CN103468704B - Peptidoglycan binding protein BjApextrin2, as well as gene, production method and application thereof - Google Patents
Peptidoglycan binding protein BjApextrin2, as well as gene, production method and application thereof Download PDFInfo
- Publication number
- CN103468704B CN103468704B CN201310385551.XA CN201310385551A CN103468704B CN 103468704 B CN103468704 B CN 103468704B CN 201310385551 A CN201310385551 A CN 201310385551A CN 103468704 B CN103468704 B CN 103468704B
- Authority
- CN
- China
- Prior art keywords
- sequence
- gene
- albumen
- pet32a
- peptidoglycan
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Abstract
The invention relates to two peptidoglycan binding proteins, coding genes BjApextrin1 and BjApextrin2 of the peptidoglycan binding proteins, and an application of the proteins in preparing a drug for treating infectious diseases. The amphioxus genes BjApextrin1 and BjApextrin2 are separated from a digestive tract of a Chinese amphioxus through 5' RACE and 3' RACE according to the existing EST (Expressed Sequence Tag) sequence, and DNA (Deoxyribonucleic Acid) sequences of the genes are shown as a sequence 1 and a sequence 2 in a sequence table. Amino acid sequences of the proteins (BjApextrin1 and BjApextrin2) coded by the genes are shown as a sequence 3 and a sequence 4 in the sequence table. The proteins coded by the genes BjApextrin1 and BjApextrin2 can identify and agglutinate gram-positive bacteria, is specifically bound with a biomacromolecule peptidoglycan on the surfaces of the bacteria, and can be used for preparing the drug for treating the infectious diseases.
Description
The application is application number 201210439488.9, the applying date is on January 6th, 2012, and denomination of invention is the divisional application of " peptidoglycan associated proteins BjApextrin1 and BjApextrin2 and gene, production method and application ".
Technical field
The present invention relates to a kind of peptidoglycan binding-protein gene of novelty and the protein B jApextrin1 of coding and BjApextrin2 thereof, and the application of this albumen in preparation treatment infectious disease medicament.
Background technology
Branchiostoma is in Chordata (Chordata), Cephalochordata (Cephalochordata), being that questions of invertebrate evolution arrives vertebrate transitional type, is the similar model of vertebrates original ancestry before 500,000,000 years, is the good material of research vertebrate animal development all the time.In recent years, the research of the immunity of lancelet is caused and payes attention to widely, found many significant immunogenes wherein.
Peptidoglycan (Peptidoglycan, PGN) be one of the main component of cell walls of nearly all bacterium, especially be rich in gram-positive microorganism, also be a kind of important pathogeny associated molecular pattern (Pathogen-associated molecular patterns, PAMPs) of the invasion of host's perception pathogenic bacteria, activate immunity reaction.Peptidoglycan can by various modes identification molecular recognition, as peptidoglycan recognition protein (Peptidoglycan recognition proteins, PGRPs), and Toll-like receptor 2(Toll-like receptor2, TLR2) etc.
Haag etc. use difference aobvious technology to be contrasted by sea urchins different for fetal development pattern, gene expression abundance is apparently higher than the tubercle sea urchin of indirect development in the embryo of the Red sea courage (Heliocidaris erythrogramma) of direct development pattern to find Apextrin, and embryonic in situ hybridization display Apextrin specifically expressing is in the ectoderm of Anthocidaris crassispina embryo.Immunohistochemical experiment proves that Apextrin albumen is stored in inside ovum with the form of secretory vacuole, secretion is started gradually after ovum completes fertilization, when embryo's Apextrin albumen after polarization blastula stage is just positioned embryo top extracellular matrix, therefore be called top extracellular matrix protein (Apical extracellular matrix protein, Apextrin).People are again respectively hydra subsequently, find Apextrin gene in coral, and embryonic in situ hybridization display Apextrin also may take part in the embryo development procedure of hydra and coral.
The expression amount of lancelet Apextrin gene has raised thousands of times after bacterium stimulates 12h; The expression amount of Red sea courage Apextrin albumen after being subject to vibrio infection 20h also significantly increases.We find that the Apextrin of lancelet can identify and aggegation gram-positive microorganism, and the biomacromolecule peptidoglycan of specific combination bacterium surface, can be used for, as the medicine of preparation treatment infectious diseases, in the field such as aquaculture, medical and health, there is wide DEVELOPMENT PROSPECT.
Summary of the invention
The object of the present invention is to provide the gene of a kind of new peptidoglycan associated proteins BjApextrin1 and BjApextrin2 and this albumen of encoding.
Another object of the present invention is to the production method that this albumen is provided.
3rd object of the present invention is to provide the application of this albumen in preparation treatment infectious disease medicament.
The present invention is according to existing est sequence by 5 ' and 3 ' RACE, and from the digestive tube of Chinese Amphioxus, separation obtains lancelet BjApextrin1 and BjApextrin2 gene, and its DNA sequence dna is as shown in sequence in sequence table 1 and sequence 2 sequence.
The protein B jApextrin1 of genes encoding of the present invention and BjApextrin2, its aminoacid sequence is as shown in sequence in sequence table 3 and sequence 4 sequence; This albumen iso-electric point is respectively 6.05 and 5.03, and molecular weight is respectively 56,671 and 52,516 dalton.
BjApextrin1 and BjApextrin2 is cloned on coli expression carrier pET32a, obtains recombinant expression vector pET32a-BjApextrin1 and pET32a-BjApextrin2.
This albumen can be expressed with insoluble inclusion bodies intestinal bacteria by expression vector pET32a-BjApextrin1 and pET32a-BjApextrin2.
Described expression vector pET32a-BjApextrin1 and pET32a-BjApextrin2 take Trx as the amalgamation and expression companion body, and this system makes BjApextrin1 and the BjApextrin2 inclusion body of expression correctly be folded into solvable albumen by refolding strategy under the help of Trx.
Qingdao branchiostoma (Branchiostoma japonicum) selected by the present invention is collected in Shandong Province's sand Estuary Waters.
The present invention is according to existing est sequence by 5 ' and 3 ' RACE, and from the digestive tube of Chinese Amphioxus, separation obtains lancelet BjApextrin1 and BjApextrin2 gene (its DNA sequence dna is as shown in sequence in sequence table 1 and sequence 2 sequence).Coding 504 and 462 amino acid (its aminoacid sequence is as shown in sequence in sequence table 3 and sequence 4 sequence) respectively, iso-electric point is respectively 6.05 and 5.03, and molecular weight is respectively 56,671 and 52,516 dalton.
Gene BjApextrin1 and BjApextrin2, by devising two pairs of primers, is cloned into coli expression carrier pET32a(Novagen company by the present invention), construction expression plasmid and by its transformation of E. coli BL21(DE3).Expression vector pET32a-BjApextrin1 and pET32a-BjApextrin2 take Trx as the amalgamation and expression companion body, and this system makes BjApextrin1 and the BjApextrin2 inclusion body of expression correctly be folded into solvable albumen by refolding strategy under the help of Trx.This recombinant protein is encoded 670 and 628 amino acid respectively, and iso-electric point is respectively 5.80 and 5.14, and molecular weight is respectively 74,374 and 70,219 dalton.By to incubation time, induction time, the groping and optimize of the conditions such as temperature, the expression amount of BjApextrin1 and BjApextrin2 fusion rotein is higher, and the overwhelming majority exists with soluble inclusion bodies.
The present invention also gropes and optimizes the purification condition of BjApextrin1 and BjApextrin2 recombinant protein, and after thalline carries out ultrasonication, centrifuging and taking precipitation is carried out refolding strategy and can be obtained purer albumen.
Expression plasmid clone method of the present invention: with reference to Sambrook(Sambrook, et al.1989, Molecular cloing.Cold Spring Harbor Labroratory Press.USA) method, use CaCl
2method by Plastid transformation E.coli.DH5 α or BL21(DE3) bacterial strain, transform bacterial strain by the LB culture medium culturing containing penbritin (100 μ g/mL), extract plasmid with Omega company test kit.
The present invention demonstrates this recombinant protein by bacterium binding tests and has activity in conjunction with gram positive bacterium.Bacterial agglutination experiment shows that this recombinant protein can make middenstead coccus and staphylococcus aureus generation aggegation.Enzyme-linked immunosorbent assay (Enzyme-linked-immunosorbent assay, ELISA) show that this recombinant protein can combine in peptidoglycan specifically, fusion rotein and peptidoglycan do drop-down experiment (Pulldown assay) and show that this recombinant protein strengthens with the increase of peptidoglycan concentration the binding activities of peptidoglycan.
By building deletion mutant, we find that the pattern recognition function of BjApextrin1 is that the one section of conserved sequence held by C determines.
Accompanying drawing explanation
Fig. 1 a and Fig. 1 b is respectively 5 ' RACE and 3 ' RACE and increases BjApextrin1 and the BjApextrin2 gene object fragment obtained.1.5 ' RACE amplified fragments; 2.3 ' RACE amplified fragments; 3.DNA molecular weight standard (DL2000).
Fig. 2 a and Fig. 2 b is respectively BjApextrin1 and the BjApextrin2 full length gene fragment increasing and obtain.
Fig. 3 is recombinant expression plasmid pET32a-BjApextrin1 and pET32a-BjApextrin2 design of graphics.
Fig. 4 a and Fig. 4 b is respectively the protein induced expression of restructuring BjApextrin1 and BjApextrin2, refolding strategy purifying electrophorogram.M, protein marker; 1, the ultrasonic supernatant of not inducing; 2, the ultrasound precipitation of not inducing; 3, the ultrasonic supernatant of induction; 4, the ultrasound precipitation of induction; 5, TRX-Apextrin1 and TRX-Apextrin2 after purifying.
Fig. 5 is the bacterium binding tests result of recombinant protein BjApextrin1 and BjApextrin2: by about 2 × 10
7individual various different bacterium TBS(pH7.5) after washing balance, with 1 μ g target protein at 1ml TBS(pH7.5) 4 DEG C of oscillation incubations spend the night in damping fluid; 4 DEG C, the centrifugal 1min of 12000 × g, precipitation 1ml TBS damping fluid washes 5 times; With the resuspended thalline of 100 μ l TBS, then add 20 μ l6 × sample-loading buffers, boil after mixing and boil 10min; Then carry out Western blot analysis, carry out testing goal albumen by His monoclonal antibody, Sepharose4B bead carries out parallel laboratory test as negative control.
Fig. 6 is the bacterial agglutination experimental result of recombinant protein BjApextrin1 and BjApextrin2: hatch, enterococcus faecalis labeled for FITC and streptococcus aureus and recombinant protein in the aggegation situation of fluorescent microscope norma basilaris micrometer biology altogether.
Fig. 7 a and Fig. 7 b is respectively the ELISA experimental result of recombinant protein BjApextrin1 and BjApextrin2 and bacteria cell wall pure component: recombinant protein carries out ELISA experiment with LPS, LTA, PGN, Mannan and Zymosan respectively.
Fig. 8 is recombinant protein BjApextrin1 and BjApextrin2 and peptidoglycan Pulldown experimental result: 1 μ g target protein is carried out Pulldown experiment with the PGN of 5,10,20,50 μ g respectively.
Fig. 9 is recombinant protein BjApextrin1 deletion mutant abduction delivering, refolding strategy purifying electrophorogram.M, protein marker; 1st swimming lane, the ultrasonic supernatant of TRX-△ C of not inducing; 2nd swimming lane, the TRX-△ C ultrasound precipitation of not inducing; 3rd swimming lane, the ultrasonic supernatant of TRX-△ C of induction; 4th swimming lane, the TRX-△ C ultrasound precipitation of induction; 5th swimming lane, the TRX-△ C after purifying; 6th swimming lane, the ultrasonic supernatant of TRX-△ N of not inducing; 7th swimming lane, the TRX-△ N ultrasound precipitation of not inducing; 8th swimming lane, the ultrasonic supernatant of TRX-△ N of induction; 9th swimming lane, the TRX-△ N ultrasound precipitation of induction; 10th swimming lane, the TRX-△ N after purifying.
Figure 10 a and 10b is respectively the peptidoglycan PGN(S.a in recombinant protein BjApextrin1 deletion mutant and streptococcus aureus source place) and the peptidoglycan PGN(B.s that originates of subtilis) ELISA experimental result.
Embodiment
Below implement to contribute to those of ordinary skill in the art and understand the present invention further, but do not limit the present invention in any form.
Embodiment 1: the extraction of Chinese Amphioxus digestive tube total serum IgE and the synthesis of cDNA
The extraction of total serum IgE and RACE cDNA synthesize: collect Chinese Amphioxus digestive tube, adopt Trizol reagent method to extract digestive tube total serum IgE.Get 1 μ g total serum IgE, according to TOYOBO company cDNA mono-chain synthetic agent box (ReverTra Ace-α-
tM, code No.FSK-100) and synthesis cDNA mono-chain is described.Adopt the GeneRacer of Invitrogen
tMkit is according to explanation synthesis RACE cDNA mono-chain.
Embodiment 2:RACE amplification BjApextrin1 and BjApextrin2 gene 5 ' and 3 ' end.
Gene-specific primer according to the 5 ' RACE amplification of known est sequence design BjApextrin1 is 5 '-GSP:5 '-CGTCATCTTCATCGTCCCA ACGGAA-3 '; The gene-specific primer of the 3 ' RACE amplification of BjApextrin1 is 3 '-GSP:5 '-TTCCGCTTGGGACGATGAAGATG-3 '.The gene-specific primer of the 5 ' RACE amplification of BjApextrin2 is 5 '-GSP:5 '-CGTCTTCATCGTCCCACCGGAA-3 '; The gene-specific primer of the 3 ' RACE amplification of BjApextrin2 is 3 '-GSP:5 '-TTCCGGTGGGACGATGAAGAC-3 '.Adopt the LA Taq polysaccharase of Takara company according to GeneRacer
tMthe reaction system of Kit carries out pcr amplification.The current fragment that amplification obtains is as Fig. 1.Object fragment is connected to pGEX Teasy vector(promega) transformation of E. coli DH5 α afterwards, selects recombinant clone order-checking.The full length sequence of BjApextrin1 and BjApextrin2 gene is obtained after being spliced by the sequencing result of 5 ' RACE and 3 ' RACE.The full length sequence of BjApextrin1 contains the open reading frame (open reading frame, ORF) that a length is 1515bp, 504 amino acid whose albumen of encoding; The full length sequence of BjApextrin2 contains the open reading frame (open reading frame, ORF) that a length is 1389bp, 462 amino acid whose albumen of encoding.
The amplification of embodiment 3:BjApextrin1 and BjApextrin2 full length gene sequence and analysis.
According to the PCR primer 5 '-AACGGCGGTTCTTCTCTGA-3 ' and the 5 '-TGTAGTCGCATCAAGCTCTTTATT-3 ' that splice the sequences Design BjApextrin1 full length gene sequence obtained above; The PCR primer 5 '-CAAAGGAACGTCAGAACATTC-3 ' of BjApextrin2 full length gene sequence and 5 '-TTTAGAGTGAGCCAGTTTGT-3 ', adopt the full genome of the LA Taq polymeric enzymatic amplification BjApextrin1 of Takara, 1578bp and the 1433bp fragment that obtains of increasing respectively, electrophoretogram is as Fig. 2.The object fragment that obtains of increasing is connected to transformation of E. coli DH5 α after pGEX Teasy vector, selects recombinant clone order-checking.Carry out analysis to sequencing result to show, obtain BjApextrin1 and BjApextrin2 full length gene sequence.
Embodiment 4: the structure of restructuring pET32a-BjApextrin1 and pET32a-BjApextrin2 expression plasmid
According to the sequent synthesis pair of primers of BjApextrin1 gene, upstream primer is containing BamH I cleavage site, and downstream primer is containing Xho I cleavage site.
Upstream primer (FL-F1):
5′-CGC
GGATCCGCACCGACCGAAGTCGTACA-3′
BamH?I
Downstream primer (FL-R1):
5′-CCG
CTCGAGCGAATAGTAACAGTAGTG?GAGTCT-3′
Xho?I
According to the sequent synthesis pair of primers of BjApextrin2 gene, upstream primer is containing BamHI cleavage site, and downstream primer is containing Xho I cleavage site.
Upstream primer (FL-F2):
5′-GGA
AGATCTATGAAATTCGCGCTGCTCG-3′
Bgl?II
Downstream primer (FL-R2):
5′-CCG
CTCGAGAGAGTAGTAGCAGTAGTGAATCCG-3′
Xho?I
Respectively with the pGEX Teasy plasmid containing BjApextrin1 and BjApextrin2 gene for template, FL-F1/FL-R1 and FL-F2/FL-R2 be primer PCR amplification, obtain the single band of specific amplified, product size is about 1500.Pcr amplification product is cloned on prokaryotic fusion expression vector pET32a, obtains its building process of recombinant expression vector pET32a-BjApextrin1 and pET32a-BjApextrin2(as shown in Figure 3).Exogenous gene sequence in expression vector is correct through order-checking qualification.
Embodiment 4: the expression and purification of Chinese Amphioxus BjApextrin1 and BjApextrin2 fusion rotein
By pET32a-BjApextrin1 and pET32a-BjApextrin2 plasmid transformation escherichia coli BL21(DE3).Genetic engineering bacterium ultrasonic degradation supernatant liquor and precipitation show through SDS-PAGE electrophoretic analysis, and bacterial strain has obvious specifically expressing product band after induction in ultrasonic degradation precipitation, and molecular weight conforms to (Fig. 4) with the theoretical value of prediction.
To the conditions such as incubation time, induced concentration, temperature grope draw.The culture condition of genetic engineering bacterium is: order bacterium colony is in 50ml ammonia benzyl resistance 2 × YT liquid nutrient medium, 37 DEG C, 250rpm overnight incubation, getting overnight culture 5ml is inoculated in ammonia benzyl resistance 2 × YT substratum of 500ml, 37 DEG C, 250rpm is cultured to OD600=0.6(enlarged culturing and is about 4h), add 100mM IPTG and be respectively 0.1mM to final concentration, 18 DEG C, collected by centrifugation thalline after 250rpm inducing culture 24h.Show through SDS-PAGE electrophoretic analysis, the expression amount of BjApextrin1 and BjApextrin2 fusion rotein accounts for more than 20% of bacterial protein with this understanding, is in insoluble inclusion body state.After using TBS damping fluid (50mM TrisCl, 150mM NaCl, pH7.5) resuspended the ultrasonic degradation precipitation of collecting, with ultrasonic cell disruptor with the power of 200W, the ultrasonic 4s of ultrasonic 30min(on ice, interval 4s), 4 DEG C, 12,000rpm centrifugal 30min.Repeat twice.To be precipitated and dissolve according to 1g:50ml ratio 8M urea-TBS, accelerating its dissolving, the centrifugal lysate 10min of room temperature 12,000rpm by adding magnetic stirring apparatus.The inclusion body supernatant liquor of dissolving is loaded processed dialysis tubing, dialysis tubing is transferred to buffer A(50mM TrisCl, pH6.0, 150mM NaCl, 2mM reduced glutathione (GSH), 0.2mM oxidized glutathione (GSSG), 10% glycerine, 4M urea), 4 DEG C of dialysis 12h, then dialysis tubing is transferred to buffer B(50mM TrisCl, pH6.0, 150mM NaCl, 2mM GSH, 0.2mM GSSG, 10% glycerine, 2M urea), 4 DEG C of dialysis 12h, again dialysis tubing is transferred to the TrisCl of buffer C(50mM, pH6.0, 150mM NaCl, 2mM GSH, 0.2mM GSSG, 10% glycerine, 1M urea), 4 DEG C of dialysis 12h, finally dialysis tubing is transferred to buffer D(50mM TrisCl, pH6.0, 150mM NaCl, 10% glycerine), 4 DEG C of dialysis 12h, change Fresh dialysate buffer D, repeat previous step.Recombinant protein is at 4 DEG C, and the centrifugal 15min of 12,000rpm, gets supernatant and carry out SDS-PAGE electrophoresis detection (Fig. 4).
Embodiment 5: the bacterium binding activities of Chinese Amphioxus BjApextrin1 and BjApextrin2 fusion rotein is analyzed
The bacterium used comprises: gram negative bacterium e. coli k12 (Escherichia coli K12), Vibrio anguillarum (Vibro anguillarum), Vibrio parahaemolyticus (Vibro paraheamolyticus) and Acinetobacter calcoaceticus (Acinetobacter caloacetius); Gram positive bacterium streptococcus aureus (Staphylococcus aureus), staphylococcus haemolyticus (Staphylococcus haemolyticus), middenstead coccus (Enterococcus faecium), subtilis (Bacillus subtilis) and micrococcus flavus (Micrococcus luteus).By about 2 × 10
7individual various different bacterium TBS(pH7.5) after washing balance, with BjApextrin1 and the BjApextrin2 fusion rotein of 1 μ g at 1ml TBS(pH7.5) 4 DEG C of oscillation incubations spend the night in damping fluid; 4 DEG C, the centrifugal 1min of 12000 × g, precipitation 1ml TBS damping fluid washes 5 times; With the resuspended thalline of 100 μ l TBS, then add 20 μ l6 × sample-loading buffers, boil after mixing and boil 10min; Then carry out Western blot analysis, carry out testing goal albumen by His monoclonal antibody, Sepharose4B bead carries out parallel laboratory test as negative control.BjApextrin1 and BjApextrin2 recombinant protein can in conjunction with gram positive bacterium as shown in Figure 5, and not in conjunction with gram negative bacterium.
Embodiment 6: the Bacterial agglutinative activity analysis of Chinese Amphioxus BjApextrin1 and BjApextrin2 recombinant protein
After enterococcus faecalis and streptococcus aureus shaking culture are spent the night, 6,000rpm collected by centrifugation 2 × 10
9various bacteriums after, with TBS(pH7.5) clean 2 times.After adding 50 μ l FITC solution (be dissolved in DMSO, final concentration is 10mg/ml), fill to cumulative volume 1ml with TBS, lucifuge rocks 1h.Clean 7-8 all over colourless to solution with TBS, be finally suspended in the CaCl that 1ml contains 10mM
2tBS solution in for subsequent use.96 hole flat boards carry out, and every hole adds the various microbial suspensions (final concentration about 1 × 10 of 10 μ l
7the bacterium of CFU/ml or 1 × 10
6cFU/ml yeast), the target protein of 10 μ g, fills to 100 μ l with TBS, and after mixing, lucifuge detects agglutination activity after leaving standstill 1 ~ 2h under fluorescent microscope.BjApextrin1 and BjApextrin2 recombinant protein can in conjunction with enterococcus faecalis and streptococcus aureus generation aggegation as shown in Figure 6.
Embodiment 7: the bacteria cell wall pure component binding activities of Chinese Amphioxus BjApextrin1 and BjApextrin2 recombinant protein is analyzed
Tested by ELISA and detect the binding activities of recombinant protein to bacteria cell wall pure component.The six kinds of bacteria cell wall pure components used are respectively: derive from the peptidoglycan (PGN (S.a)) of streptococcus aureus, derive from peptidoglycan (PGN (B.s)), zymosan (Zymosan), teichoic acid (the Lipoteichoic acid of Bacillus subtillis, LTA), lipopolysaccharides (Lipopolysaccharides, LPS) and mannosans (Mannan).Because PGN, Mannan and Zymosan are as insolubles, these 3 kinds of components be resuspended in before experiment after in carbonic acid buffer and use ultrasonic wave hydrotropy, centrifuging and taking supernatant carries out experiment below.
1) bag quilt: dissolve various different cell wall polysaccharides component with carbonic acid buffer (0.1M NaHCO3,2.5mM Na2CO3, pH9.6).Then in the reacting hole of each polystyrene microtiter plates, add each component of 20 μ g, supplementary bag is buffered liquid to 100 μ l, hatches 3h(blank control wells for 37 DEG C and does not add sugar component).
2) wash: discard solution in hole, with 200 μ l TBST(TBS, 0.05%Tween-20) wash 3 times, each 3min.
3) close: add 200 μ l Block buffer (TBST, 5%BSA), 4 DEG C of overnight incubation.Secondary daily TBST washing.
4) application of sample: the recombinant protein adding different concns in reacting hole, is placed in wet box and hatches 2h in 37 DEG C.Then with TBST washing, negative control is done with Trx (thioredoxin, TRX).
5) enzyme-added mark primary antibodie: in each reacting hole, adds the mouse His monoclonal antibody (1:5,000) with Block buffer dilution that 100 μ l are fresh, is placed in wet box and hatches 1h at 37 DEG C, washing.
6) add ELIAS secondary antibody: in each reacting hole, add the goat anti-mouse igg two anti-(1:20,000) of the HRP mark of 100 μ l Block buffer dilutions, be placed in wet box and hatch 1h in 37 DEG C, washing.
7) substrate buffer solution (100 μ g/ml tetramethyl benzidines, 0.24%H is added
2o
2, 0.2M Na
2hPO
4, 0.1M citric acid, pH5.5) and colour developing: in each reacting hole, add 50 μ l TMB nitrite ions, clock from adding first hole.All add rear lucifuge 37 DEG C and hatch 10min.
8) termination reaction: 10min after timing from the first hole, every hole adds 50 μ l stop buffer (2M H according to the order adding substrate buffer solution
2sO
4).
9) result judges: in 450nm place in microplate reader, with the light absorption value surveying each hole after blank control wells zeroing.As shown in Figure 7, the PGN of recombinant protein TRX-BjApextrin1 and TRX-BjApextrin2 to two kinds of sources has significant binding activities, but not in conjunction with other cell-wall component.
Embodiment 8: the insoluble peptidoglycan binding activities of bacterium of Chinese Amphioxus BjApextrin1 and TRX-BjApextrin2 fusion rotein is analyzed
Tested by Pulldown and detect the binding activities of recombinant protein to insoluble peptidoglycan (PGN).By 1 μ g target protein respectively with the PGN of two kinds of bacterial origins of 5,10,20,50 μ g at 1ml TBS(pH7.5) 4 DEG C of oscillation incubations spend the night in damping fluid; 4 DEG C, the centrifugal 1min of 12000 × g, precipitation 1ml TBS damping fluid washes 5 times; By the resuspended precipitation of 100 μ l TBS, then add 20 μ l6 × sample-loading buffers, boil after mixing and boil 10min; Then carry out Western blot analysis, carry out testing goal albumen by His monoclonal antibody.As shown in Figure 8, recombinant protein TRX-BjApextrin1 and RX-BjApextrin2 has significant binding activities to two kinds of PGN, and binding activities strengthens with the increase of peptidoglycan concentration.
Embodiment 9: the expression and purification of Chinese Amphioxus BjApextrin1 deletion mutant fusion rotein
According to the primer of the sequence of BjApextrin1 gene and the result design construction deletion mutant of homology comparison, as follows:
△C-R:
5′-CCG
CTCGAGCTGTTTGGT?AAACCGTTGGAGG-3′
BamH?I
△N-F：
5′-CGC
GGATCCCAAGGTGAAGT?TGCGGCTGT-3′
Xho?I
With the pGEX Teasy plasmid containing BjApextrin1 gene for template, be the segment △ C that primer PCR amplification obtains C end disappearance with FL-F and △ C-R; With △ N-F and FL-R be primer PCR amplification obtain hold N disappearance segment △ N.Pcr amplification product is cloned on prokaryotic fusion expression vector pET32a, obtains recombinant expression vector pET32a-△ C identical as shown in Figure 4 with its building process of pET32a-△ N(), recombinant expression vector is correct through order-checking qualification.
By pET32a-△ C and pET32a-△ N plasmid transformation escherichia coli BL21(DE3).Genetic engineering bacterium ultrasonic degradation supernatant liquor and precipitation show through SDS-PAGE electrophoretic analysis, and bacterial strain has obvious specifically expressing product band after induction in ultrasonic degradation precipitation.The purification condition of recombinant protein and process identical with embodiment 4, inclusion body insoluble as shown in Figure 9 can obtain purer recombinant protein through refolding strategy.
Embodiment 10: the bacterial peptide glycan binding activities of Chinese Amphioxus BjApextrin1 deletion mutant fusion rotein is analyzed
Detect recombinant protein TRX-△ C and TRX-△ N to bacterial peptide glycan binding activities by ELISA method, method is identical with embodiment 7.As shown in Figure 10, TRX-△ N has significant binding activities to peptidoglycan, and TRX-△ C does not have.
Claims (4)
1. a peptidoglycan associated proteins BjApextrin2 gene, its DNA sequence dna is as shown in sequence in sequence table 2.
2., by the BjApextrin2 albumen of BjApextrin2 genes encoding described in claim 1, its aminoacid sequence is as shown in sequence in sequence table 4.
3. the production method of BjApextrin2 albumen described in claim 2, carry out according to the following steps:
(1) by BjApextrin2 gene clone according to claim 1 to coli expression carrier pET32a, obtain recombinant expression vector pET32a-BjApextrin2;
(2) by pET32a-BjApextrin2 transform Escherichia coli strain BL21 (DE3);
(3) to e. coli bl21 (DE3) liquid medium within 2 × YT transformed, it is that the IPTG of 0.2mM is at 18 DEG C of overnight induction that 37 DEG C of cultivations added final concentration after 4 hours;
(4) purifying of restructuring BjApextrin2 fusion rotein, specifically by bacterium liquid collected by centrifugation thalline, carries out ultrasonication, and centrifuging and taking precipitation carries out refolding strategy, obtains albumen.
4. BjApextrin2 albumen according to claim 2 is treating the application in the infectious disease medicament caused by gram-positive microorganism as preparation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310385551.XA CN103468704B (en) | 2012-11-06 | 2012-11-06 | Peptidoglycan binding protein BjApextrin2, as well as gene, production method and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310385551.XA CN103468704B (en) | 2012-11-06 | 2012-11-06 | Peptidoglycan binding protein BjApextrin2, as well as gene, production method and application thereof |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201210439488.9A Division CN102925447B (en) | 2012-11-06 | 2012-11-06 | peptidoglycan binding protein BjApextrin1 and BjApextrin2, and genes, production method and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103468704A CN103468704A (en) | 2013-12-25 |
| CN103468704B true CN103468704B (en) | 2015-01-07 |
Family
ID=49793745
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310385551.XA Expired - Fee Related CN103468704B (en) | 2012-11-06 | 2012-11-06 | Peptidoglycan binding protein BjApextrin2, as well as gene, production method and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103468704B (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1358227A (en) * | 1999-06-25 | 2002-07-10 | 美国氰胺公司 | Production of the lipidated form of the peptido glycon-associated lipoproteins of gram-negative bacteria |
| CN101914545A (en) * | 2010-07-23 | 2010-12-15 | 中山大学 | Leucine-rich protein ALM gene of branchiostoma japonicum and application thereof |
| CN102186878A (en) * | 2008-08-19 | 2011-09-14 | 拜奥默里克斯公司 | Artificial peptidoglycan lysing enzymes and peptidoglycan binding proteins |
-
2012
- 2012-11-06 CN CN201310385551.XA patent/CN103468704B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1358227A (en) * | 1999-06-25 | 2002-07-10 | 美国氰胺公司 | Production of the lipidated form of the peptido glycon-associated lipoproteins of gram-negative bacteria |
| CN102186878A (en) * | 2008-08-19 | 2011-09-14 | 拜奥默里克斯公司 | Artificial peptidoglycan lysing enzymes and peptidoglycan binding proteins |
| CN101914545A (en) * | 2010-07-23 | 2010-12-15 | 中山大学 | Leucine-rich protein ALM gene of branchiostoma japonicum and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 海洋生物水解活性多肽研究进展;苏捷;《北京水产》;20080125(第01期);28-30 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103468704A (en) | 2013-12-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105906714B (en) | A kind of preparation and application of brucellosis specific fusion protein antigen | |
| CN101948521A (en) | Recombinant antigenic protein for diagnosing echinococcosis granulosus, preparation method thereof and use thereof | |
| CN105440132B (en) | The monoclonal antibody and its application of porcine epidemic diarrhea resisting viral N proteins | |
| CN105717299A (en) | Indirect ELISA kit based on Mo P113 protein and use method | |
| CN103499693A (en) | Competitive Alpha LISA (linked immuno sorbent assay) detection kit for classical swine fever virus (CSFV) antibody and detection method thereof | |
| CN111647055A (en) | N protein for detecting novel coronavirus, preparation and application thereof | |
| CN106018831B (en) | The mark GP50 of coenosis and the kit for diagnosing coenosis | |
| CN111087453A (en) | Preparation method and application method of chlamydia pneumoniae recombinant antigen | |
| CN102268091A (en) | Single-chain antibody C1B3 capable of identifying IgM (Immunoglobulin M) in grass carp | |
| CN103468704B (en) | Peptidoglycan binding protein BjApextrin2, as well as gene, production method and application thereof | |
| CN102925447B (en) | peptidoglycan binding protein BjApextrin1 and BjApextrin2, and genes, production method and application thereof | |
| CN107860927A (en) | A kind of preparation method and detection kit and its detection method of anaphylactogen Pru p1 albumen | |
| CN107167606B (en) | More diagnostic kits | |
| CN108101974B (en) | Fasciola hepatica multi-epitope fusion diagnostic antigen and application and preparation method thereof | |
| CN109946456A (en) | Diagnosing bovine tuberculosis marker and its application | |
| CN102827292B (en) | Fusion protein TgMEP as well as preparation method and application thereof | |
| CN107003309A (en) | Antigen composition for detecting chagas disease | |
| CN105037555B (en) | Conjugate and its preparation method and application | |
| CN106978425B (en) | The albumen of Babesia orientalis 1-deoxy-D-xylulose -5- phosphoric acid reduction isomerase gene and its coding | |
| CN108588096B (en) | Babesia orientalis spheroid protein gene 4 and protein coded by same | |
| CN107840884B (en) | Nano antibody for resisting avian infectious bronchitis virus and preparation method thereof | |
| CN104073502B (en) | Neutrality genetic engineering antibody 3C1 of human brain natriuretic peptide and its preparation method and application | |
| CN113444157B (en) | Application of mycoplasma hyorhinis outer membrane protein Mhr _0461 in preparation of mycoplasma hyorhinis or antibody detection kit thereof | |
| US9284360B2 (en) | Diagnostic test for infectious diseases in cattle | |
| TWI811793B (en) | Soluble erns recombinant protein of classical swine fever virus, method of making the same, kit and method of identifying classical swine fever virus infection using the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150107 Termination date: 20151106 |
|
| EXPY | Termination of patent right or utility model |