CN103468718A - Highly specific gene segment of Cronobacter spp. and application thereof - Google Patents
Highly specific gene segment of Cronobacter spp. and application thereof Download PDFInfo
- Publication number
- CN103468718A CN103468718A CN2013103527731A CN201310352773A CN103468718A CN 103468718 A CN103468718 A CN 103468718A CN 2013103527731 A CN2013103527731 A CN 2013103527731A CN 201310352773 A CN201310352773 A CN 201310352773A CN 103468718 A CN103468718 A CN 103468718A
- Authority
- CN
- China
- Prior art keywords
- seq
- detection
- magnetic
- primer
- bacillus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for specific detection of Cronobacter spp. with silica magnetic microballoon and nested PCR technology based on a Cronobacter spp. 16SrDNA gene specific sequence, which is shown in the SEQID NO.1. Under specific condition, the property that silica magnetic microballoons can absorb nucleic acids is used for realizing rapid adsorption, enrichment and separation of pathogen nucleic acids in milk powder samples; two pairs of highly specific primers are designed based on Cronobacter spp. 16SrDNA gene, Cronobacter spp. specific gene is amplified by nested PCR technology, thereby realizing accurate, rapid and high sensitivity detection of Cronobacter spp. existed in the samples.
Description
Technical field
The present invention relates to biology field, be specifically related to a kind of based on Crow promise bacillus (Cronobacter spp.) 16S rDNA specific gene sequence and application thereof.
Background technology
Crow promise bacillus (original name Enterobacter sakazakii) is a kind of food source property conditioned pathogen, can cause the diseases such as serious neonatal meningitis, enterocolitis and microbemia, can cause serious nervous system injury sequela and dysplasia (Nazarowecwhite M., J.M.Farber.Enterobacter sakazakii:A review[J] .International Journal of Food Microbiology, 1997,34 (2): 103-113.).According to clinical case, show, the old man that the main infection population of Crow promise bacillus is newborn infant, premature infant and hypoimmunity, it infects lethality rate up to 20%～50%.At present, for the pollution source of Crow promise bacillus still among research.According to epidemiological study, show, most of clinical case indication source of infection is infant formula powder.
2002 the international food microbial standard council (ICMSF) Crow promise bacillus is classified as to a kind of pathogenic bacterium of " serious harm specific crowd life, cause the substantive sequela of long-term chronic ".FAO and WHO think all kinds of Crow promise bacillus be all cause a disease (Organization World Health.Enterobacter sakazakii and other microorganisms in powdered infant formula:meeting report.[J] .Microbiological risk assessment series, no.6.[Online] http://www.who.int/foodsafety/publications/micro/enterobacter_s akazakii/en/.2004.)
2004, after powdered milk sample in " doll with big head " event that China occurs in Fuyang detects Crow promise bacillus first, formulated the detection national standard in dispensed food for baby, breast and milk-product and raw material thereof for Crow promise bacillus, also formulated the industry standard of " detection method of Crow promise bacillus in milk powder " simultaneously in inspection and quarantining for import/export.Afterwards, in the inspection in China to the milk preparation of domestic production and Imported dairy products, repeated detection goes out in the milk preparation of a plurality of brands to contain Crow promise bacillus, wherein is no lack of U.S.A and praises the internationally renowned brand that minister, Hui Shi, U.S. element etc. are trusted by Chinese Consumer's deeply., just in China, in developed regions such as America and Europes, the event that contains promise bacillus in Crow in milk powder does not emerge in an endless stream yet, and it is defective and recall the formula milk product with regard to Yin Keluonuo bacillus once that U.S.A in 2004 praises minister.Visible, Crow promise bacillus does not have specific regional limitation, and this has also brought difficulty for prevention Crow promise coli infections, therefore, promise bacillus in Crow is carried out sensitive and detects and also seem particularly important accurately.
At present, still using the cellar culture method as standard for the detection method of promise bacillus in Crow in powdered milk sample both at home and abroad, its accuracy is high, but sense cycle is longer, reach 5-7 days, the operation relative complex, detection efficiency is lower, is difficult to meet modern society for food-borne pathogens testing process high-throughput, highly sensitive, high efficiency requirement.Developed successively subsequently the detection means of PCR and Fluorescence PCR assay, also in the industry standard of " detection method of Crow promise bacillus in milk powder " of China, adopted, but these two kinds of methods have higher false positive rate, finally still need to adopt the method for cultivating counting to be confirmed.
In bacterial genomes, the rDNA gene of coding 16S rRNA has the length (being about 15kb) of fit analysis, and the good variability that there is good evolution conservative simultaneously and be complementary with evolutionary distance, by variable region and constant region, formed, so become the standard identifier that bacteria molecule is identified.In research in the past, there have been some to take the PCR detection technique (people such as Lehner A who carries out as goal gene of 16S rDNA gene of Crow promise bacillus, Gene based analysis of Enterobacter sakazakii strains from different source and development of a PCR assay for identification.[J] Molecular and Cellular Probes, 2006.20 (1): 11-17), the people such as fluorescence quantitative PCR detection technique Malorny B, Detection of Enterobacter sakazakii strains by real-time PCR[J] .Journal of Food Protection.2005,68 (8): 1623-1627) and the fluorescent probe detection technique (people such as Almeida C, Development and application of a novel peptide nucleic acid oribe for the specific detection of Cronobacter genomospecies (Enterobacter sakazakii) in powered infant formula[J] .Appl.Environ.Microbiol, 2009,75 (9): 2925-2930), but generally believe that at present between each bacterial strain of Crow promise bacillus, sequence difference is larger, 16S rDNA gene specific is relatively poor, still there are the problems such as the not high or sensitivity of specificity is low.
Therefore, in order to meet testing requirement, be badly in need of setting up a set of more efficient, practical and the bacillus detection means of Crow promise accurately and method.
Summary of the invention
The object of the present invention is to provide Crow promise bacillus specific gene fragment, in conjunction with nested PCR method, realize the rapid detection to Crow promise bacillus, for the monitoring of food safety provide a kind of efficiently, detection method accurately.
To achieve these goals, the technical solution used in the present invention is as follows:
The high specific gene fragment of Crow promise bacillus (Cronobacter spp.), its nucleotides sequence is classified nucleotide sequence as shown in SEQ ID NO.1 or the nucleotide sequence complementary with it as.
The application of described high specific gene fragment in detecting Crow promise bacillus, comprise the following steps:
(1) using nucleotide sequence claimed in claim 1 as aim sequence, design two pairs of nest-type PRC primers, described first pair of primer is
VicF1：5′-TCGTGCTGCGAGTTTGAGAG-3′（SEQ ID NO.2），
VicR1：5′-CCTCGCGTGCTCACACAG-3′（SEQ ID NO.3），
Described second pair of primer is
VicF2：5′-AGAGACTCTGACACACCGCG-3′（SEQ ID NO.4），
VicR2：5′-AATGAGTGAAAGGCGTTACCG-3′（SEQ ID NO.5）；
(2) will detect sample and carry out boiling water bath 5-15 minute, the Crow promise bacillus in the described detection sample of cracking, discharge genomic dna;
(3) silicone dioxide magnetic microsphere and high reactant salt liquid are joined to step 2) in the detection sample processed with absorption nucleic acid, then by magnetic, separates the nucleic acid of described silicone dioxide magnetic microsphere absorption is separated from the detection sample;
(4) take isolated nucleic acid as template, utilize the described first pair of primer of step 1) and second pair of primer to carry out the nest-type PRC detection, determine in described detection sample whether contain described aim sequence;
Wherein said step 2) preferred 8-12 minute of boiling water bath time in;
In described step 3) by silicone dioxide magnetic microsphere and high reactant salt liquid (3M NaCl, 2M KCl) join in the described detection sample after processing with absorption nucleic acid, carry out the magnetic separation on magnetic frame, abandon supernatant, and with after 80% ethanolic soln washing magnetic bead 3-5 time, with 10 μ lddH
2the resuspended silicone dioxide magnetic microsphere of O, after 80 ℃ of water-bath 10min, magnetic frame separates, and gets supernatant as detecting template;
(5) using nucleotide sequence claimed in claim 1 as aim sequence, designing two pairs of nest-type PRC primers is nucleic acid probe.
Described first pair of primer is
VicF1：5′-TCGTGCTGCGAGTTTGAGAG-3′（SEQ ID NO.2），
VicR1：5′-CCTCGCGTGCTCACACAG-3′（SEQ ID NO.3），
Described second pair of primer is
VicF2：5′-AGAGACTCTGACACACCGCG-3′（SEQ ID NO.4），
VicR2：5′-AATGAGTGAAAGGCGTTACCG-3′（SEQ ID NO.5）。
Described nucleic acid probe is preferably 5 '-TCGTGCTGCGAGTTTGAGAG-3 ' (SEQ ID NO:2).
High specific gene fragment provided by the invention can detect the Crow promise bacillus in milk powder, can be milk, milk powder or cheese, is more preferably baby formula milk powder.
The present invention has following advantage:
1, the nucleotide sequence of Crow promise bacillus (Cronobacter spp.) the 16SrDNA gene fragment of high specific of the present invention, each bacterial strain of Crow promise bacillus is had to good specificity, classify with this nucleotides sequence the detection specificity that aim sequence carries out as high, false positive rate is low;
2, the present invention adopts silicone dioxide magnetic microsphere absorption to detect the whole nucleic acid in sample, has separated and enrichment the sensitivity that the PCR carried out after having improved detects by magnetic;
3, the present invention utilizes silicone dioxide magnetic microsphere can adsorb the character of nucleic acid under given conditions, realizes quick adsorption and enrichment to pathogenic bacteria nucleic acid in sample; Utilize two pairs of high specific primers of Crow promise bacillus 16S rDNA gene, in conjunction with Nested PCR Technique, realize that the specificity goal gene to detecting the Crow promise bacillus in sample is detected.Amplification is taken turns in first round amplification and second in nest-type PRC all has higher specificity to goal gene, therefore can reduce significantly false positive rate, thereby increases the accuracy detected.
The accompanying drawing explanation
The different cell concentration pure growth of Fig. 1 pattern detection collection of illustrative plates.
The milk powder pattern detection collection of illustrative plates of the different cell concentrations of Fig. 2.
The detection collection of illustrative plates of the milk powder sample of the different concns Crow promise bacillus that Fig. 3 contains the high density miscellaneous bacteria.
Annotate: M:DL2000DNA Marker; N: negative control.
Embodiment
Further illustrate technical scheme of the present invention below in conjunction with accompanying drawing and by embodiment.
Embodiment 1: the obtaining of specific gene fragment
1, utilize 16S rDNA universal primer:
F341：5′-CCTACGGGAGGCAGCAG-3′（SEQ ID NO.6），
R518：5′-ATTACCGCGGCTGCTGG-3′（SEQ ID NO.7）；
Using Crow promise vaccae genomic dna as template, and amplification obtains aim sequence.PCR reaction system (50 μ l): 2 * PFU mix25 μ l, primer V3F/V3R(1 μ M) respectively get 1.5 μ l, genomic dna 2 μ l, sterilized water 20 μ l.The PCR reaction conditions is: 95 ℃ of denaturation 5min; 95 ℃ of sex change 30s, 54 ℃ of annealing 30s, 72 ℃ are extended 3min, 20 circulations; 72 ℃ are extended 10min eventually.
2, obtain detailed sequence information by order-checking, utilize the Blast instrument compare of analysis screening of NCBI to obtain the high fragment of conservative property the sequence of acquisition, with Crow promise bacillus matching rate, up to more than 98%, but not the matching rate of Crow promise bacillus is standard lower than 80%;
3, choose the sequence at two ends, and with the last base of primer end only with Crow promise bacillus sequences match, and be not the standard design specificity amplification primer with Fei Keluonuo bacillus sequences match, and utilize the primer pair Crow promise bacillus of design and the genomic dna of Fei Keluonuo bacillus to carry out the augmentation detection checking;
4, the not homotactic result of choosing is compared and selects, finally obtained the one section 16S rDNA gene fragment that different Crow promise bacillus strains is all had to high specific, its sequence is:
TCGTGCTGCGAGTTTGAGAGACTCTGACACACCGCGCATTCCTGATTACGGAGAAATGCAGCAGCATGTCTGTTTCAATTTTCAGCTTGTTCCGGATTGTTAAAGAGCAAATATCTCAAACGTGACTTTACAGTCAGTTTTGAGATATTAATCGGTAACGCCTTTCACTCATTACCAGCAGGTGGCGTCCCTTAGGGGATTCGAACCCCTGTTACCGCCGTGAAAGGGCGGTGTCCTGGGCCTCTAGACGAAAGGGACTTCGCTTTCGCAGACAACCCTGCTTCTTTACTTTCTATCAGACAATCTGTGTGAGCACGCGAGG（SEQ ID NO：1）。
The checking of embodiment 2:PCR primer specificity
1, the design of primer:
Using in embodiment 1 screened the specific sequence that obtains as aim sequence as template, design Crow promise bacillus specificity amplification primer, primer sequence is as follows:
VicF1：5′-TCGTGCTGCGAGTTTGAGAG-3′（SEQ ID NO.2）
VicR1：5′-CCTCGCGTGCTCACACAG-3′（SEQ ID NO.3）
VicF2：5′-AGAGACTCTGACACACCGCG-3′（SEQ ID NO.4）
VicR2：5′-AATGAGTGAAAGGCGTTACCG-3′（SEQ ID NO.5）
2, the checking of primer specificity
The genomic dna of 31 strain Crow promise bacillus and 21 strain Fei Keluonuo bacillus of take is template, and the specificity by nest-type PRC augmentation detection checking primer VicF1/VicR1 and VicF2/VicR2, the results are shown in Table 1, and step is as follows:
Get each strain gene group DNA template and carry out the amplification of the nest-type PRC first round, PCR reaction system (25 μ l): 2 * Taq mix12.5 μ l, primer VicF1/VicR1(1 μ M) respectively get 0.75 μ l, genomic dna 10 μ l, sterilized water 1 μ l.The PCR reaction conditions is: 95 ℃ of denaturation 5min; 95 ℃ of sex change 30s, 62 ℃ of annealing 30s, 72 ℃ are extended 25s, 20 circulations; 72 ℃ of 10min.
Second takes turns pcr amplification, with 100 times of diluents of first round PCR product, as the second template of taking turns pcr amplification, uses primer VicF2/VicR2 in the PCR system instead and is increased, and other conditions are constant.
After PCR completes, get 10 μ l second and take turns in the sepharose that pcr amplification product is 1.5% (w/v) in concentration and carry out electrophoresis (deposition condition is 5V/cm), utilize gel imaging system observe electrophoresis result and analyze, in Table 1.
Primer pair Crow promise bacillus in the present invention has good specificity as can be seen here.
Table 1 nest-type PRC primer specificity detected result
ajX-CDC, disease prevention and control center, Jiangxi Province, China;
bsKLF, Food science and technology National Key Laboratory, China;
ccMCC, Chinese medicine DSMZ, China;
daTCC, U.S. typical case DSMZ, the U.S..“+”
Mean the PCR positive as a result, " _ " means PCR feminine gender as a result.
Embodiment 3: the pattern detection application of silicone dioxide magnetic microsphere
1, the pure growth sample of different concns Crow promise bacillus detected
Utilize silicone dioxide magnetic microsphere (10mg/ml, purchased from Zhengzhou English promise bio tech ltd for Magpearl Silica, 0.3-0.5 μ m) and Nested PCR Technique to carry out specific detection to Crow promise bacillus pure growth sample.With aseptic 0.01M PBS gradient dilution Crow promise bacillus pure growth, obtain the cell concentration gradient and be: 10
7, 10
6, 10
5, 10
4, 10
3, 10
2, 10
1, 10
0the sample of CFU/ml,, get the 1ml sterilized water simultaneously and join in the 2ml centrifuge tube as negative control as sample to be detected to the mycelium dilution liquid that adds successively the 1ml different concns in the centrifuge tube of each 2ml.Centrifuge tube is placed in to boiling water bath 10min, with lysing cell, discharges genomic dna; Add 700uL high level salt solution (3M NaCl in centrifuge tube, 2M KCl) and 10uL silicone dioxide magnetic microsphere solution (10mg/ml), after utilizing the whirlpool mixed instrument to be put upside down to mix 20min, magnetic frame separates 1min, reclaiming magnetic bead and abandon supernatant, then add 800uL80%(v/v) after ethanolic soln washing magnetic bead 3 times, magnetic frame separates 1min, reclaim magnetic bead and abandon supernatant, 60 ℃ of baking ovens are placed 3min; With the aseptic ddH of 10 μ l
2the resuspended silicone dioxide magnetic microsphere of O, after 80 ℃ of water-bath 10min, magnetic frame separates 1min, get supernatant as detecting template for the nest-type PRC detection validation, nest-type PRC first round amplification, PCR reaction system (25 μ l): 2 * Taq mix12.5 μ l, primer VicF1/VicR1(1 μ M) respectively get 0.75 μ l, genomic dna 10 μ l, sterilized water 1 μ l.The PCR reaction conditions is: 95 ℃ of denaturation 5min; 95 ℃ of sex change 30s, 62 ℃ of annealing 30s, 72 ℃ are extended 25s, 20 circulations; 72 ℃ are extended 10min eventually.
Second takes turns pcr amplification, with 100 times of diluents of first round PCR product, as the second template of taking turns pcr amplification, uses primer VicF2/VicR2 in the PCR system instead and is increased, and other conditions are constant.
After PCR completes, getting 10 μ l second takes turns in the sepharose that pcr amplification product is 1.5% (w/v) in concentration and carries out electrophoresis (deposition condition is 5V/cm), utilize gel imaging system observe electrophoresis result and analyze, electrophoresis result is shown in Fig. 1, and known present method can reach 10 to the lowest detection line of the sample of Crow promise bacillus pure culture
0cFU/ml.
2, the milk powder sample of different concns Crow promise bacillus detected:
The preparation of milk powder sample is fully dissolved and is mixed with the 9ml sterilized water according to 1g milk powder (having verified not containing Crow promise bacillus); The Crow promise bacillus thalline of fresh culture is carried out to gradient dilution in powdered milk sample, and obtaining respectively concentration is 10
7, 10
6, 10
5, 10
4, 10
3, 10
2, 10
1, 10
0the milk powder sample of CFU/ml Crow promise bacillus, respectively fill the mycelium dilution liquid of 1ml different concns as sample to be detected in the centrifuge tube of each 2ml.Silicone dioxide magnetic microsphere catch and the PCR detecting step same as above, electrophoresis detection the results are shown in Figure 2, known present method can reach 10 to the lowest detection line of the Crow promise bacillus in the milk powder sample
1cFU/ml.
3, the milk powder sample of the different concns Crow promise bacillus that contains the high density miscellaneous bacteria detected:
Whether can affect the detection sensitivity of the method in order to simulate and investigate the high density miscellaneous bacteria that may exist in sample, in the milk powder sample to different concns Crow promise bacillus, add the miscellaneous bacteria (10 of high density
8the Salmonellas ATCC13311 of CFU/ml), and utilize silicone dioxide magnetic microsphere to adsorb and the detection of Chao Shi pcr amplification, Fig. 3 is shown in by the electrophoresis detection collection of illustrative plates, under the condition that known present method is disturbed the high density Salmonellas, to the lowest detection line of the Crow promise bacillus in the milk powder sample, still can reach 10
1cFU/ml, illustrate this experimental technique in the situation that the high density miscellaneous bacteria is disturbed, and still can maintain former detection sensitivity.
4, to the detection of actual sample:
20 parts of infant formula powders (having verified without Crow promise bacillus), artificial doping different concns Crow promise bacillus pure growth in above-mentioned infant formula powder, 80 parts, preparation artificial contamination sample; Milk powder sample and 20 parts of pollution-free milk powder samples to these 80 parts of artificial contamination Crow promise bacillus carry out carrying out sample process and detection according to aforesaid method.The detected result data statistics is in Table 2.
Table 2. actual sample detected result
Milk powder sample and the 20 parts of free of contamination milk powder samples of these 80 parts of artificial contamination Crow promise bacillus are carried out to traditional cultivation count detection simultaneously, found that and adopt method of the present invention to be detected two routine false-negative samples, the non-false positive sample detects.
Applicant's statement, the present invention illustrates detailed construction feature of the present invention and method by above-described embodiment, but the present invention is not limited to above-mentioned detailed construction feature and method, do not mean that the present invention must rely on above-mentioned detailed construction feature and method could be implemented.The person of ordinary skill in the field should understand, any improvement in the present invention, to the increase of the equivalence replacement of the selected parts of the present invention and accessory, the selection of concrete mode etc., within all dropping on protection scope of the present invention and open scope.
<110 > Wuxi Zhongde Bore Bioisystech Co., Ltd
<120 > high specific gene fragment and the application thereof of Crow promise bacillus
<130>
<160> 7
<170> PatentIn version 3.3
<210> 1
<211> 322
<212> DNA
<213 > artificial sequence
<400> 1
tcgtgctgcg agtttgagag actctgacac accgcgcatt cctgattacg gagaaatgca 60
gcagcatgtc tgtttcaatt ttcagcttgt tccggattgt taaagagcaa atatctcaaa 120
cgtgacttta cagtcagttt tgagatatta atcggtaacg cctttcactc attaccagca 180
ggtggcgtcc cttaggggat tcgaacccct gttaccgccg tgaaagggcg gtgtcctggg 240
cctctagacg aaagggactt cgctttcgca gacaaccctg cttctttact ttctatcaga 300
caatctgtgt gagcacgcga gg 322
<210> 2
<211> 20
<212> DNA
<213 > artificial sequence
<400> 2
tcgtgctgcg agtttgagag 20
<210> 3
<211> 18
<212> DNA
<213 > artificial sequence
<400> 3
cctcgcgtgc tcacacag 18
<210> 4
<211> 20
<212> DNA
<213 > artificial sequence
<400> 4
agagactctg acacaccgcg 20
<210> 5
<211> 21
<212> DNA
<213 > artificial sequence
<400> 5
aatgagtgaa aggcgttacc g 21
<210> 6
<211> 17
<212> DNA
<213 > artificial sequence
<400> 6
cctacgggag gcagcag 17
<210> 7
<211> 17
<212> DNA
<213 > artificial sequence
<400> 7
attaccgcgg ctgctgg 17
Claims (4)
- Crow promise bacillus ( cronobacter spp.) the high specific gene fragment, its nucleotides sequence is classified nucleotide sequence as shown in SEQ ID NO.1 or the nucleotide sequence complementary with it as.
- 2. the application of high specific gene fragment claimed in claim 1 in detecting Crow promise bacillus.
- 3. application as claimed in claim 2, is characterized in that comprising the following steps:(1) using nucleotide sequence claimed in claim 1 as aim sequence, design two pairs of nest-type PRC primers, described first pair of primer isVicF1：5′-TCGTGCTGCGAGTTTGAGAG-3′（SEQ ID NO.2），VicR1：5′-CCTCGCGTGCTCACACAG-3′（SEQ ID NO.3），Described second pair of primer isVicF2：5′-AGAGACTCTGACACACCGCG-3′（SEQ ID NO.4），VicR2：5′-AATGAGTGAAAGGCGTTACCG-3′（SEQ ID NO.5）；(2) will detect sample and carry out boiling water bath 5-15 minute, the Crow promise bacillus in the described detection sample of cracking, discharge genomic dna;(3) silicone dioxide magnetic microsphere and high reactant salt liquid are joined to step 2) in the detection sample processed with absorption nucleic acid, then by magnetic, separates the nucleic acid of described silicone dioxide magnetic microsphere absorption is separated from the detection sample;(4) take isolated nucleic acid as template, utilize the described first pair of primer of step 1) and second pair of primer to carry out the nest-type PRC detection, determine in described detection sample whether contain described aim sequence.
- 4. application as claimed in claim 3 is characterized in that: the preferred 8-12 minute of boiling water bath described step 2); Magnetic described in step 3) separates concrete steps: silicone dioxide magnetic microsphere and high reactant salt liquid are joined to step 2) in the detection sample processed, carry out the magnetic separation on magnetic frame, abandon supernatant, and with after 80% ethanolic soln washing magnetic bead 3-5 time, with 10 μ l ddH 2the resuspended silicone dioxide magnetic microsphere of O, after 80 ℃ of water-bath 10 min, magnetic frame separates.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013103527731A CN103468718A (en) | 2013-08-14 | 2013-08-14 | Highly specific gene segment of Cronobacter spp. and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013103527731A CN103468718A (en) | 2013-08-14 | 2013-08-14 | Highly specific gene segment of Cronobacter spp. and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103468718A true CN103468718A (en) | 2013-12-25 |
Family
ID=49793759
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2013103527731A Pending CN103468718A (en) | 2013-08-14 | 2013-08-14 | Highly specific gene segment of Cronobacter spp. and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103468718A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104593487A (en) * | 2014-12-15 | 2015-05-06 | 合肥工业大学 | PCR-RFLP molecular subtyping method for distinguishing different types of cronobacters |
| WO2022141941A1 (en) * | 2020-12-30 | 2022-07-07 | 广东省科学院微生物研究所(广东省微生物分析检测中心) | Cronobacter standard strains containing specific molecular target, and detection and use thereof |
-
2013
- 2013-08-14 CN CN2013103527731A patent/CN103468718A/en active Pending
Non-Patent Citations (3)
| Title |
|---|
| KUCEROVA, E.,ET AL: "GENBANK:CP000783.1", 《NCBI》, 28 December 2010 (2010-12-28) * |
| YIN LIU，ET AL: "Real time PCR using TaqMan and SYBR Green for detection of Enterobacter sakazakii in infant formula", 《JOURNAL OF MICROBIOLOGICAL METHODS》, vol. 65, 3 August 2005 (2005-08-03), pages 21 - 31 * |
| YOSHITSUGU OCHIAI, ET AL: "Detection and Discrimination of Cryptosporidium parvum and C. hominis in Water Samples by Immunomagnetic Separation-PCR", 《APPLIED AND ENVIRONMENTAL MICROBIOLOGY》, vol. 71, no. 2, 28 February 2005 (2005-02-28), pages 898 - 903 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104593487A (en) * | 2014-12-15 | 2015-05-06 | 合肥工业大学 | PCR-RFLP molecular subtyping method for distinguishing different types of cronobacters |
| WO2022141941A1 (en) * | 2020-12-30 | 2022-07-07 | 广东省科学院微生物研究所(广东省微生物分析检测中心) | Cronobacter standard strains containing specific molecular target, and detection and use thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Turroni et al. | Exploring the diversity of the bifidobacterial population in the human intestinal tract | |
| Leyla et al. | Comparison of polymerase chain reaction and bacteriological culture for the diagnosis of sheep brucellosis using aborted fetus samples | |
| CN102816761B (en) | The high specific gene fragment of Enterobacter sakazakii and application thereof | |
| CN102146466B (en) | Reagent for detecting brucella and complex probe fluorescence quantitative PCR (polymerase chain reaction) brucella detection method | |
| Oliveira et al. | Enterotoxin production, enterotoxin gene distribution, and genetic diversity of Staphylococcus aureus recovered from milk of cows with subclinical mastitis | |
| CN103290119B (en) | Quintuple PCR (polymerase chain reaction) rapid detection method for main pathogenic bacteria in pork | |
| Choo et al. | Prevalence and genetic diversity of Bacillus cereus in dried red pepper in Korea | |
| CN104450940B (en) | A kind of nucleotide sequence and detection method and detection kit for detecting Listeria Monocytogenes | |
| CN107746890A (en) | Identify the multiple PCR detection primer and method of Listeria monocytogenes serotype | |
| Afshari et al. | Genotyping of Clostridium perfringens isolated from broiler meat in northeastern of Iran | |
| CN110229916A (en) | A kind of primer of Escherichia coli specific gene and the method for detecting Escherichia coli | |
| Razmyar et al. | Toxigenic Clostridium difficile in retail packed chicken meat and broiler flocks in northeastern Iran | |
| Zhang et al. | Brucella melitensis isolated from aborted cow and sheep fetuses in northwest of China | |
| Ghosh et al. | A comparative study of conventional and molecular techniques in diagnosis of campylobacter gastroenteritis in children | |
| Kim et al. | Rapid and specific detection of Burkholderia glumae in rice seed by real-time Bio-PCR using species-specific primers based on an rhs family gene | |
| Kot et al. | Application of multiplex PCR for monitoring colonization of pig tonsils by Yersinia enterocolitica, including biotype 1A, and Yersinia pseudotuberculosis | |
| Oh et al. | Prevalence and genetic characteristics of meatborne Listeria monocytogenes isolates from livestock farms in Korea | |
| CN103468718A (en) | Highly specific gene segment of Cronobacter spp. and application thereof | |
| CN104017873B (en) | A multiple PCR primer used for simultaneously detecting five pathogenic bacteria and three virulence genes in marine, and a designing method thereof | |
| CN109811073B (en) | Primer for rapidly detecting streptococcus agalactiae and streptococcus iniae at early stage by double PCR (polymerase chain reaction) and application of primer | |
| CN112795673B (en) | CRISPR (clustered regularly interspaced short palindromic repeats) detection method for Cronobacter in food and kit thereof | |
| da Silva et al. | Characterization and evaluation of some virulence markers of Listeria monocytogenes strains isolated from Brazilian cheeses using molecular, biochemical and serotyping techniques | |
| CN111057776B (en) | Listeria and 6 common Listeria specific novel molecular targets and rapid detection method thereof | |
| Shayegh et al. | POTENTIAL OF PASTEURELLA MULTOCIDA ISOLATED FROM HEALTHY AND DISEASED CATTLE | |
| Abd El Tawab et al. | Molecular screening of virulence genes in avian pathogenic esherichia coli |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20131225 |