CN103421777B

CN103421777B - PCR-instrument-free method for fast and accurately amplifying lateral wing nucleotide sequence and application

Info

Publication number: CN103421777B
Application number: CN201310412687.5A
Authority: CN
Inventors: 胡广隆; 程丽莉; 黄武刚
Original assignee: INSTITUTE OF FORESTRY AND FRUIT BEIJING ACADEMY OF AGRICULTURE AND FORESTRY SCIENCES
Current assignee: INSTITUTE OF FORESTRY AND FRUIT BEIJING ACADEMY OF AGRICULTURE AND FORESTRY SCIENCES
Priority date: 2013-09-11
Filing date: 2013-09-11
Publication date: 2015-05-13
Anticipated expiration: 2033-09-11
Also published as: CN103421777A

Abstract

The invention provides a PCR-instrument-free method for fast and accurately amplifying a lateral wing nucleotide sequence. The method comprises the following steps of 1) a first round of reaction, wherein the first round of reaction is carried out through a DNA template, recombinase polymerase and a first round of primers; 2) a second round of reaction, wherein the product of the first round of reaction is used as a template, recombinase polymerase and a second round of primers are added, and the second round of reaction is carried out; 3) a third round of reaction, wherein the product of the second round of reaction is used as a template, recombinase polymerase and a third round of primers are added, and the third round of reaction is carried out. The primers and kits for the PCR-instrument-free method for fast and accurately amplifying the lateral wing nucleotide sequence are further provided. The invention further provides the application of the method, the primers and the kits in the amplification of a DNA sequence. The method is free of the PCR instrument, and can amplify the DNA lateral wing sequence simply, efficiently and accurately.

Description

Without the need to flanking nucleic acid sequence quick and precisely amplification method and the application of PCR instrument

Technical field

The present invention relates to genetically engineered field, particularly relate to quick and precisely amplification method and the application of a kind of flanking nucleic acid sequence without the need to PCR instrument.

Background technology

Scientific research personnel has developed several PCR method without the need to setting up cDNA storehouse or screening and cloning, for obtaining the unknown nucleotide sequence be connected with known array.These PCR method comprise inverse PCR (IPCR), ligation-mediated PCR (LM-PCR), arbitrarily primed PCR (RP-PCR) etc.Although these methods have certain effect and updated, be still limited by that loaded down with trivial details enzyme is cut, aptamers connects (adaptor ligation) and purification step.And the random primer of RP-PCR often can produce waste products because of non-specific annealing.Renaturation afterwards controls the specificity that primer (ACP) technology improves small pieces oligonucleotide, some shortcomings of appeal gene walking method can be overcome, but this technology still relies on PCR instrument amplification, three-wheel PCR reaction time consumption reaches 4 and a half hours, and design to control given block primer that primer matches with renaturation time, still to consider primer annealing.

Summary of the invention

For solving the problem, the object of this invention is to provide quick and precisely amplification method and the application of a kind of flanking nucleic acid sequence without the need to PCR instrument.

The present invention is successful first to combine recombinase polymeric enzymatic amplification technology (RecombinasePolymerase Amplification) with containing hypoxanthic design of primers technology, and realizes the efficiently and accurately amplification of DNA flanking sequence.

The present invention selects the recombinase polysaccharase of TwistDX company of Britain, they have fast, the feature of isothermal, normal temperature amplification, it is a kind of amplification technique being different from PCR completely, the nucleic acid primer of recombinase pairing DNA profiling wherein, polysaccharase synthesis new nucleic acid chain, can complete exponential amplification at about 15 minutes.

In traditional arbitrarily primed PCR process, there is following problem: random primer is too short, then likely cause many wheel PCR primer inconsistent, random primer is long, then likely increase less than product.For addressing this problem, we introduce poly deoxyinosine nucleosides poly (dI) in random primer design process, random primer length can be made like this to reach more than 20bp, effectively reduce the unstable caused because primer length is too short in many wheel amplifications; Due to introduce poly (dI) do not affect random primer and template in conjunction with time randomness, when with template DNA effect, poly (dI) in primer can form the structure (as shown in Figure 1) of an air bubble-shaped, it can promote that poly (dI) is above combined with template specificity by the sequence of 5 based compositions and suppresses the combination of sequence and template after it, thus the only template that is combined with 5, front end base of specific amplified.

The invention provides the primer for the quick and precisely amplification method of the flanking nucleic acid sequence without the need to PCR instrument, it is:

RPA-nest1c:tcacagaagtatgccaagcgaggiiiiicggtc(is as shown in SEQ ID No.1);

RPA-nest1a:tcacagaagtatgccaagcgaggiiiiiaggtc(is as shown in SEQ ID No.2);

RPA-nest1t:tcacagaagtatgccaagcgaggiiiiitggtc(is as shown in SEQ ID No.3);

RPA-nest1g:tcacagaagtatgccaagcgaggiiiiigggtc(is as shown in SEQ ID No.4);

RPA-nest2:tcacagaagtatgccaagcg(is as shown in SEQ ID No.5);

RPA-nest3:cagaagtatgccaagcgagg(is as shown in SEQ ID No.6).

A kind of flanking nucleic acid sequence without the need to PCR instrument provided by the invention quick and precisely amplification method, comprises the steps:

1) first round reaction

First round reaction is carried out with DNA profiling, recombinase polysaccharase, first round primer;

Described first round primer is for RPA-nest1c(is as shown in SEQ ID No.1), RPA-nest1a(is as shown in SEQ ID No.2), RPA-nest1t(is as shown in SEQ ID No.3) and RPA-nest1g(as shown in SEQ ID No.4);

2) second reaction is taken turns

With first round reaction product for template, add recombinase polysaccharase, second and take turns primer, carry out second and take turns reaction;

Described second takes turns primer for RPA-nest2(as shown in SEQ ID No.5);

3) third round reaction

Take turns reaction product for template with second, add recombinase polysaccharase, third round primer carries out third round reaction;

Described third round primer is for RPA-nest3(is as shown in SEQ ID No.6).

Wherein, described recombinase polysaccharase is the recombinase polysaccharase of TwistDX company of Britain, specifically TwistDX recombinase polysaccharase freezing dry powder (freeze-dried reaction).

Wherein, reaction system is specific as follows:

First round reaction system:

Wherein, reaction conditions is often wheel reaction 37-39 DEG C of heating 15-40 minute, preferably heating 15 minutes.

Another object of the present invention is to provide the test kit for the quick and precisely amplification method of the flanking nucleic acid sequence without the need to PCR instrument, comprises following component:

Test kit for the quick and precisely amplification method of the flanking nucleic acid sequence without the need to PCR instrument of the present invention, as being designed to the test kit of amplification 100 times, then comprises following component:

Another object of the present invention is to provide the quick and precisely application of amplification method in DNA sequence dna amplification of the described flanking nucleic acid sequence without the need to PCR instrument.

The present invention also provides the described application of primer in DNA sequence dna amplification for the quick and precisely amplification method of the flanking nucleic acid sequence without the need to PCR instrument.

The present invention also provides the described application of test kit in DNA sequence dna amplification for the quick and precisely amplification method of the flanking nucleic acid sequence without the need to PCR instrument.

Method of the present invention is invented in order to simple, efficient, accurate DNA amplification flanking sequence, be a kind of need not build storehouse, need not enzyme cut, need not fix, also need not the method for complicated PCR, successfully first recombinase polymeric enzymatic amplification technology (Recombinase PolymeraseAmplification) to be combined with containing hypoxanthic design of primers technology and the efficiently and accurately realizing DNA flanking sequence increases, target product can obtain in 4 hours.Method of the present invention surmounts other existing methods, very reliably, only obtains target product, without non-specific product.Major advantage of the present invention is as follows:

(1) avoid because of sex change, annealing, extend equitemperature and control the wrong amplification failure caused.

(2) without PCR instrument, easy and simple to handle, consuming time few, amplification and the electrophoresis detection of the reaction of three-wheel nido can be completed in two hours.

(3) because design of primers (comprise in design of primers and add xanthoglobulin) cleverly effectively inhibits non-specific amplification, specific band nothing but after three-wheel amplification.

Accompanying drawing explanation

Fig. 1 is the random primer amplification schematic diagram containing there being poly deoxyinosine nucleosides.

Wherein, 1 holds 5 base sequences for 3', and 2 is poly deoxyinosine nucleosides, and 3 is that 5' holds non-targeted tail sequence.

Fig. 2 is that embodiment 1 increases the experiment flow of one section of microsatellite sequence total length in Chinese chestnut and electrophoresis photographs with the inventive method.

Wherein, Y1, Y2, Y3 are respectively the electrophoretic band of three-wheel product.

Embodiment

Following examples for illustration of the present invention, but are not used for limiting the scope of the invention.If do not specialize, the conventional means that technique means used is well known to those skilled in the art; Experimental technique used is ordinary method; Material used, reagent etc., all can obtain from commercial channels.

Embodiment 1 increases one section of microsatellite sequence total length in Chinese chestnut with the inventive method

One section of microsatellite sequence in Chinese chestnut:

GGCTGAAAACCAAGGCCGGAGTGGCATGTTCTTTAAAATGCTAT

CAGTAATCCCTCAGGTCAACTCTCTCTCTCTCTCTCTCTCTCGCT

CTCTCTCTCCATATATATATGTGTGTGTGTGTGTGTGTGCGCGCG

CGTGTGTGTGTGTGTG(is as shown in SEQ ID No.7)

This section of microsatellite sequence total length amplification is very difficult: in this sequence, the tumor-necrosis factor glycoproteins of site tumor-necrosis factor glycoproteins reaches 82; Multiple copied is there is in Post section sequence at genome; In site there is reverse complementary sequence in the section of having sequence in genome.With the inverse PCR (IPCR) of forefathers' invention, ligation-mediated PCR (LM-PCR), the object fragments that all do not increase such as arbitrarily primed PCR (RP-PCR), although control primer (ACP) technology by renaturation to have increased object fragment, but it is in a couple of days consuming time, and get into trouble in the process of design of primers, design of primers is careless slightly, causes the failure of an experiment.

The concrete reaction method of the present embodiment is as follows:

1 according to known array design primer

The first round:

Random primer (by the synthesis of invitrogen company):

RPA-nest1c:tcacagaagtatgccaagcgaggiiiiicggtc(is as shown in SEQ ID No.1)

RPA-nest1a:tcacagaagtatgccaagcgaggiiiiiaggtc(is as shown in SEQ ID No.2)

RPA-nest1t:tcacagaagtatgccaagcgaggiiiiitggtc(is as shown in SEQ ID No.3)

RPA-nest1g:tcacagaagtatgccaagcgaggiiiiigggtc(is as shown in SEQ ID No.4)

Immobilized primer on known array:

F1:TCAGTAATCCCTCAGGTCAA(, as shown in SEQ ID No.8, is synthesized by invitrogen company)

Second takes turns:

RPA-nest2:TCACAGAAGTATGCCAAGCG(, as shown in SEQ ID No.5, is synthesized by invitrogen company)

F2:CAGTAATCCCTCAGGTCAAC(, as shown in SEQ ID No.9, is synthesized by invitrogen company)

Third round:

RPA-nest3:CAGAAGTATGCCAAGCGAGG(, as shown in SEQ ID No.6, is synthesized by invitrogen company)

F3:GTAATCCCTCAGGTCAACTC(, as shown in SEQ ID No.10, is synthesized by invitrogen company)

2 nested amplification technology reaction systems:

First round reaction system: RPA-nest1c(is as shown in SEQ ID No.1) 0.6uL, RPA-nest1a(be as shown in SEQ ID No.2) 0.6uL, RPA-nest1t(be as shown in SEQ ID No.3) 0.6uL, RPA-nest1g(be as shown in SEQ ID No.4) 0.6uL, immobilized primer F12.4uL, TwistDx Rehydration Buffer29.5uL on known array, DNA profiling (10-1000ng) add ddH ₂o 13.2uL mixing altogether, adds TwistDX recombinase polysaccharase freezing dry powder 1pellet(1 and manages) mixing, then add magnesium acetate (MgAc) aqueous solution mixing that 2.5uL concentration is 280mmol/L, obtain first round reaction system;

Second takes turns reaction system: RPA-nest2(is as shown in SEQ ID No.5) 2.4uL, immobilized primer F22.4uL, TwistDx Rehydration Buffer29.5uL on known array, the first round product 5uL, ddH ₂o8.2uL mixes, and adds TwistDX recombinase polysaccharase freezing dry powder 1pellet and mixes, then adds the MgAc aqueous solution mixing that 2.5uL concentration is 280mmol/L, obtains second and takes turns reaction system;

Third round reaction system: RPA-nest3(is as shown in SEQ ID No.6) 2.4uL, immobilized primer F32.4uL, TwistDx Rehydration Buffer29.5uL, second on known array take turns product 5uL, ddH ₂o8.2uL mixes, and adds TwistDX recombinase polysaccharase freezing dry powder 1pellet and mixes, then adds the MgAc aqueous solution mixing that 2.5uL concentration is 280mmol/L, obtains third round reaction system.

Reaction conditions: heat in gold and silver apricot H2O3-100C dry type constant-temperature metal bath, often take turns 37 ~ 39 DEG C 15 minutes.

3 electrophoresis detection

Get the final amplified production of 5uL point sample electrophoresis (adopting Baygene horizontal cataphoresis apparatus) in agarose.Electrophoresis detection and purifying and the common PCR reaction of three-wheel reaction are as good as, can not be purified with regard to electrophoresis detection, and point sample sky is brighter but do not affect detected result.

4 purified products

With common PCR primer purification kit (as MinElute Reaction Cleanup Kit).

Experiment flow and electrophoresis photographs are shown in Fig. 2, and sequencing result, with SEQ ID No.7, illustrates that method of the present invention has successfully increased target sequence total length.

Result shows, the recombinase polysaccharase flanking sequence amplification kit of we oneself exploitation can complete the reaction of three-wheel nido and without the need to PCR instrument without the need to groping complicated PCR response procedures in two hours, have time-saving and efficiency, design of primers requires low, product specificities advantages of higher.

Although above the present invention is described in detail with a general description of the specific embodiments, on basis of the present invention, can make some modifications or improvements it, this will be apparent to those skilled in the art.Therefore, these modifications or improvements without departing from theon the basis of the spirit of the present invention, all belong to the scope of protection of present invention.

Claims

1., without the need to a flanking nucleic acid sequence quick and precisely amplification method for PCR instrument, it is characterized in that, comprise the steps:

1) first round reaction

Described first round primer is

RPA‐nest1c：tcacagaagtatgccaagcgaggiiiiicggtc；

RPA‐nest1a：tcacagaagtatgccaagcgaggiiiiiaggtc；

RPA‐nest1t：tcacagaagtatgccaagcgaggiiiiitggtc；

RPA‐nest1g：tcacagaagtatgccaagcgaggiiiiigggtc；

2) second reaction is taken turns

Described second take turns primer be RPA ?nest2:tcacagaagtatgccaagcg;

3) third round reaction

Described third round primer be RPA ?nest3:cagaagtatgccaagcgagg.

2. method according to claim 1, is characterized in that, described recombinase polysaccharase is the recombinase polysaccharase of TwistDX company of Britain.

3. method according to claim 2, is characterized in that, described recombinase polysaccharase is TwistDX recombinase polysaccharase freezing dry powder.

4. method according to claim 1, is characterized in that, reaction system is specific as follows:

First round reaction system:

Second takes turns reaction system:

Third round reaction system:

5. method according to claim 1, is characterized in that, reaction conditions be often take turns reaction 37 ?39 DEG C of heating 15 ?40 minutes.

6. claim 1 ?the application in DNA sequence dna amplification of method described in 5 any one.