CN103421789B - Clone and application of porcine skeletal muscle specific expression gene tnnc2 promoter - Google Patents

Abstract

The invention belongs to the technical field of animal genetic engineering, and particularly relates to separation identification and functional verification of promoter areas with different lengths of porcine skeletal muscle specific expression gene tnnc2. Five promoters with different lengths in the upstream of a porcine skeletal muscle specific expression gene tnnc2 are cloned from a porcine genome, and the nucleotide sequences are shown as SEQ ID NO: 1 to SEQ ID NO: 5; the result shows that tnnc2-pro fragment of 2313 bp and tnnc2-Q2 fragment of 1048bp have independent promoter activity and muscular tissue specificity, and the nucleotide sequences are shown as SEQ ID NO: 1 and SEQ ID NO: 3. The invention discloses a preparation method of five different deletion promoter fragments, a dual-luciferase activity detecting system and application to promoter activity analysis by a quantitative PCR method.

Description

The clone of Animal muscles different expression gene tnnc2 promotor and application

Technical field

The invention belongs to animal gene engineering technology field, be specifically related to isolation identification and the functional verification of the different lengths promoter region of Animal muscles different expression gene tnnc2.

Background technology

The expression of higher organism gene is subject to the finely regulating of intraor extracellular environment, thus has strict time and spatial ordering.The expression regulation of gene is a complexity and orderly process, is jointly completed by multistage regulation and control level, this mainly comprise transcribe before, transcribe, transcribe after, translate, translate rear five levels.Wherein the regulation and control of transcriptional level are the links of most critical.Promotor is an important controlling element on transcriptional level, is to be positioned at the DNA sequence dna that structure gene 5 ' holds upstream, can with the expression of numerous transcription factor interaction regulatory genes (military force 1999).Therefore further investigate the structure of promotor, function, binding mode etc. to be conducive to us and better to understand the function of corresponding gene and intergenic interaction.

Promotor sorting technique is more, and the function and effect mode according to promotor can be divided into constitutive promoter, tissue specific promoter and inducible promoter; Core promoter, proximal promoter and Proximal promoter (Wang and Hannenhalli2006 can be divided into according to the structure of promotor and position; Reddy et al2003; Aneia et al2008); Structure according to core promoter can be divided into again concentrated promotor and decentralized promotor.Although the classification of promotor is varied, for eukaryote, rna plymerase ii type promotor plays Main Function (Sandelin et al2007).Often only express at some specific organ or tissue position at the gene of tissue-specific promoter's regulation and control, and show the feature of Growth adjustment.The tissue-specific promoter possessing high transcriptional activity is the desirable promotor in genetically engineered, this kind of promotor efficiently can start exogenous gene expression, foreign gene can be made again to express in specific target cell or target tissue, and the CMV of this utilization more extensive than present stage and SV40 promotor have more research and practical value.

Tissue-specific promoter is usually based on specific tissue cellularity with chemistry, physical signalling, target location can be carried out to foreign gene, gene is fixed on a certain tissue or cells, decrease the loss of human body energy and material and the impact on organism metabolism activity, can play again the directed effect improving a certain tissue characteristics, this prospect in human disease treatment is especially considerable simultaneously.Secondly, in transgenic animal breeding research, expressed in target tissue by tissue-specific promoter's regulation and control external source goal gene, effectively can improve some proterties of animal, as intramuscular fat; Or the Digestive tract improving animal is to reduce the nitrogen and phosphorus content etc. in movement.Given this, tissue-specific promoter is more and more subject to the favor of investigator in genetically engineered and transgenic breeding.

Fast muscle TnC (TNNC2) is TnC (TnC) a kind of heterogeneous.The Ca that TnC has by itself ²⁺binding site, with Ca ²⁺in conjunction with after cause Muscle contraction and to release energy and CREB, CREB to regulate and control the formation of myoprotein alone or synergistically by starting c-myc in core and other proto-oncogenes, thus start myofibrillar Growth and Differentiation.The research of Gahlmann to the fast muscle TnC of the mankind and slow muscle TnC differential expression finds, fast muscle troponin C gene is only expressed in the high microsteping type muscle of similar skeletal muscle fast muscle, and does not express (Gahlmann1988) in slow muscle and cardiac muscle.Mouse and people tnnc2 gene studies found that, both length portions, coding region are 480bp, 160 amino acid of encoding, and all have 6 exons and 5 introns (Tiso et al1997).Research shows, pig tnnc2 gene is positioned at No. 17 karyomit(e)s, total length 1143bp, containing 5 exons and 4 introns, coding region length is 483bp, 160 amino acid of encoding, and is analyzed find that tnnc2 gene is only at Animal muscles by RT-PCR, as expressed in the bicipital muscle of arm, quadriceps muscle of thigh and longissimus dorsi muscle, do not express or low expression (field makes the country prosperous 2006) at its hetero-organization.

Up to the present, the relevant report of the promoter function of research Animal muscles different expression gene tnnc2 is not seen.So applicant has carried out the functional study of different lengths fragment to the promotor of this gene, to this promotor can be utilized better.

Summary of the invention

The object of the invention is to the different fragments being separated, screening Animal muscles different expression gene tnnc2 promotor, and functional verification is carried out to it, possess startup activity to obtaining this gene and keep the specific regulation and control section of muscle tissue, for animal genetic engineering provides available tissue-specific promoter.

The present invention is separated and identifies tnnc2 gene from the genome of Large White has the specific promotor of muscle tissue.With the poba gene group DNA of Large White for template amplification obtains 2313bp, 1237bp, 1048bp, 484bp, the promoter fragment of 338bp totally 5 different lengthss, these segment composition reporter gene firefly luciferase genes (being called for short LUC gene) are built pGL3-tnnc2-pro, pGL3-tnnc2-Q1, pGL3-tnnc2-Q2, pGL3-tnnc2-Q3, pGL3-tnnc2-Q4 carrier for expression of eukaryon 5, by these carriers transfection C2C12 respectively, the C2C12 cell of 3T3-L1 and differentiation, by the relative reactivity of Dual-luciferase reportor systerm analysis report gene Photinus pyralis LUC, thus obtain the maintenance specific core promoter district of muscle tissue, the recombinant vectors of further structure core promoter and pig PPAR γ gene, by the expression amount of fluorescence quantitative PCR detection PPAR γ.

The present invention is realized by following technology:

Technological line of the present invention as shown in Figure 1.

Utilize ncbi database (http://www.ncbi.nlm.nih.gov) search to obtain the regulating and controlling sequence of Animal muscles specific gene tnnc2, utilize the approximate region of MEME, TFSEARCH and MethPrimer bioinformatics software prediction total length promotor, cis-trans functional element and CpG island distribution situation.According to the design 5 pairs of primers (its nucleotide sequence is in table 1) that predict the outcome, from the genome of Large White, pcr amplification obtains muscle tissue specificity promoter, applicant is by the promoter fragment of amplification called after tnnc2-pro, tnnc2-Q1, tnnc2-Q2, tnnc2-Q3, tnnc2-Q4 respectively, its fragment length is respectively 2313bp, 1237bp, 1048bp, 484bp, 338bp, and its nucleotide sequence is respectively as shown in SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5.Build reporter gene LUC fusion vector, applicant is distinguished called after pGL3-tnnc2-pro, pGL3-tnnc2-Q1, pGL3-tnnc2-Q2, pGL3-tnnc2-Q3, pGL3-tnnc2-Q4.The C2C12 cell of transient transfection C2C12,3T3-L1 and differentiation, Dual-luciferase reportor systerm detects and finds that pGL3-tnnc2-pro, pGL3-tnnc2-Q1, pGL3-tnnc2-Q2, pGL3-tnnc2-Q4 all exist transcriptional activity in various degree in C2C12 cell, only has pGL3-tnnc2-Q1 to there is faint activity in 3T3-L1 cell.In C2C12 cell after differentiation, pGL3-tnnc2-pro activity has great raising, and the activity of pGL3-tnnc2-Q1 and pGL3-tnnc2-Q2 reduces, and the activity of pGL3-tnnc2-Q4 is down to consistent with negative control.The result display total length promotor tnnc2-pro of 2313bp and the tnnc2-Q2 fragment of 1048bp possess the expression specificity that the function independently starting reporter gene expression also remains muscle tissue simultaneously.Using tnnc2-Q2 fragment relatively short for sequence as core promoter, build the recombinant expression vector of the pig PPAR γ gene relevant to fatty deposits, the carrier called after pGL3-tnnc2-Q2-PPAR γ that applicant will build.By pGL3-tnnc2-Q2-PPAR γ transfection C2C12 cell, the expression of fluorescence quantitative PCR detection pig PPAR γ gene.Found that, tnnc2-Q2 can improve the expression amount about 3 times of PPAR γ gene in C2C12 cell, proves that isolated core promoter tnnc2-Q2 has both the ability starting luciferase reporter gene and fatty genes involved.

Concrete steps of the present invention are as follows:

By pig tnnc2 gene is searched by US National biological study institute website NCBI (http://www.ncbi.nlm.nih.gov/), this gene order is as shown in SEQ ID NO:6, using this gene mRNA 5 ' end upstream 3000bp to the sequence of downstream First Intron as regulation and control region, using this sequence as research object, MEME Multiple Sequence Alignment software is utilized to analyze it, determine total length promoter region, as shown in SEQ IDNO:1.Cis-trans functional element and CpG island distribution situation is predicted again according to TFSEARCH and MethPrimer.According to the result design primer of neural network forecast, with Large White genomic dna for template, pcr amplification obtains the promoter region of 5 different lengthss, and sequence is respectively as shown in sequence table SEQ ID NO:1-SEQ ID NO:5.These promotor candidate segment are loaded into multiple clone site place, pGL3-basic reporter gene LUC upstream, are assembled into fusion expression vector (Fig. 3).By Fugene HP transfection by instantaneous for the fusion expression vector C2C12 cell proceeding to C2C12,3T3-L1 and differentiation, proceed to Renilla luciferase reporter gene pRL-TK is internal reference plasmid simultaneously.The present invention arranges negative control pGL3-basic (Fig. 2), positive control pGL3-control.By Dual-luciferase reportor systerm, quantitative analysis is carried out to reporter gene LUC after transfection 48h, and then investigate the start-up performance of different deletion fragments in different sources cell of this promotor of checking.Further, the core promoter obtained is connected the CDS region of pig PPAR γ, build recombinant expression vector, the CDS regional sequence of pig PPAR γ is as shown in SEQ ID NO:7.After recombinant vectors transfection C2C12 cell 48h, extract cell RNA, by the expression amount of fluorescence quantitative PCR detection PPAR γ in C2C12 cell, prove that the core promoter of skeletal muscle specificity can not only start reporter gene expression with this, also possess the ability starting fatty related gene expression simultaneously.

The invention has the advantages that:

(1) each section ability that promotor gene is expressed in different sources cell of pig tnnc2 promotor that what the present invention was detailed demonstrate, the expression regulation for tnnc2 gene brings deeper cognition.

(2) the present invention identifies the core section of the startup pigling tnnc2 of muscle tissue specifically expressing, for genetically engineered and molecular breeding provide the promotor resource of new specifically expressing.

More detailed technical scheme is see the content of " embodiment ".

Accompanying drawing explanation

The total length promoter sequence tnnc2-pro of the Animal muscles specific expression gene tnnc2 of sequence table SEQ ID NO:1 the present invention clone, length is 2313bp.

Sequence table SEQ ID NO:2 is the nucleotide sequence of cloning the deletion promoters tnnc2-Q1 obtained from described SEQ ID NO:1 nucleotide sequence, and length is 1237bp.

Sequence table SEQ ID NO:3 is the nucleotide sequence of cloning the deletion promoters tnnc2-Q2 obtained from described SEQ ID NO:1 nucleotide sequence, and length is 1048bp.

Sequence table SEQ ID NO:4 is the nucleotide sequence of cloning the deletion promoters tnnc2-Q3 obtained from described SEQ ID NO:1 nucleotide sequence, and length is 484bp.

Sequence table SEQ ID NO:5 is the nucleotide sequence of cloning the deletion promoters tnnc2-Q4 obtained from described SEQ ID NO:1 nucleotide sequence, and length is 338bp.

Sequence table SEQ ID NO:6 is the full length sequence of the present invention as the Animal muscles specific expression gene tnnc2 of probe, and length is 1143bp, and the Genebank accession number of pig tnnc2 gene is 414905.

Sequence table SEQ ID NO:7 is the pig PPAR γ gene C DS sequence (the Genebank accession number of pig PPAR γ gene is 397671) that the present invention clones, and length is 1515bp, 504 amino acid of encoding.

Fig. 1: Technology Roadmap of the present invention.

Fig. 2: expression vector pGL3-basic structural representation, comprises reporter gene luc+ in the below of multiple clone site.

Fig. 3: what build take pGL3-basic as the fusion vector sketch of skeleton.The promotor series of deletions fragment of skeletal muscle specific expression gene tnnc2 drives LUC genetic expression, is represented by the deleted promoter in figure.Amp is ammonia benzyl resistance screening gene; Luc+ is reporter gene Photinus pyralis LUC; The direction of arrow represents the direction of gene or promoter expression.

Fig. 4: the Mlu I of fusion vector and Nhe I double digestion qualification figure.M represents DL marker2000,1-5 represents the double digestion result of fusion vector pGL3-tnnc2-Q1, pGL3-tnnc2-Q2, pGL3-tnnc2-Q3, pGL3-tnnc2-Q4, pGL3-tnnc2-pro respectively, band larger is above carrier ribbon, lower end is deletion promoters band, and band length is respectively 1237bp, 1048bp, 484bp, 338bp, 2313bp.

Fig. 5: by the expression of series of deletions promoters driven LUC gene in the cell of different sources of skeletal muscle specific expression gene tnnc2.

Fig. 6: carrier pcDNA-3.1-PPAR γ structural representation.

The structural representation of Fig. 7: recombinant expression plasmid pGL3-tnnc2-Q2-PPAR γ.

The PCR qualification figure of Fig. 8: recombinant expression plasmid pGL3-tnnc2-Q2-PPAR γ.M represents DL marker2000, and the 1 CDS region representing PPAR γ gene, 2 represent tnnc2-Q2 fragments.

Fig. 9: quantitative PCR measures the expression amount of PPAR γ gene in C2C12 cell.

Embodiment

Embodiment 1: the promotor candidate segment of skeletal muscle specificity expressing gene tnnc2 of pig and the acquisition of corresponding deletion fragment

(GenBank accession number: 414905) be probe sequence extracts the region of candidate gene mRNA5 ' end upstream 3000 to First Intron as regulation and control region to the DNA sequence dna of the tnnc2 gene of the pig of utilization report at NCBI (http://www.ncbi.nlm.nih.gov/).Utilize the total length promoter region of MEME prediction functionality, by bioinformatics software prediction core promoter region, cis-trans functional element and CpG island distribution situations such as TFSEARCH and MethPrimer.According to the primer of the result of neural network forecast design total length promotor and 3 ' end deletion fragment, (primer sequence is as shown in table 1; PCR reaction parameter arranges as shown in table 2).Wherein tnnc2-pro-F represents the public front primer of 5 promoter fragments, adds restriction enzyme site Mlu I (ACGCGT represents with underscore), carries protection base CG (shadow representation); Tnnc2-pro-R, tnnc2-Q1-R, tnnc2-Q2-R, tnnc2-Q3-R, tnnc2-Q4-R represent the rear primer of 5 promoter fragments respectively; add restriction enzyme site Nhe I (GCTAGC; represent with underscore), carry protection base CTA (shadow representation).With the poba gene group DNA of Large White for template, PCR first increases total length promoter sequence tnnc2-pro, amplified production through 1.5% agarose electrophoresis detect and Omega company reclaim kits reclaim after, as the template of deletion promoters, put to-20 DEG C for subsequent use.

Table 1: the design of pig tnnc2 promoter deletion vector primer

Table 2PCR Amplification

Embodiment 2: the promotor of the skeletal muscle specificity expressing gene tnnc2 of pig and the transfection carrier of corresponding deletion fragment build.

(1) restriction enzyme Mlu I and Nhe I enzyme are cut carrier pGL3-basic (carrier are purchased from Pu Luomaige (Beijing) Bioisystech Co., Ltd, i.e. U.S. Promega company, the information such as carrier and multiple clone site is shown in Fig. 2) and recovery product tnnc2-pro, rnnc2-Q1, rnnc2-Q2, rnnc2-Q3, tnnc2-Q4 of each promoter fragment.The enzyme system of cutting is:

Detect enzyme with the agarose gel electrophoresis of 1.5% after 37 DEG C of enzymes cut 6h cut result and reclaim object fragment: pGL3-basic reclaims larger fragment, and tnnc2-pro, tnnc2-Q1, tnnc2-Q2, tnnc2-Q3, tnnc2-Q4 reclaim the fragment of corresponding size.Reclaim test kit with the glue of Omega company and reclaim (operating by the specification sheets of this test kit), be placed in-20 DEG C of Refrigerator stores.

(2) promoter fragment that enzyme cuts back to close is connected to (see Fig. 3) on pGL3-basic carrier, linked system is in table 3.

Table 3 linked system

16 DEG C of water-baths are spent the night connection, proceeded in bacillus coli DH 5 alpha, screening positive monoclonal containing on the LB flat board of penbritin (Amp), PCR being carried out to recon and enzyme cuts qualification, positive recombinant being chosen and send the prosperous bio tech ltd order-checking of Beijing AudioCodes.For the correct positive colony that checks order in original bacteria liquid: the ratio of culture volume than=1: 100 carries out enlarged culturing, with the plasmid that can be used for cell transfecting extraction agent box (D6950-01) the extracting plasmid in a small amount that OMEGA company produces after 37 DEG C of shaking tables shake 16h, operate by the specification sheets of this test kit, respectively called after pGL3-tnnc2-pro, pGL3-tnnc2-Q1, pGL3-tnnc2-Q3, pGL3-tnnc2-Q4.With the plasmid of Mlu I, Nhe I double digestion qualification extracting, it is described above that enzyme cuts system, and now plasmid only need add 1 μ L, and enzyme is cut and be the results are shown in Figure 4, is placed in-20 DEG C of refrigerators for subsequent use.

Embodiment 3: the cell transfecting of promotor and deletion fragment recombinant plasmid

The present invention does transfection with 24 porocyte culture dish and uses.In order to eliminate the error of experiment, each recombinant vectors all carries out independently testing for 3 times, and 3 repetitions are done in each test.According to the operation of Fugene HD (Roche company) specification sheets, every hole is in the quality of carrier: the ratio transfection of the volume=0.5 μ g:1.5 μ L of transfection reagent.The acceptor of transfection is the cell of different sources, mainly comprises Mouse Muscle source cell system C2C12 (purchased from Chinese Academy of Sciences's cell bank), mouse Preadipocyte In Vitro 3T3-L1 (purchased from Chinese Academy of Sciences's cell bank) and horse serum induction C2C12 cell (purchased from Chinese Academy of Sciences's cell bank) myotube that is differentiated to form with 2%.The activity of Dual-Luciferase detection system to deletion promoters is utilized to analyze after recombinant vectors (pGL3-tnnc2-pro, pGL3-tnnc2-Q1, pGL3-tnnc2-Q2, pGL3-tnnc2-Q3, pGL3-tnnc2-Q4) is transfected into cell 48h after collecting cell lysate.Described in being formulated as follows of the key step of cell cultures of the present invention, differentiation-inducing, transfection and various solution:

(1) preparation of main solution

1) cell growth medium (the foetal calf serum substratum FBS of 10% concentration): foetal calf serum (purchased from GIBCO company) is positioned over 4 DEG C of refrigerators and melts, after it melts completely, draw the DMEM/F12 substratum (purchased from HyClone company) that 10mL foetal calf serum moves into 100mL, 0.25 μm of rearmounted 4 DEG C of refrigerator of frit is for subsequent use.

2) preparation of differentiation culture liquid (the horse serum nutrient solution of 2% concentration): horse serum (purchased from GIBCO company) is positioned over 4 DEG C of refrigerators and melts, after it melts completely, draw the horse serum of 2mL, add the DMEM substratum (being purchased from HyClone company) of 100mL, it is for subsequent use that 0.25 μm of frit is placed on 4 DEG C of refrigerators.

3) cells frozen storing liquid: dimethyl sulfoxide (DMSO) (DMSO), the low sugar culture-medium of DMEM/F12, foetal calf serum three volume ratio are 1: 4: 5, and the frozen storing liquid prepared is frozen in-20 DEG C.

(2) cellar culture of cell

1) change nutrient solution according to the upgrowth situation of cell, within general 1 or 2 day, change once;

2) can go down to posterity time more than cell density to 80%, with the nutrient solution that suction pipe sucking-off is old, with phosphate buffered saline buffer, namely PBS (purchased from HyClone company) rinses twice.By 0.25% trypsin of 37 DEG C of preheatings purchased from GIBCO company) add culturing bottle, general 50cm2 Tissue Culture Flask adds 400 μ L, is paved by pancreatin to cover all cells at the bottom of cell bottle, sucking-off pancreatin after room temperature placement 15s-30s;

3) pat cell bottle sidewall 30s-60s gently, cell is come off from bottle wall, adds a certain amount of fresh 10%FBS nutrient solution in time, the cell being attached to bottle wall is rinsed and stops pancreatin effect;

4) do not rinse the attached cell got off with suction pipe featheriness, make the cell on bottle wall depart from formation cell suspension completely, avoid the generation of bubble as far as possible;

5) blow and beat cell evenly after, the cell suspension of sucking-off 1/2 or 1/3 moves in new cell bottle, puts into 37 DEG C, 5%CO after shaking up gently ₂incubator is cultivated.

(3) carry out differentiation-inducing to C2C12 cell

When cell density is at 60%-70%, outwell original 10%FBS+DMEM/F12 nutrient solution, after PBS cleaning twice, add the DMEM nutrient solution of the horse serum of isopyknic 2%, put into 37 DEG C of incubators and cultivate.Cell can change liquid every 1 to 2 day, the growthhabit situation of basis of microscopic observation cell, and within 3-5 days, can be observed myotube and formed, the cell after this test and Selection induces 7 days is tested.

(4) Fugene HP transfection procedure

1) 12-24 hour before transfection, get the good and cell density of one bottle of upgrowth situation about 80% cell, after tryptic digestion, what add proper amount of fresh does not contain any antibiotic 10%FBS Growth of Cells nutrient solution, with suction pipe cell dispelled completely and form uniform cell suspension, in 24 orifice plates, every hole adds the cell suspension of 500 μ L, rocks culture plate gently and shakes up cell and be placed on 37 DEG C, cultivate 12h-24h in 5%CO2 cell culture incubator;

2), during transfection, the cell density in orifice plate should reach more than 80%.Getting 0.5 μ g plasmid (pGL3-tnnc2-pro ~ pGL3-tnnc2-Q4) adds in the OPTI-MEM solution of 50 μ L, and piping and druming adds the Fugene HP of 1.5 μ L again after mixing gently, and room temperature leaves standstill 25min;

3) discard the cell culture fluid in orifice plate, with 1 × PBS or serum-free without after twice, dual anti-nutrient solution cleaning cell, add fresh cell culture fluid;

4) the 24 every holes of orifice plate add in (2) after mixed solution, and after the sway,postural culture plate of right-angled intersection all around mixes, put into 37 DEG C, 5%CO2 cell culture incubator cultivates 48h;

For the C2C12 cell after differentiation-inducing, after it cultivates 7 days with 2%HS nutrient solution in the orifice plate, with Fugene HP transfection.

Embodiment 4: the detection of the promotor candidate segment of skeletal muscle specificity expressing gene tnnc2 and two Luciferase activity of corresponding deletion fragment

The present embodiment arranges negative control plasmids pGL3-basic, positive control plasmid pGL3-control, with Renilla luciferase reporter gene pRL-TK, (carrier is purchased from Pu Luomaige (Beijing) Bioisystech Co., Ltd, i.e. U.S. Promega company) do internal reference plasmid (in order to correct transfection efficiency), collecting cell lysate after transfectional cell 48h, utilize luciferase reporter gene to detect lifetime measurement system to analyze the activity of the different deletion fragment of the promotor of Animal muscles different expression gene tnnc2 and tissue specificity, determine high reactivity and possess the section of muscle tissue expression specificity.Result shows (as shown in Figure 5): pGL3-tnnc2-pro, pGL3-tnnc2-Q1, pGL3-tnnc2-Q2, pGL3-tnnc2-Q4 all exist transcriptional activity in various degree in C2C12 cell, only has pGL3-tnnc2-Q1 to there is faint activity in 3T3-L1 cell.In C2C12 cell after differentiation, pGL3-tnnc2-pro activity has great raising, and the activity of pGL3-tnnc2-Q1 and pGL3-tnnc2-Q2 reduces, and the activity of pGL3-tnnc2-Q4 is down to consistent with negative control.The present invention finally obtains the total length promotor tnnc2-pro (sequence information is shown in SEQ ID NO:1) of 2313bp and the tnnc2-Q2 fragment (sequence information is shown in SEQ ID NO:3) of 1048bp, and two fragments possess the expression specificity that the function independently starting reporter gene expression also remains muscle tissue simultaneously.

Embodiment 5: core promoter drives external source PPAR γ gene in the checking of C2C12 cells

The present embodiment for research object with tnnc2-Q2 fragment, is thought that it is the core promoter fragment having muscle specific concurrently, is connected the PPAR γ gene C DS region relevant to fatty deposits, under core promoter effect, detects its expression in sarcoplast.

(1) the pcDNA-3.1-PPAR γ plasmid preserved with this laboratory for template (see Fig. 5), amplification pig PPAR γ CDS region.In order to the expression of enhancing gene, hold at upstream primer 5 ' and add Kozak sequence GCCACC, downstream primer 3 ' holds the terminator codon TGA of interpolation 6 × his histone sequence label CACCACCATCACCATCAT and mouse preference, primer called after is-tnnc2-Q2-PPAR γ-F and 1.-PPAR γ-6 × his-R 1., primer sequence is in table 4, and pcr amplification parameter is with shown in table 2.

The design of table 4 pig PPAR γ gene clone primer

(2), after restriction enzyme Hind III and Xba I double digestion pGL3-tnnc2-Q2, adopt the CDS region of the PPAR γ of amplification is connected to tnnc2-Q2 downstream by PCR mono-step directed cloning test kit, and system is as follows:

PCR reclaims product and pGL3-tnnc2-Q2 reclaims product 37 DEG C of homologous recombination after 30 minutes, transformation of E. coli DH5 α, and after transforming, picking positive colony send survey.Due to PPAR γ fragment containing Hind III digestion site, PCR method is adopted to replace double digestion qualification recombinant plasmid.Promotor Auele Specific Primer tnnc2-pro-F/tnnc2-Q2-R identifies tnnc2-Q2 fragment, and PPAR γ-F/R identifies PPAR γ fragment.Primer PPAR γ-F/R is respectively: 5 ' ATGGGTGAAACTCT3 ' and 5 ' GTACAAGTCCTTGTATATTTCCTGTAGG3 '

(3) the plasmid called after pGL3-tnnc2-Q2-PPAR γ will built, transfection C2C12 cell, each plasmid does 3 repetitions, and the C2C12 cell simultaneously arranging 3 any plasmids of untransfected is blank.48h after transfection, the RNA carrying out C2C12 cell with the RNA extraction test kit of OMEGA company extracts (operating by test kit specification sheets), carries out reverse transcription (operating by the specification sheets of the Reverse Transcription box of Thermo company), the Light Cycler480 quantitative real time PCR Instrument (operating by the specification sheets of instrument) of Roche company is adopted to measure the expression amount of PPAR γ in C2C12 cell, PPAR γ and reference gene primer are in table 4, and quantitative fluorescent PCR program is as shown in table 5:

Table 5 increases the design of primers of C2C12 cell cDNA

Table 6 fluorescent quantitative PCR system

The all samples of quantitative test carries out 4 times to be repeated.Gene relative expression quantity is with 2 ^{-△ △ CT}algorithm, experimental error represents with SD, T inspection carry out significance analysis.

Result shows, in transfection in the C2C12 cell of recombinant plasmid pGL3-tnnc2-Q2-PPAR γ, the expression amount of PPAR γ is significantly higher than the blank C2C12 cell of untransfected recombinant plasmid, about about 3 times, prove that muscle specific core promoter tnnc2-Q2 can drive the C2C12 cells of PPAR γ mouse of external source really.

Claims (3)

1. the promotor that a regulation and control Swine muscle Skeletal Muscle Gene tnnc2 is specific expressed in muscle tissue, its nucleotide sequence is as shown in sequence table SEQ ID NO:1.

2. the promotor that a regulation and control Swine muscle Skeletal Muscle Gene tnnc2 is specific expressed in muscle tissue, its nucleotide sequence is as shown in sequence table SEQ ID NO:3.

3. the promotor described in claim 1 or 2 is in the application of regulatory gene in Swine muscle in specifically expressing.