CN103409525A - Method for identifying branch rooting ability of larch - Google Patents

Abstract

The invention discloses a specific primer pair and an identification method for identifying the rooting ability of larch. A primer sequence is formed by 5'CTGCTTAGGGGTGGCCTGTC3' and 5'CTGCTTAGGGAGAACCATGGATGTG3'. The method for identifying the high rooting ability of the larch by using the primers comprises the steps as follows: extracting and detecting larch genome DNA; amplifying PCR of the specific primer pair; performing gel electrophoresis detection of the product of the PCR; judging and reading a result; identifying whether the detected larch has high rooting ability according to the result of the PCR amplification of the detected larch genome DNA. By adopting the method, the fit rate of the identification result and the field can reach above 95 percent. The method provides a molecular level auxiliary means for larch high rooting ability plant system selection and culture, and has important application value.

Description

A kind of method of identifying tamarack branch rootability

Technical field

The present invention relates to the special primer sequence of the evaluation tamarack vegetative propagation branch rootability in biotechnology and utilize this primer sequence to identify the methods and applications of tamarack branch rootability.

Background technology

Tamarack is the seeds type with Important Economic and ecological value, has higher drought-resistant ability.Because distribute is in cold and alpine belt more, at the bottom of ground, draw the prerequisite that sufficient moisture becomes Larch Growth, tree root is that control trees and its surrounding environment are carried out one of critical organ of energy and dispensed materials, and therefore possessing high rootability is one of important channel of improving the plant drought ability.

For the good character that makes the tamarack parent keeps stable and expanding propagation coefficient, meet the needs of producing breeding, cottage propagation has become one of larchen main modes of reproduction.For the vegetative ideal genotype of mass-producing, should have both fast-growing and good rootability.According to research and the comprehensive evaluation result of each maternal plant cuttage rooting ability of Cai Sui garden, cut down except the poor maternal plant of rootability, can increase substantially the rootability of Cai Sui garden cuttings, improve cuttage seeding root system development situation.

Yet the methods such as employing conventional determining rooting rate are carried out the rootability judgement, are screened consuming time, effort, are subject to simultaneously the impact of external environment factor.Along with the development of Protocols in Molecular Biology, from DNA level, by molecular marking technique, objective trait is carried out to anticipation, early screening and evaluation and become possibility.Because it is not subjected to such environmental effects, and do not need plant to show proterties and just can carry out examination to it, shortening the breeding cycle greatly, can reduce simultaneously man power and material's waste, so the molecule marker ancillary technique is carrying out, aspect early screening, evaluation, significant application value is just arranged to different genotype tamarack rootability.

Summary of the invention

The objective of the invention is to overcome that existing rooting rate etc. is consuming time according to measuring, the screening of consumption power, identify the method for tamarack rootability, provide a kind of and identify fast, in early days the primer sequence of tamarack rootability and utilize this primer to identify a kind of methods and applications of rootability power after tamarack cuttage.

Technical scheme of the present invention is summarized as follows:

A kind of Auele Specific Primer for the identification of tamarack branch rootability, is characterized in that it is comprised of primer sequence 5 ' CTGCTTAGGGGTGGCCTGTC 3 ' (SEQ NO:1) and 5 ' CTGCTTAGGGAGAACCATGGATGTG 3 ' (SEQ NO:2).

Another object of the present invention is to provide a kind of PCR test kit that comprises Auele Specific Primer, and utilizes this PCR test kit to identify tamarack asexual propagation material rootability.This test kit is comprised of PCR primer, dNTP, damping fluid and archaeal dna polymerase, and its composition is as follows:

PCR primer: each 50 μ L (concentration is 10 μ M/L) of SEQ NO.1 and SEQ NO.2;

10 mM dNTP 50μL；

10 * enzyme spcificity reaction buffer, 500 μ L;

5 U/ μ l hot resistant DNA polymerase 200 μ L;

Positive reference substance 15 μ L,

Negative control product 15 μ L;

DdH ₂O 10mL; Archaeal dna polymerase is the Taq polysaccharase.

The present invention further discloses the method that adopts this test kit to identify tamarack asexual propagation material rootability, it is characterized in that being undertaken by following step:

(1) extract the tamarack genomic dna;

(2) 0.8% agarose gel electrophoresis of genomic dna detects;

(3) specific primer PCR amplification, in the centrifuge tube of pcr amplification special use, add: PCR buffered soln, dNTP, primer sequence is to 5 ' CTGCTTAGGGGTGGCCTGTC3 ' and 5 ' CTGCTTAGGGAGAACCATGGATGTG 3 ', the tamarack genomic dna, the Taq polysaccharase, sterilized water is mended to 25 μ L, the special-purpose thin wall centrifugal tube of the PCR that aforesaid liquid is housed is put into to the pcr amplification instrument, amplification condition is: 94 ℃ of sex change 2 min, after enter and fall formula PCR:94 ℃ of 30 s, 65 ℃ of 1 min, 72 ℃ of 1min10 s, amplification cycles, the circulation number of rings is 10, each circulating temperature reduces by 1 ℃, 94 ℃ of 30 s subsequently, 55 ℃ of 1 min, 72 ℃ of 1min10 s, totally 25 circulations, finally at 72 ℃, extend 5 min, amplification completes,

Composition	Concentration	Application of sample amount (μ l)
			ddH 2O	-	18.5
10 * PCR damping fluid	10×	2.5
			dNTP	10mmol/L	1μL
The Taq polysaccharase	5 U/μL	1μL
			Genomic dna	100 ng/μL	1μL
SEQ NO:1	10μmol/L	0.5μL
			SEQ NO:2	10μmol/L	0.5μL

(4) agarose gel electrophoresis of pcr amplification product detects: the sepharose of configuration 1.5% adds 0.5 μ g/mL ethidium bromide in gel; In 5 μ L amplified productions and in standard positive marker, add respectively 1 μ L 6 * sample-loading buffer, mix, with pipettor, above-mentioned mixed solution is added respectively in the point sample hole of sepharose of submergence TBE electrophoresis liquid, the 120V constant voltage, stop electrophoresis after electrophoresis 10 min, gel are directly being observed under the ultraviolet lamp of ultraviolet wavelength 265nm or on the gel imaging instrument;

(5) interpretation as a result: the migration position of the positive Marker band of secundum legem on gel and the migration position judgement tamarack root growth situation of PCR product.

The invention still further relates to the application of above-mentioned PCR test kit in identifying tamarack asexual propagation material rootability.

Above-mentioned PCR detection kit for identifying tamarack asexual propagation material rootability, whole detecting step comprises sample pretreatment-amplification-electrophoresis detection result.Primer and the needed reagent of PCR reaction system add in the amplification pipe in advance, and the user only need add pretreated sample amplification pipe to start amplified reaction to get final product, Simple fast complete testing.

Adopt Auele Specific Primer to identify the method for tamarack asexual propagation material rootability, mainly comprise:

1) extract the DNA profiling of tamarack sample to be measured;

2) in the PCR pipe, add dNTP, 10 * enzyme spcificity reaction buffer, Taq polysaccharase, primer, testing sample DNA profiling and ddH ₂O, mix;

3) by step 2) in the PCR pipe that mixes on the PCR instrument, increase;

4) electrophoresis amplified production in electrophoresis equipment, record result;

5) analyze and carry out judgement as a result.

Concrete method is as follows:

(1) extraction its concrete method of tamarack genomic dna (DNA profiling) and step are as follows:

Get young tender Larch Needles 50 mg, grinding powder in liquid nitrogen, move in the 1.5ml centrifuge tube, add 600 μ L CTAB lysates, 56 ℃ of insulation 30 min, add isopyknic phenol, chloroform, after fully mixing, centrifugal, get supernatant and add 600 μ L chloroforms, primary isoamyl alcohol, mix rear centrifugally, get supernatant and add isopyknic Virahol, after-20 ℃ of static 30 min, centrifugal 20 min of 10000g, remove supernatant, precipitate air-dry with 75% ethanol rinsing after, add 100 μ L sterilized water dissolving DNA precipitations, get the content of 5 μ L electrophoresis detection DNA quality and calculating DNA; Add 5 μ L RNase A(RNA enzyme A) (10 mg/mL), 37 ℃ of water bath heat preservations 2 hours, add the equal-volume chloroform, puts upside down gently and mix 2-3 min, centrifugal 10 min of 10,000 rpm; Get supernatant, add 3 mol/L NaAc of 1/10 volume, the dehydrated alcohol that diploid is long-pending ,-20 ℃ of static 30 min; Centrifugal 10 min of 10,000 rpm, collect the DNA precipitation; The 75% ethanol rinsing twice gently that adds precooling, centrifugal 5 min of each 10000 rpm; The air-dry precipitation of room temperature, be dissolved in 30 min sterilized waters, standby;

(2) 0.8% agarose gel electrophoresis of genomic dna detects;

(3) specific primer PCR amplification, in the centrifuge tube of pcr amplification special use, add: PCR buffered soln, dNTP, primer sequence is to 5 ' CTGCTTAGGGGTGGCCTGTC3 ' and 5 ' CTGCTTAGGGAGAACCATGGATGTG 3 ', the tamarack genomic dna, the Taq polysaccharase, sterilized water is mended to 25 μ L, the special-purpose thin wall centrifugal tube of the PCR that aforesaid liquid is housed is put into to the pcr amplification instrument, amplification condition is: 94 ℃ of sex change 2 min, after enter and fall formula PCR:94 ℃ of 30 s, 65 ℃ of 1 min, 72 ℃ of 1min10 s, amplification cycles, the circulation number of rings is 10, each circulating temperature reduces by 1 ℃, 94 ℃ of 30 s subsequently, 55 ℃ of 1 min, 72 ℃ of 1min10 s, totally 25 circulations, finally at 72 ℃, extend 5 min, amplification completes,

(4) agarose gel electrophoresis of pcr amplification product detects: the sepharose of configuration 1.5% adds 0.5 μ g/mL ethidium bromide in gel; In 5 μ L amplified productions and in standard positive marker, add respectively 1 μ L 6 * sample-loading buffer, mix, with pipettor, above-mentioned mixed solution is added respectively in the point sample hole of sepharose of submergence TBE electrophoresis liquid, the 120V constant voltage, stop electrophoresis after electrophoresis 15 min, gel are directly being observed under the ultraviolet lamp of ultraviolet wavelength 265nm or on the gel imaging instrument;

(5) interpretation as a result: the migration position of the positive Marker band of secundum legem on gel and the growing state of the migration position judgement tamarack root system ability power of PCR product.

The positively effect that the method for evaluation tamarack branch rootability disclosed by the invention compared with prior art has is:

(1) be not subjected to the restriction of environment and growth factor, be applicable to being in the detection of various growth period tamarack asexual propagation material rootabilities

(2) can to unknown tamarack material rootability, identify in early days on a large scale

(3) working method is simple, and accuracy rate is high, saves largely human and material resources.

The accompanying drawing explanation

Fig. 1 utilizes special primer sequence and the method electrophorogram to the high rootability of known tamarack and low rootability detected result, and M, be standard molecular weight marker, and 1-6 is the individual plant of high rootability, and specific band is 445bp; 7-12 is for the individual plant of low rootability, without the 445bp band;

Fig. 2 utilizes the efficient tamarack rootability PCR detection kit of optimizing, setting up to carry out the electrophorogram of the random detected result in field, and what show the 445bp band is the tamarack plant of high rootability, does not show the tamarack plant for low rootability of band.

Embodiment

For guaranteeing that the above and other objects of the present invention feature and advantage become apparent, below especially exemplified by preferred embodiment, and coordinate Figure of description, in conjunction with specific examples, the present invention is described in further detail.The present invention's all ingredients used all has commercially available.The wherein preparation of test experience material requested and equipment

Wherein 10 * damping fluid, dNTP, Taq polysaccharase are provided by Dalian precious biotechnology company limited; It is synthetic that mixture is that the sequence of designed, designed offers Shanghai biotechnology company limited; Positive reference substance, negative control product are given birth to section's science institute chromosomes chamber by Nankai University and are provided.Equipment PCR instrument (having another name called DNA thermal cycling amplification instrument), electrophoresis equipment (comprising electrophoresis apparatus and electrophoresis chamber), gel imaging instrument ,-20 ℃ of refrigerators, supercentrifuge, micropipet and 0.2ml PCR thin-walled tubes of experiment.

Embodiment 1

Utilize primer sequence: 5 ' CTGCTTAGGGGTGGCCTGTC3 ' and 5 ' CTGCTTAGGGAGAACCATGGATGTG 3 ', to the detection method of the high rootability plant of tamarack and low rootability plant, concrete steps are as follows:

(1) adopt the CTAB method to extract the tamarack genomic dna:

Get young tender Larch Needles 50 mg, grinding powder in liquid nitrogen, move in the 1.5ml centrifuge tube, add 600 μ L CTAB lysates, 56 ℃ of insulation 30 min, add isopyknic phenol, chloroform, after fully mixing, centrifugal, get supernatant and add 600 μ L chloroforms, primary isoamyl alcohol, mix rear centrifugally, get supernatant and add isopyknic Virahol, after-20 ℃ of static 30 min, centrifugal 20 min of 10000g, remove supernatant, precipitate air-dry with 75% ethanol rinsing after, add 100 μ L sterilized water dissolving DNA precipitations, get the content of 5 μ L electrophoresis detection DNA quality and calculating DNA; Add 5 μ L RNase A(RNA enzyme A) (10 mg/mL), 37 ℃ of water bath heat preservations 2 hours, add the equal-volume chloroform, puts upside down gently and mix 2-3 min, centrifugal 10 min of 10,000 rpm; Get supernatant, add 3 mol/L NaAc of 1/10 volume, the dehydrated alcohol that diploid is long-pending ,-20 ℃ of static 30 min; Centrifugal 10 min of 10,000 rpm, collect the DNA precipitation; The 75% ethanol rinsing twice gently that adds precooling, centrifugal 5 min of each 10000 rpm; The air-dry precipitation of room temperature, be dissolved in 30 min sterilized waters, standby;

(2) pcr amplification:

In 0.2 mL PCR centrifuge tube, add: 2.5 μ L PCR buffered soln; 10 μ mol/L primer sequences: 5 ' CTGCTTAGGGGTGGCCTGTC 3 ' 0.5 μ L, 10 μ mol/L primer sequences: 5 ' CTGCTTAGGGAGAACCATGGATGTG 3 ' 0.5 μ L; Tamarack genomic dna 50-100ng; 10mmol/L dNTP 1 μ L; Taq polysaccharase 5 units; Sterilized water is mended to 25 μ L, and the special-purpose thin wall centrifugal tube of the PCR that above-mentioned solution is housed is put into to the pcr amplification instrument, and amplification condition is:

94 ℃ of sex change 2 min, after enter and fall formula PCR:94 ℃ of 30 s, 65 ℃ of 1 min, 72 ℃ of 1min10 s, amplification cycles, the circulation number of rings is 10, each circulating temperature reduces by 1 ℃, subsequently 94 ℃ of 30 s, 55 ℃ of 1 min, 72 ℃ of 1min10 s, totally 25 circulations; Finally at 72 ℃, extend 5 min, amplification completes.

(3) agarose gel electrophoresis of pcr amplification product detects:

The sepharose of configuration 1.5%, add 0.5 μ g/mL ethidium bromide in gel; In 5 μ L amplified productions and in standard positive marker, add respectively 1 μ L 6 * sample-loading buffer, mix, with pipettor, above-mentioned mixed solution is added respectively in the point sample hole of sepharose of submergence TBE electrophoresis liquid, the 120V constant voltage, stop electrophoresis after electrophoresis 15 min, gel are directly being observed under the ultraviolet lamp of ultraviolet wavelength 265nm or on the gel imaging instrument;

(4) position of secundum legem DNA marker band on gel identifies whether tamarack has high rootability.

Fig. 1 is the detection of the tamarack individual plant of known high rootability, and M is molecular weight standard marker, and arrow shows 500bp; 1-6 is the individual plant of high rootability, has the band of 445bp, and 7-12 is the individual plant of low rootability; Fig. 2 is the tamarack individual plant of field random acquisition, every have a 445bp band be the plant of the high rootability of tamarack.

Embodiment 2:

After the cuttage of detection tamarack, the PCR detection kit step of rootability power is as follows:

(1) adopt the CTAB method to extract the tamarack genomic dna: to get young tender Larch Needles 50 mg, grinding powder in liquid nitrogen, move in the 1.5ml centrifuge tube, add 600 μ L CTAB lysates, 56 ℃ of insulation 30 min, add isopyknic phenol, chloroform, after fully mixing, centrifugal, get supernatant and add 600 μ L chloroforms, primary isoamyl alcohol, mix rear centrifugal, get supernatant and add isopyknic Virahol, after-20 ℃ of static 30 min, centrifugal 20 min of 10000g, remove supernatant, precipitate air-dry with 75% ethanol rinsing after, add 100 μ L sterilized water dissolving DNA precipitations, get the content of 5 μ L electrophoresis detection DNA quality and calculating DNA, add 5 μ L RNase A(RNA enzyme A) (10 mg/mL), 37 ℃ of water bath heat preservations 2 hours, add the equal-volume chloroform, puts upside down gently and mix 2-3 min, centrifugal 10 min of 10,000 rpm, get supernatant, add 3 mol/L NaAc of 1/10 volume, the dehydrated alcohol that diploid is long-pending ,-20 ℃ of static 30 min, centrifugal 10 min of 10,000 rpm, collect the DNA precipitation, the 75% ethanol rinsing twice gently that adds precooling, centrifugal 5 min of each 10000 rpm, the air-dry precipitation of room temperature, be dissolved in 30 min sterilized waters, standby, .

(2) pcr amplification: add in 0.2 mL PCR centrifuge tube: the PCR mixture that is mixed with primer, dNTP, Taq polysaccharase, the damping fluid 5.5 μ L that 1 μ L tamarack sample DNA (50-100ng), test kit provide, 18.5 μ L ddH ₂O, put into the pcr amplification instrument by the special-purpose thin wall centrifugal tube of the PCR that above-mentioned solution is housed, and amplification condition is:

94 ℃ of sex change 2 min, after enter and fall formula PCR:94 ℃ of 30 s, 65 ℃ of 1 min, 72 ℃ of 1min10 s, amplification cycles, the circulation number of rings is 10, each circulating temperature reduces by 1 ℃, subsequently 94 ℃ of 30 s, 55 ℃ of 1 min, 72 ℃ of 1min10 s, totally 25 circulations; Finally at 72 ℃, extend 5 min, amplification completes.

(3) agarose gel electrophoresis of pcr amplification product detects:

The sepharose of configuration 1.5%, add 0.5 μ g/mL ethidium bromide in gel; In 5 μ L amplified productions and in standard positive marker, add respectively 1 μ L 6 * sample-loading buffer, mix, with pipettor, above-mentioned mixed solution is added respectively in the point sample hole of sepharose of submergence TBE electrophoresis liquid, the 120V constant voltage, stop electrophoresis after electrophoresis 15 min, gel are directly being observed under the ultraviolet lamp of ultraviolet wavelength 265nm or on the gel imaging instrument;

(4) position of secundum legem DNA marker band on gel identifies whether tamarack has high rootability.

Fig. 2 utilizes the efficient tamarack rootability PCR detection kit of optimizing, setting up to carry out the electrophorogram of the random detected result in field, and what show the 445bp band is the tamarack plant of high rootability, does not show the tamarack plant for low rootability of band.

Conclusion: utilize special primer sequence provided by the present invention, and the PCR detection kit can be simply, the tamarack rootability is identified efficiently, Detection accuracy can reach more than 95%.

SEQUENCE LISTING

<110 > Nankai University

<120 > a kind of method of identifying tamarack branch rootability

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 20

<212> DNA

<213 > artificial sequence

<400> 1

ctgcttaggg gtggcctgtc 20

<210> 2

<211> 25

<212> DNA

<213 > artificial sequence

<400> 2

ctgcttaggg agaaccatgg atgtg 25

Claims (4)

1. the Auele Specific Primer for the identification of tamarack branch rootability, is characterized in that it is comprised of primer sequence SEQ NO.1:5 ' CTGCTTAGGGGTGGCCTGTC 3 ' and SEQ NO.2:5 ' CTGCTTAGGGAGAACCATGGATGTG 3 '.

2. the PCR test kit for the identification of tamarack branch rootability, is characterized in that, this test kit is comprised of PCR primer, dNTP, damping fluid and archaeal dna polymerase, and its composition is as follows:

PCR primer: each 50 μ L (concentration is 10 μ M/L) of SEQ NO.1 and SEQ NO.2;

10 mM dNTP 50μL；

10 * enzyme spcificity reaction buffer, 500 μ L;

5 U/ μ l hot resistant DNA polymerase 200 μ L;

Positive reference substance 15 μ L,

Negative control product 15 μ L;

DdH ₂O 10mL; Archaeal dna polymerase is the Taq polysaccharase.

3. method that adopts test kit claimed in claim 2 to identify tamarack asexual propagation material rootability is characterized in that being undertaken by following step:

(1) extract the tamarack genomic dna;

(2) 0.8% agarose gel electrophoresis of genomic dna detects;

(3) specific primer PCR amplification, in the centrifuge tube of pcr amplification special use, add: PCR buffered soln, dNTP, primer sequence is to 5 ' CTGCTTAGGGGTGGCCTGTC3 ' and 5 ' CTGCTTAGGGAGAACCATGGATGTG 3 ', the tamarack genomic dna, the Taq polysaccharase, sterilized water is mended to 25 μ L, the special-purpose thin wall centrifugal tube of the PCR that aforesaid liquid is housed is put into to the pcr amplification instrument, amplification condition is: 94 ℃ of sex change 2 min, after enter and fall formula PCR:94 ℃ of 30 s, 65 ℃ of 1 min, 72 ℃ of 1min10 s, amplification cycles, the circulation number of rings is 10, each circulating temperature reduces by 1 ℃, 94 ℃ of 30 s subsequently, 55 ℃ of 1 min, 72 ℃ of 1min10 s, totally 25 circulations, finally at 72 ℃, extend 5 min, amplification completes,

(4) agarose gel electrophoresis of pcr amplification product detects: the sepharose of configuration 1.5% adds 0.5 μ g/mL ethidium bromide in gel; In 5 μ L amplified productions and in standard positive marker, add respectively 1 μ L 6 * sample-loading buffer, mix, with pipettor, above-mentioned mixed solution is added respectively in the point sample hole of sepharose of submergence TBE electrophoresis liquid, the 120V constant voltage, stop electrophoresis after electrophoresis 10 min, gel are directly being observed under the ultraviolet lamp of ultraviolet wavelength 265nm or on the gel imaging instrument;

(5) interpretation as a result: the migration position of the positive Marker band of secundum legem on gel and the migration position judgement tamarack root growth situation of PCR product.

4. the application of the described PCR test kit of claim 2 aspect preparation detection tamarack asexual propagation material rootability.

Images