CN103439513B - The pharmaceutical use of Rictor/mTORC2 in heart development and disease treatment - Google Patents
The pharmaceutical use of Rictor/mTORC2 in heart development and disease treatment Download PDFInfo
- Publication number
- CN103439513B CN103439513B CN201310334338.6A CN201310334338A CN103439513B CN 103439513 B CN103439513 B CN 103439513B CN 201310334338 A CN201310334338 A CN 201310334338A CN 103439513 B CN103439513 B CN 103439513B
- Authority
- CN
- China
- Prior art keywords
- rictor
- mtorc2
- differentiation
- cell
- myocardial
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Investigating Or Analysing Biological Materials (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides rictor/mTORC2 in mouse embryo stem cell vitro differentiation is the application in myocardial cell, namely can be applicable to screen and the research evaluating with rictor/mTORC2 the short Cardiomyocyte Differentiation agent being target spot.The present invention utilizes percoll reagent purification to go out the myocardial cell come by mouse embryo stem cell vitro directed differentiation; the histone acetyltransferase that transfection is composed of rictor transcribes the plasmid of the sub-p300 of auxiliary activation; rictor Acetylation Level in myocardial cell is increased; and then promote rictor downstream effect device Akt(ser473) phosphorylation; increase mTORC2 active; thus build cardiac myocyte hypertrophy model; and utilize this model further; have rated the effect of the anti-myocardial hypertrophy of trans-resveratrol, be conducive to finding new class Myocardium Differentiation inductor.
Description
Technical field
The invention belongs to developmental biology, pharmacology and regenerative medicine field, relate to a kind of research and apply field of protein New function, be specifically related to rictor/mTORC2(Mammals rapamycin target protein mixture 2, mammalian target of rapamycin complex 2, mTORC2) at the New function that mouse embryo stem cell vitro differentiation is in myocardial cell, can be used for take rictor/mTORC2 as the short Cardiomyocyte Differentiation agent screening of target spot.The present invention have also demonstrated the cognation of rictor/mTORC2 and myocardial hypertrophy, can be used for the development research of anti-myocardial hypertrophy disease medicament.
Background technology
Mammals rapamycin target protein (mammalian target of rapamycin, mTOR) be the central regulator person of cell proliferation, growth, differentiation, by forming two kinds of mixture mTORC1(mammalian target of rapamycin complex 1 in conjunction with different albumen) and mTORC2(mammalian target of rapamycin complex 2).MTORC2 comprises the insensitive component of rapamycin (rapamycin-insensitive companion of mTOR, rictor), the mSin1(mammalian stressactivated protein kinase-interacting protein 1 of mTOR, mTOR), PRR5(prolin-rich repeat protein-5) and mLST8(mammalian lethal with sec13 protein 8) albumen.Wherein rictor ensures that mSin1 is stable and it is necessary to maintain mTORC2 activity.Research both at home and abroad in the past few decades mainly concentrates on mTORC1, and knows little about it in the function of various physiology/pathological state (comprising heart development/heart disease etc.) to mTORC2.
MTOR is required in fetal development and embryonic stem cell Growth and Differentiation process, and mTORC1 and mTORC2 plays a different role in different endoderm cell differentiation.The Mouse Embryo Development that Rictor knocks out shows retarded growth to E9.5, and dead at E11.5, and infer and cause intracellular energy to produce deficiency after lacking rictor with embryonic cell, metabolic imbalance has substantial connection, but its concrete mechanism is not yet illustrated.Meanwhile, mTORC2 participates in cytoskeletal protein structure and cell migration process.There is not yet the report of rictor/mTORC2 and embryo heart differentiation and development and heart disease generation dependency so far.Therefore, deeply disclose rictor/mTORC2 role in heart physiological/pathology develops, exploitation take rictor/mTORC2 as the novel drugs of target spot, control for heart disease provides new way and method, and to be conducive in regenerative medicine the drug intervention treatment of heart disease in whole latter stage, there is wide Research Prospects.
Summary of the invention
An object of the present invention is to provide rictor/mTORC2 in mouse embryo stem cell vitro differentiation is the application in myocardial cell, namely can be applicable to screen and the research evaluating with rictor/mTORC2 the short Cardiomyocyte Differentiation agent being target spot.The present invention can significantly suppress its directed differentiation for myocardial cell after confirming that mouse embryo stem cell passes through gene slow virus shRNA interference rictor.Show as differentiation phase and inhibit mesoderm specific proteins brachyury, cardiac transcription factors Nkx2.5 and Cardiac-specific albumen
the expression of-Actinin.Number of myocardial cells also significantly reduces.Meanwhile, myocardial cell's sarcomere that interference rictor group differentiates gets muddled, light and dark not obvious.The present invention finds that the compound PP242 suppressing rictor to express is unfavorable for Cardiomyocyte Differentiation further, and the compound icarin promoting rictor to express is conducive to Cardiomyocyte Differentiation.Namely utilize the present invention to can be applicable to screening and the evaluation of the short Cardiomyocyte Differentiation agent taking rictor/mTORC2 as target spot, be conducive to finding new class Myocardium Differentiation inductor.
The invention provides a kind of new cardiac myocyte hypertrophy model, being applied to screening with evaluating take rictor/mTORC2 as the anti-myocardial hypertrophy drug research of target spot.The present invention utilizes percoll reagent purification to go out the myocardial cell come by mouse embryo stem cell vitro directed differentiation; the histone acetyltransferase that transfection is composed of rictor transcribes the plasmid of the sub-p300 of auxiliary activation; rictor Acetylation Level in myocardial cell is increased; and then promote rictor downstream effect device Akt(ser473) phosphorylation; increase mTORC2 active, thus build cardiac myocyte hypertrophy model.And utilize this model further, have rated the effect of the anti-myocardial hypertrophy of trans-resveratrol.
Accompanying drawing explanation
Fig. 1 is after ES-D3 cell interference rictor be the impact of myocardial cell on its directed differentiation, * * P<0.01, * * * P<0.001 vs solvent control group.
Fig. 2 is the impact on Cardiac-specific protein expression during Cardiomyocyte Differentiation after Western blot method detection ES-D3 cell interference rictor.
Fig. 3 is the impact on number of myocardial cells after flow cytometry detection by quantitative ES-D3 cell interference rictor, and wherein A is streaming result figure, B is the quantitative histogram of number of myocardial cells,
n=3, * *
p<0.01
vssolvent control group.
Fig. 4 A is the expression of immuno-fluorescence assay ES-D3 cell Spontaneous Differentiation (negative control) for sarcomere protein alpha-Actinin in myocardial cell.
Fig. 4 B is the expression of sarcomere protein alpha-Actinin in (interference group) derivatize myocardial cell after immuno-fluorescence assay ES-D3 cell interference rictor.
Fig. 5 is that PP242 is divided into the impact of myocardial cell to ES-D3 cell directional, and wherein A is rictor and downstream effect albumen, Cardiac-specific protein expression situation, and B is that ES cell directional is divided into myocardial cell's percentage statistics histogram,
n=3, *
p< 0.05, * *
p< 0.01
vssolvent control group.
Impact on rictor when Fig. 6 is icarin induction ES-D3 cell directional Cardiomyocyte Differentiation.
Fig. 7 is that in the myocardial cell that comes of ES-D3 cytodifferentiation, rictor acetylize causes cardiac myocyte hypertrophy, and wherein A is that WB detects myocardial cell's acetylize effect, and B is the expression that WB method detects myocardial hypertrophy associated protein.(C) immunofluorescence technique observes myocardial cell's form.
Fig. 8 is the effect that WB method detects that the anti-rictor acetylize of trans-resveratrol causes cardiac myocyte hypertrophy.
specific examples mode
The present invention is further described in conjunction with the accompanying drawings and embodiments.In addition should be understood that preferred specific embodiments below only illustrates, but not limit the scope of the invention by any way.
impact on directed Cardiomyocyte Differentiation after embodiment 1 ES-D3 cell interference rictor
1. disturb rictor gene in ES-D3 cell by slow virus shRNA
Adopt mouse ES-D3 cell, add shRNA-rictor and carry out transfection, and control group is set.ShRNA-rictor interference sequence is as follows: 5'-CCGGGCCAGTAAGATGGGAATCATTCTCGAGAATGATTCCCATCTTACTGGCT TTTTG-3'; Transfection same day, suck cell conditioned medium liquid, be 10 PFU/ cells, added in culturing bottle by virus stock solution used by MOI value, then add normal nutrient solution to 2 ml, limit edged jog culture dish, guarantees to be uniformly distributed and to avoid high local concentrations.Cell is put back to incubator hatch, after 37 ° of C infect 72-96 h, observe luciferase expression situation.Transfection efficiency reaches about 80%, carries out cell differentiation experimentation by hanging drop-suspension-stationary culture.
hanging drop-suspension culture
Be 2 × 10 by cells trypsinised for successful for above-mentioned transfection ES-D3 cell density of making
4the single cell suspension of individual/ml, with 30
be inoculated on cover inner surface that diameter is the culture dish of 10-cm, 10ml D-Hanks liquid is added in culture dish, then carefully cover the lid with many droplets, make the droplet on lid hang upside down into hanging drop (each hanging drop is about containing 600 cells), put in incubator and cultivate 3 days.Collect EBs to go to and be covered with agar and contain in the culture dish of 10 ml differentiation culture liquid suspension culture 2 days.Differentiation culture liquid is DMEM in high glucose, containing 0.1 mmol.L
-1 -mercaptoethanol, non-essential amino acid and 20 % foetal calf serums, not containing the LIF factor.
adherent culture
Under the microscope with embryoid body (the embryoid body that Hanging drop culture is formed by suction pipe, EB), transfer in 24 orifice plates, make its adsorb adherent after, 1 ml differentiation culture liquid is slowly added in every hole, now start with inverted microscope observation of cell every day, to catch the metamorphosis of myocardial cell's directed differentiation.EB is transferred in 24 orifice plates and is designated as d 5+0.
be divided into myocardial cell when observing and add up adherent 1,2,3 day of EB to beat situation.
Result is see Fig. 1.Result shows, and significantly suppresses its directed differentiation to be myocardial cell after ES cell interference rictor.Interference group Cardiomyocyte Differentiation rate when breaking up d 5+2 is only 20.9 ± 6.7%, and comparatively solvent control group 38.1 ± 3.9% significantly reduces (* *
p<0.01); Interference group is 42.2 ± 5.8% in d 5+3 Cardiomyocyte Differentiation rate, and comparatively solvent control group 65.4 ± 6.3% significantly reduces (* * *
p<0.001).
impact on Cardiac-specific protein expression during Cardiomyocyte Differentiation after embodiment 2 Western blot method detection ES-D3 cell interference rictor.
The collection differentiation EB of d 3, d 5, d 5+1 and d 5+3 days and Cardiac Myocytes carry out the investigation of correlative protein expression.Get albumen and add 5 × SDS damping fluid, boil 5 min sex change, electrophoresis in 10 % SDS-polyacrylamide gels, about 2 h; Albumen is transferred on PVDF film by then electricity consumption transferring film instrument, about 1.5 h; 5 % skimmed milks are dissolved in room temperature and close 1 h, T-PBS(0.05% Tween) rinsing 3 times (15 min, 5 min, 5 min); Add goat-anti rictor(1:1000), the anti-p-Akt(1:1000 of rabbit), the anti-p-Akt(1:1000 of rabbit), the anti-brachyury(1:1000 of rabbit), the anti-Nkx2.5 of rabbit, (1:1000), mouse-anti α-Actinin(1:1000), mouse-anti GAPDH(1:10000), 4 ° of C overnight incubation, T-PBS rinsing 3 times (15 min, 10 min, 5 min); Add the anti-rabbit of horseradish peroxidase-labeled respectively, mouse or sheep two anti-(1:5000), incubated at room 1 h; T-PBS rinsing 3 times (15 min, 10 min, 5 min); ECL method is adopted to detect blotting membrane.
Result is see Fig. 2.Result shows, and from differentiation d 3 to d 5+3, slow virus sh-rictor significantly can suppress mTORC2 important component part rictor and mTORC2 downstream effect device Akt(Ser473) phosphorylated protein expression.From differentiation d 3 to d 5, interfering component cell mesoderm albumen brachyury and cardiac transcription factors Nkx2.5 down-regulated expression; Differentiation d 5+1 to d 5+3, interfering component and the cell Cardiac-specific protein alpha-Actinin expression that comes also significantly is lowered.
embodiment 3: the impact on number of myocardial cells after flow cytometry detection by quantitative ES-D3 cell interference rictor.
Collect the cell-derived myocardial cell's sample of the adherent differentiation ES-D3 of 3 days, individual cells is digested to collagenase II, and fix 1 h with 1 % paraformaldehyde, 1 h is closed again with the BSA of 3 %, upper primary antibodie: cardiac myocytespecific albumen Monoclonal mouse anti-α-Actinin, 1:500 dilutes, 4 ° of C overnight incubation.Within second day, add two to resist: Dylight549-Conjugatedgoat anti-mouse IgG, 1:500 dilute, 37 ° of C hatch 1.5 h.Upper machine testing.
Result is see Fig. 3.Result shows, and after ES-D3 cell interference rictor, directed differentiation is that number of myocardial cells significantly reduces.Interference rictor group number of myocardial cells is 5.8 ± 1.7%, and comparatively negative control group 12.5 ± 1.1% significantly reduces (* *
p<0.01).
embodiment 4: immunofluorescence experiment detects the expression of sarcomere protein alpha-Actinin in derivatize myocardial cell after ES-D3 cell interference rictor.
Collect adherent differentiation 3 days
eS-D3cell-derived myocardial cell's sample, fixes 10 min with pure cold methanol, then uses bovine serum sealing treatment 30 min, then adds primary antibodie: cardiac myocytespecific albumen Monoclonal mouse anti-α-Actinin, 1:500 dilute, 4 ° of C overnight incubation.1:500 dilutes, 4 ° of C overnight incubation.Within second day, add two to resist: Dylight549-Conjugatedgoat anti-mouse IgG, 1:500 dilute, 37 ° of C hatch 1.5 h.With DAPI with 1:1000 process 1min, with fluorescence microscope, Taking Pictures recording.
Result is see Fig. 4.Result shows, and myocardial cell's sarcomere that negative control group differentiation comes is clear, light and dark, and in trapezoidal, and sun dye region (redness) is many, and in interference group, sarcomere gets muddled, and light and dark not obvious, sun dye region is significantly reduced.
embodiment 5:mTORC2 inhibitor PP242 is on the impact of ES-D3 cell directional Cardiomyocyte Differentiation.
Cardiomyocyte Differentiation experiment is carried out by " hanging drop-suspension-adherent " method in embodiment 1.Add mTORC2 inhibitor PP242 when Hanging drop culture, final concentration is 100 nmol/L, whole atomization all inhibitings simultaneously.Beating cardiomyocytes differentiation percentage and correlative protein expression situation is added up respectively adherent differentiation the 3rd and 7 days.
Result is see Fig. 5.Result shows, PP242 significantly can suppress ES-D3 cell myocardiac differentiation, beating cardiomyocytes group's ratio reduces, Cardiac-specific protein alpha-Actinin expresses minimizing, important composition albumen rictor and downstream effect albumen p-AKT(Ser473 in mTORC2) express all suppressed (Fig. 5).
embodiment 6: the impact on rictor during icarin induction ES cell directional Cardiomyocyte Differentiation.
Disturb rictor gene in ES-D3 cell by embodiment 1 by slow virus shRNA, then carry out Cardiomyocyte Differentiation experiment.Add differentiating inducer icarin when adherent culture, final concentration is 10 simultaneously
-7mol/L.Correlative protein expression situation is observed respectively adherent differentiation the 1st and 3 days.
Result is see Fig. 6.Result shows, and icarin significantly can induce ES-D3 cell myocardiac differentiation, and Cardiac-specific protein alpha-Actinin expresses increase, important composition albumen rictor and downstream effect albumen p-AKT(Ser473 in mTORC2) express all increases (Fig. 6).
in embodiment 7. myocardial cell, rictor histone acetylation causes cardiac myocyte hypertrophy.
myocardial cell is separated:cell differentiation experimentation is carried out by " hanging drop-suspension-stationary culture " in embodiment 1.Get the adherent differentiation Cardiac Myocytes of 7 days, adopt Percoll discontinuous density gradient centrifuging to be separated the cell-derived myocardial cell of ES.Key step is as follows: myocardial cell's floating density in Percoll is 1.065 ~ 1.069 g/ml, corresponding 40.5% ~ 58.5%Percoll liquid concentration; 3 ml 58.5%Percoll are added to centrifuge tube bottom, then 3 ml 40.5%Percoll liquid are slowly added to above 58.5%Percoll liquid, then 3 ml ES source myocardial cells are added to top layer gently, centrifugal 30 min of 1500 × g; Collect the 4th confluent monolayer cells be separated, wash 2 times with D-Hanks liquid, centrifugal segregation Percoll liquid, adds perfect medium resuspended, is inoculated in culture plate; Be placed in 37 ° of C, 5% CO
2cultivate in incubator.
acetylize:myocardial cell's transfection is composed of mTORC2(mTOR; LST8; mSin1.1; Rictor) have or transcribe the plasmid of the sub-p300 of auxiliary activation without histone acetyltransferase; when having or without wortmannin; co-immunoprecipitation method detects the relation of rictor acetylize and mTORC2, statistics Akt(ser473) phosphorylation multiple changing conditions.
cardiac myocyte hypertrophy situation is observed after acetylize:(1) extract albumen and add 5 × SDS damping fluid, boil 5 min sex change, electrophoresis in 10 % SDS-polyacrylamide gels, about 2 h; Albumen is transferred on PVDF film by then electricity consumption transferring film instrument, about 1.5 h; 5% skimmed milk is dissolved in room temperature and closes 1 h, T-PBS(0.05% Tween) rinsing 3 times (15 min, 5 min, 5 min); Add goat-anti GATA4(1:1000), rabbit resists
-MHC(1:1000), the anti-MEF2C(1:1000 of rabbit), mouse-anti GAPDH(1:10000) and, 4 ° of C overnight incubation, T-PBS rinsing 3 times (15 min, 10 min, 5 min); Add the anti-rabbit of horseradish peroxidase-labeled respectively, mouse or sheep two anti-(1:5000), incubated at room 1 h; T-PBS rinsing 3 times (15 min, 10 min, 5 min); ECL method is adopted to detect blotting membrane.(2) myocardial cell's sample, fixes 10 min with pure cold methanol, then uses bovine serum sealing treatment 30 min, after then adding the phalloidin of FITC mark, with fluorescence microscope, and Taking Pictures recording.
Result is see Fig. 7.Result shows; the plasmid of expressing p300 can significantly increase rictor histone acetylation in myocardial cell; and then promote rictor downstream effect device Akt(ser473) phosphorylation, making Akt(ser473) multiple of phosphorylation adds 1.5, and namely rictor acetylize can increase the activity of mTORC2.In cardiac muscle cells after rictor acetylize, WB result display myocardial hypertrophy associated protein GATA4, β-MHC and MEF2C expresses significantly to be increased.Immunofluorescence results shows, and the acetylizad myocardial cell surface of rictor is long-pending to be increased.
the cardiac myocyte hypertrophy evaluating drug effect that the anti-rictor acetylize of embodiment 8. trans-resveratrol causes.
Prepare myocardial hypertrophy model by embodiment 7, add trans-resveratrol 75 μm of ol/L, investigate its anti-myocardial hypertrophy effect.
Result is see Fig. 8.Result shows, and trans-resveratrol has the cardiac myocyte hypertrophy effect that anti-rictor acetylize causes, and under 75 μm of ol/L concentration, significantly reduces Akt(ser473) phosphorylation level, and myocardial hypertrophy associated protein GATA4, β-MHC and MEF2C express.
Without the need to elaborating further, believe content disclosed before employing, those skilled in the art can apply the present invention to greatest extent.The all documents mentioned in the present invention are quoted as a reference all in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
<110> Zhejiang University
The pharmaceutical use of <120> Rictor/mTORC2 in heart development and disease treatment
<160> 1
<210> 1
<211> 58
<212> DNA
<213> artificial sequence
<220>
<223> is according to the interference sequence of rictor shRNA sequences Design
<400> 1
CCGGGCCAGTAAGATGGGAATCATTCTCGAGAATGATTCCCATCTTACTGGCTTTTTG 58
Claims (1)
1.rictor/mTORC2 is the application in myocardial cell in mouse embryo stem cell vitro differentiation, it is characterized in that, is taking rictor/mTORC2 as the screening of short Cardiomyocyte Differentiation agent of target spot and the application in evaluation.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310334338.6A CN103439513B (en) | 2013-08-05 | 2013-08-05 | The pharmaceutical use of Rictor/mTORC2 in heart development and disease treatment |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310334338.6A CN103439513B (en) | 2013-08-05 | 2013-08-05 | The pharmaceutical use of Rictor/mTORC2 in heart development and disease treatment |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103439513A CN103439513A (en) | 2013-12-11 |
| CN103439513B true CN103439513B (en) | 2015-07-29 |
Family
ID=49693217
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310334338.6A Expired - Fee Related CN103439513B (en) | 2013-08-05 | 2013-08-05 | The pharmaceutical use of Rictor/mTORC2 in heart development and disease treatment |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103439513B (en) |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1403586A (en) * | 2002-09-27 | 2003-03-19 | 浙江大学 | Construction and application of in vitro directional embryonic stem cell-differentiating medicine efficacy screening model |
| CN1425763A (en) * | 2002-12-30 | 2003-06-25 | 浙江大学 | Use of icariin in inducing external oriented differentiation of embryo stem cells |
| CN1869204A (en) * | 2006-05-19 | 2006-11-29 | 浙江大学 | Use of icariin in inducting dry cell body in-vitro directional differentiation |
| CN101886127A (en) * | 2010-06-24 | 2010-11-17 | 浙江大学 | Application of glutamic acid receptor 5 in directionally differentiating embryonic stem cells to cardiac muscle cells |
| EP2551341A1 (en) * | 2010-03-23 | 2013-01-30 | Kuraray Co., Ltd. | Culture method for causing differentiation of pluripotent mammalian cells |
-
2013
- 2013-08-05 CN CN201310334338.6A patent/CN103439513B/en not_active Expired - Fee Related
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1403586A (en) * | 2002-09-27 | 2003-03-19 | 浙江大学 | Construction and application of in vitro directional embryonic stem cell-differentiating medicine efficacy screening model |
| CN1425763A (en) * | 2002-12-30 | 2003-06-25 | 浙江大学 | Use of icariin in inducing external oriented differentiation of embryo stem cells |
| CN1869204A (en) * | 2006-05-19 | 2006-11-29 | 浙江大学 | Use of icariin in inducting dry cell body in-vitro directional differentiation |
| EP2551341A1 (en) * | 2010-03-23 | 2013-01-30 | Kuraray Co., Ltd. | Culture method for causing differentiation of pluripotent mammalian cells |
| CN101886127A (en) * | 2010-06-24 | 2010-11-17 | 浙江大学 | Application of glutamic acid receptor 5 in directionally differentiating embryonic stem cells to cardiac muscle cells |
Non-Patent Citations (2)
| Title |
|---|
| mTOR-Mediated Activation of p70 S6K Induces Differentiation of Pluripotent Human Embryonic Stem Cells;Charles A. Easley, IV et al.;《CELLULAR REPROGRAMMING》;20101231;第12卷(第3期);第263页-第273页 * |
| 淫羊藿苷诱导小鼠胚胎干细胞体外定向分化为心肌细胞方法学研究;朱丹雁等;《中国药学杂志》;20070531;第42卷(第9期);第667-671页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103439513A (en) | 2013-12-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US9139811B2 (en) | Composition for suspension culturing of stem cells | |
| JP5725560B2 (en) | Cell evaluation system using cell sheet and method of using the same | |
| Rafiq et al. | Qualitative and quantitative demonstration of bead-to-bead transfer with bone marrow-derived human mesenchymal stem cells on microcarriers: Utilising the phenomenon to improve culture performance | |
| Cho et al. | Dual modulation of the mitochondrial permeability transition pore and redox signaling synergistically promotes cardiomyocyte differentiation from pluripotent stem cells | |
| Giacomelli et al. | Co‐differentiation of human pluripotent stem cells‐derived cardiomyocytes and endothelial cells from cardiac mesoderm provides a three‐dimensional model of cardiac microtissue | |
| CN106987555A (en) | Efficiently induce the micromolecular compound composition of human pluripotent stem cells myocardiac differentiation | |
| CN106635966A (en) | Culture method capable of maintaining self-renewal state of mouse epiblast stem cells | |
| Hanga et al. | Expansion of bone marrow‐derived human mesenchymal stem/stromal cells (hMSCs) using a two‐phase liquid/liquid system | |
| EP3841195A1 (en) | Epithelial cell spheroids | |
| Luo et al. | Myosin light chain 2 marks differentiating ventricular cardiomyocytes derived from human embryonic stem cells | |
| CN106635969A (en) | Preparation method of epicardial cells from stem cells | |
| Aalders et al. | Liquid marble technology to create cost-effective 3D cardiospheres as a platform for in vitro drug testing and disease modelling | |
| CN106867964B (en) | Myocardial cell culture solution and culture method | |
| CN103439513B (en) | The pharmaceutical use of Rictor/mTORC2 in heart development and disease treatment | |
| CN109722411B (en) | Application method of micromolecules for promoting self-renewal state of embryonic stem cells | |
| CN104388384A (en) | Application of oxidized low density lipoprotein for inducing mesenchymal stem cell to differentiate to myocardium-like cell | |
| Kuwahara et al. | Generation of a three-dimensional retinal tissue from self-organizing human ESC culture | |
| Gu et al. | Expansion of transdifferentiated human hepatocytes in a serum-free microcarrier culture system | |
| WO2022227289A1 (en) | Method for detecting sensitivity of organoid to macromolecular drug with sandwich culture system | |
| CN111733133B (en) | Method for promoting differentiation and growth of epidermal stem cells | |
| CN113249328B (en) | Application of EpCAM in regulation and control of hepatic differentiation of human hepatic precursor cells | |
| Tan et al. | In vitro evaluation of candidate gene targets for cancer therapy | |
| CN107177555B (en) | A kind of method of H9C2 myocardial cells culture liquid induction iPSCs orientation Myocardium Differentiation | |
| CN104208066B (en) | Bridged piperazine derivatives is as the purposes of p53 molecular regulation agent | |
| Rao et al. | 24: Deceased Donor Adipose Tissue: An Untapped Source of Mesenchymal Stem Cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent for invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Zhu Danyan Inventor after: Zheng Bei Inventor after: Wang Jiadan Inventor after: Huang Yujie Inventor after: Tang Leilei Inventor after: Lou Yijia Inventor before: Zhu Danyan Inventor before: Zheng Bei Inventor before: Huang Yujie Inventor before: Tang Leilei Inventor before: Lou Yijia |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: ZHU DANYAN ZHENG BEI HUANG YUJIE TANG LEILEI LOU YIJIA TO: ZHU DANYAN ZHENG BEI WANG JIADAN HUANG YUJIE TANG LEILEI LOU YIJIA |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150729 Termination date: 20200805 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |