CN103409385B - Method for producing proenzyme of transglutaminase through fermentation - Google Patents
Method for producing proenzyme of transglutaminase through fermentation Download PDFInfo
- Publication number
- CN103409385B CN103409385B CN201310340689.8A CN201310340689A CN103409385B CN 103409385 B CN103409385 B CN 103409385B CN 201310340689 A CN201310340689 A CN 201310340689A CN 103409385 B CN103409385 B CN 103409385B
- Authority
- CN
- China
- Prior art keywords
- transglutaminase
- mutant
- proenzyme
- tag1
- tgase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a method for producing proenzyme of transglutaminase through fermentation; mutation E62D-tag 1 of the proenzyme of the transglutaminase is taken as an original strain, aqua ammonia is used for controlling the pH value to be not less than 7, and in case of dissolved oxygen bounce, feeding is carried out through an index fed-batch manner; glycine and CaC12 are added and constant-speed flow feed liquid supplement is started until induced concentration is reached. After the adoption of the method, the yield of the proenzyme of the transglutaminase is greatly improved.
Description
Technical field
The present invention relates to a kind of method of fermentative production Transglutaminase EC2.3.2.13 proenzyme, belong to fermentation engineering field.
Background technology
Microbial transglutaminase (EC2.3.2.13; Microbial Transglutaminase; EC2.3.2.13 is called for short MTG) can the γ-carboxamide groups of catalytic proteins peptide chain GLN residue and Methionin ε-acyl group or other acyl groups react, form ε-(γ-glutamyl) Methionin covalent linkage.Special catalytic capability makes TGase be widely used in the fields such as food engineering, weaving and leather processing, material engineering, biological medicine.But due to defects such as MTG heterogenous expression secretory volume are low, limit the range of application of MTG.We will transform prior art.
Summary of the invention
The invention provides a kind of method of fermentative production Transglutaminase EC2.3.2.13 proenzyme, technical scheme is as follows: one is not less than 7 with ammoniacal liquor control pH, the start index fed-batch mode feed supplement when dissolved oxygen rebounds; During to induced concentration, add glycine and CaCl
2, and start constant speed flow feeding liquid.
The present invention is with mutant E62D-tag1 fermentative production Transglutaminase EC2.3.2.13 proenzyme.
Described mutant E62D-tag1 construction process is as follows:
1) obtain Streptomyces hygroscopicus CCTCC M203062 by PCR or chemical complete synthesis method, obtain Transglutaminase EC2.3.2.13 gene order and upstream and downstream sequence thereof, sequence is as shown in Genbank:EU477523; 2) Del1-4 Transglutaminase EC2.3.2.13 mutant is obtained by deletion mutantion; 3) with in step 2) on the mutant basis that obtains, by rite-directed mutagenesis, E62 is suddenlyd change, obtain mutant Del1-4/E62D Transglutaminase EC2.3.2.13 mutant; 4) on the mutant basis that step 3) obtains, the Transglutaminase EC2.3.2.13 mutant of tag1 acquisition as shown in SEQ ID NO.1 is merged.
Wherein E62D construction process is as follows;
In early-stage Study, this research department filters out the bacterial strain (Streptomyces hygroscopicus CCTCC M203062) of the new product Transglutaminase EC2.3.2.13 of a strain, by gene clone or chemical total synthesis method, obtain MTG gene order and upstream and downstream sequence thereof, containing promotor and the terminator (Genbank:EU477523) of MTG self, be cloned into expression plasmid pBB1-1011 as the template in the present invention's transformation.
A) with above-mentioned template for material, be upstream primer by SEQ ID NO.3, SEQ ID NO.4 is downstream primer, PCR obtains the gene order of TG mutant, the TG mutant gene of acquisition is connected on expression vector pET-22b (+), be transformed into E.coli JM109 and select positive transformant, mutant plasmid correct for order-checking is transformed expressive host E.coli BL21, obtain mutant Del1-4;
SEQ ID NO.2 is GAGAGGGTGACCCCTCCTGCCGAG
SEQ ID NO.3 is GGGGGCCCGGAAGAGCGCACTG
PCR reaction conditions is: 95 DEG C 5min95 DEG C 5min65 DEG C 30s72 DEG C 1min40s24 circulation, 72 DEG C of 10min
B) Del1-4 gene is template, suddenlys change to E62, and primer is as follows.
SEQ ID NO.4 is
gACaGGGTGACCCCTCCTGCCGAG
SEQ ID NO.5 is
gGGGGCCCGGAAGAGCGCACTG
PCR reaction conditions is: 95 DEG C 5min95 DEG C 5min65 DEG C 30s72 DEG C 7min24 circulation, 72 DEG C of 10min
The TG mutant gene of acquisition is connected on expression vector pET-22b (+), is transformed into E.coli JM109 and selects positive transformant, extract plasmid order-checking.Sequencing reaction is completed by Shanghai Sheng Gong bio-engineering corporation.Mutant plasmid correct for order-checking is transformed expressive host E.coli BL21, obtain mutant Del1-4/E62D.
Because C terminal amino acid has vital role to TGase catalytic activity and thermostability, be therefore chosen at TGase enzyme C and hold to add and stablize small peptide, by increasing it and maturing enzyme N holds or the interphase interaction in other regions, raising protein stability.Add suitable small peptide at PROTEIN C end and can improve protein stability, 7 amino acid are inserted into Del1-4/E62D glutamine transaminage mutant C as stable small peptide and hold, obtaining corresponding mutant enzyme is Del1-4/E62D-tag1.
With mutant plasmid Del1-4/E62D for template, carry out full plasmid PCR.Primer is as follows.
SEQ ID NO.6 is:
ATCGGTTGCATCATCCTGACGCTCGAGCACCACCACCACCACCACTGAG
SEQ ID NO.7 is CGACCAGCCCTGCTTCACCTCG
PCR reaction conditions is: 95 DEG C 5min95 DEG C 5min65 DEG C 30s72 DEG C 7min24 circulation, 72 DEG C of 10min
The TG mutant gene of acquisition is connected on expression vector pET-22b (+), is transformed into E.coli JM109 and selects positive transformant, extract plasmid order-checking.Sequencing reaction is completed by Shanghai Sheng Gong bio-engineering corporation.Mutant plasmid correct for order-checking is transformed expressive host E.coli BL21, obtain mutant.
Above-mentioned batch fermentation conditions is identical with seed culture, inoculation and initial incubation.
Above-mentioned ammoniacal liquor control pH is not less than 7, only controls acid and does not control alkali.
Above-mentioned adjustment rotating speed 400-800r/min is to maintain dissolved oxygen not higher than 30%.
In aforesaid method, induced concentration is OD
600for 25-80.
In the present invention, induced concentration is OD
600during for 50-80, add glycine and CaCl stage by stage
2.
At the dense OD of bacterium
600when being 50, adding final concentration is 75mmol/L glycine and 10mmol/L CaCl
2, as the dense OD of bacterium
600when reaching 80, in fermented liquid, again add final concentration is 75mmol/L glycine and 10mmol/L CaCl
2.
The present invention adopts exponential fed-batch mode to carry out high density fermentation to mutant.
The present invention effectively raises the output of Transglutaminase EC2.3.2.13, for the application of producing GLN transaminase provides conveniently.
Accompanying drawing explanation
Fig. 1 SDS-PAGE analyzes the dense impact on protein excretion of not isogeneous induction bacterium;
(M: protein standard marker; 1 and 2: the dense OD of induction bacterium
60025 full cell and fermentation supernatant; 3 and 4: the dense OD of induction bacterium
60050 full cell and fermentation supernatant; 5 and 6: the dense OD of induction bacterium
60075 full cell and fermentation supernatant).
Fig. 2 induces cell concentration impact of output in outer and born of the same parents on thalli growth, pro-TGase born of the same parents;
((a) thalli growth curve, the outer output of (b) pro-TGase born of the same parents, output in (c) pro-TGase born of the same parents, ●: induction OD
600be 25, zero: induction OD
600be 50,
: induction OD
600be 75).
Fig. 3 portion-wise addition glycine and calcium ion are on the impact of pro-TGase fermenting process;
(
: OD; ●: enzymatic activities; Zero: in born of the same parents, outer total enzyme is lived with born of the same parents).
Embodiment
Substratum
Fermention medium (g/L): glycerine 8; (NH
4)
2hPO
46; KH
2pO
410.5; Citric acid 1.7; MgSO
47H
2o3.4; Trace element 10mL, pH7.0.
Liquid microelement (g/L): FeSO
47H
2o10; ZnSO
47H
2o5.25; CuSO
45H
2o3; MnSO
44H
2o0.5; Na
2b
4o
710H
2o0.23; CaCl
22; (NH
4)
6mo
7o
240.1.
Fed-batch medium (g/L): glycerine 500; Peptone 15; Yeast powder 30; MgSO
47H
2o30.
The calculation formula of stream rate of acceleration F:
X and S is respectively cell and concentration of substrate, g/L; μ is specific growth rate, h
-1; V is fermentating liquid volume, L; S
ffor adding the concentration of substrate, g/L; Y
x/Sfor cell is to the yield coefficients of substrate, g/g; (VX
0) be the initial cell amount of culture system, g; T is that stream adds the time, h; Wherein μ is set as 0.2h
-1.
When carrying out fed-batch fermentation with intestinal bacteria synthesis fermention medium, seed culture, inoculation and initial culture conditions are identical with batch fermentation, are not less than 7 (only control acid does not control alkali) with ammoniacal liquor control pH.When dissolved oxygen rebounds, start index stream adds, and adjusts rotating speed 400-800r/min to maintain dissolved oxygen not higher than 30%, during to induced concentration, adds the glycine of 150mmol/L and the CaCl of 20mmol/L while cooling induction
2, and start constant speed stream and add.
The mensuration of GLN transaminase vigor of the present invention:
Colorimetric method for determining enzyme is lived: with N-α-CBZ-GLN-GLY for substrate specificity, and the single Hydroxylamine HCL of Pidolidone-γ does typical curve.1 unit Transglutaminase EC2.3.2.13 enzyme is lived and is defined as: when 37 DEG C, per minute catalysis forms the enzyme amount (U/mL) of the single Hydroxylamine HCL of 1 μm of ol Pidolidone-γ.
N α-the CBZ-GLN-GLY of reagent A: 100mg is dissolved in the NaOH solution of 2mL0.2moL/L, adds the Tris-HC damping fluid 4mL of 0.2mol/L pH6.0, the reduced glutathion 2mL of 0.1mol/L azanol 2mL, 0.01mol/L, and regulates pH to 6.0.
The HCL of reagent B:3mol/L, 12%TCA, 5%FeCL
3mix by 1:1:1.
Pidolidone-γ-mono-hydroxamic acid standardized solution of preparation 0-4 μm of ol/mL.Get 1mL reagent A to mix with Pidolidone-γ-mono-hydroxamic acid standardized solution of 0.4mL different concns, 37 DEG C of water-baths 10 minutes.Add 0.4mL reagent B termination reaction, in 525nm colorimetric, draw out typical curve.Replace standardized solution with 0.4mL through the enzyme liquid of suitably dilution, insulation and colorimetric under the same conditions, obtain enzyme from typical curve and live.With the supernatant liquor after 100 DEG C of heating, 10 minutes centrifugal for blank.Enzyme activity (u/mL)=(6.8548 × OD
525-0.0164) × extension rate
Optimal reactive temperature detects: in 20mmol/L Tris damping fluid (pH6.0), measure TGase katalaze enzyme vigor between 30 ~ 70 DEG C, the highest enzyme activity is defined as 100%, calculate the enzyme activity of TGase enzyme under condition of different temperatures respectively, determine TGase optimal reactive temperature.
Embodiment 1
For improving pro-TGase output, select exponential fed-batch mode to realize the mutant built in this laboratory early-stage Study process of mutant E62D-tag1() high density fermentation production Transglutaminase EC2.3.2.13 proenzyme pro-TGase.
The calculation formula of stream rate of acceleration F:
X and S is respectively cell and concentration of substrate, g/L; μ is specific growth rate, h
-1; V is fermentating liquid volume, L; S
ffor adding the concentration of substrate, g/L; Y
x/Sfor cell is to the yield coefficients of substrate, g/g; (VX
0) be the initial cell amount of culture system, g; T is that stream adds the time, h; Wherein μ is set as 0.2h
-1.
When carrying out fed-batch fermentation with intestinal bacteria synthesis fermention medium, seed culture, inoculation and initial culture conditions are identical with batch fermentation, are not less than 7 (only control acid does not control alkali) with ammoniacal liquor control pH.When dissolved oxygen rebounds, start index stream adds, and adjusts rotating speed 400-800r/min to maintain dissolved oxygen not higher than 30%, during to induced concentration, adds the glycine of 150mmol/L and the CaCl of 20mmol/L while cooling induction
2, and start constant speed stream and add.
Adopt fermention medium, when thalli growth rebounds to dissolved oxygen, start index stream adds, and thalline is grown fast, when cell concentration arrives induced concentration, changes constant speed stream into and adds to fermentation ends.
Compared with batch fermentation, above-mentioned feeding method makes biomass significantly improve, the dense OD of bacterium
600123.1 are increased to by 23.8.
Embodiment 2
Expression of recombinant proteins can form certain pressure to bacterial metabolism, is not therefore affecting under thalli growth prerequisite, selects suitable induction time to produce enzyme to recombinant bacterium and has material impact.Under high-density culturing condition, induction bacterium is dense general higher, but produces pro-TGase for recombination bacillus coli, and the dense meeting of higher induction bacterium makes pro-TGase protein aggregation in cell, and can not be secreted into outside born of the same parents.Early stage finds pro-TGase fermentation research, the dense OD of induction bacterium
600during more than 20, pro-TGase is gathered in born of the same parents and can not be secreted into outside born of the same parents, and need add final concentration when adding inductor is 150mmol/L glycine and 20mmol/L CaCl
2just can promote pro-TGase by born of the same parents to the secretion outside born of the same parents.Therefore, this section chooses the dense OD of induction bacterium
600being 25,50 and 75, adding glycine and CaCl when adding inductor simultaneously
2, to promote protein excretion.
Different induction time thalli growth difference is also not obvious, the dense OD of induction bacterium
600when being 25, the dense OD of the highest bacterium
600be only 108.2, and as the dense OD of induction bacterium
600when being 50 and 75, the dense OD of the highest bacterium
600be respectively 118.4 and 122.1.But different induction time has material impact to the outer output of pro-TGase born of the same parents, the dense OD of induction bacterium
600be that the highest enzymatic activities of 25,50 and 75 correspondence is respectively 8.2,32.5 and 1.2U/mL.In addition, under different induction time culture condition, in born of the same parents, pro-TGase accumulation volume is also different, and induction time is slower, and intracellular protein accumulation is more, as the dense OD of induction bacterium
600when being 75, in born of the same parents, pro-TGase accumulation is the highest, reaches 6.8U/mL.Choose enzymatic activities vertex sample under different culture condition, utilize SDS-PAGE to analyze pro-TGase distribution, as shown in Figure 1, in born of the same parents and born of the same parents have obvious pro-TGase band outward, wherein induce the dense OD of bacterium
600be 25 and 75 born of the same parents in pro-TGase band comparatively obvious, and induce the dense OD of bacterium
600when being 50, though have pro-TGase to accumulate in born of the same parents, account for total protein ratio lower.Can be found out by the above results, different induction time has material impact to restructuring pro-TGase synthesis and secretion, carry out inducing in thalline exponential growth early stage and later stage and be all unfavorable for recombinant protein synthesis and secretion, and carry out induction at thalline middle exponential growth and can obtain high yield, and most of albumen can be secreted into outside born of the same parents.
Embodiment 3
Although at the dense OD of bacterium
600carry out induction when 50 and can obtain higher pro-TGase output, but in born of the same parents, still have part pro-TGase to accumulate, account for 15.4% of the total enzyme work of pro-TGase.For impelling pro-TGase in born of the same parents to be transported to outside born of the same parents, the interpolation strategy of glycine and calcium ion is optimized.
Glycine and calcium ion concn too high impact meeting thalline normal growth, concentration is too low then less on protein excretion impact, therefore glycine and calcium ion is joined at twice in fermented liquid.At the dense OD of bacterium
600when being 50, interpolation inductor and final concentration are 75mmol/L glycine and 10mmol/L CaCl
2.As the dense OD of bacterium
600when reaching 80, in fermented liquid, again add final concentration is 75mmol/L glycine and 10mmol/L CaCl
2.Under this culture condition, the dense OD of bacterium
600reach as high as 130.7, born of the same parents outward the highest enzyme work can reach 47.4U/mL, and account for that total enzyme lives more than 95%, born of the same parents outward most high production intensity are 1.05U/mL/h.This result shows to add glycine and CaCl stage by stage
2less on thalli growth impact, and to contribute in born of the same parents pro-TGase to the secretion outside born of the same parents.
Claims (1)
1. a method for fermentative production Transglutaminase EC2.3.2.13 proenzyme, is characterized in that, controls fermention medium pH be not less than 7 with ammoniacal liquor, and adjustment rotating speed 400-800r/min is to maintain dissolved oxygen not higher than 30%; The start index fed-batch mode feed supplement when dissolved oxygen rebounds, makes exponential fed-batch specific growth rate be 0.2h
-1; To induced concentration OD
600when being 50, add 150mmol/L glycine and 20mmol/LCaCl
2, and start constant speed flow feeding liquid; Described fermention medium is: glycerine 8g/L, (NH
4)
2hPO
46g/L, KH
2pO
410.5g/L, citric acid 1.7g/L, MgSO
47H
2o 3.4g/L, micro-10mL/L, pH7.0; Described feed supplement liquid: glycerine 500g/L, peptone 15g/L, yeast powder 30g/L, MgSO
47H
2o 30g/L; With Transglutaminase EC2.3.2.13 proenzyme mutant E62D-tag1 for starting strain, described Transglutaminase EC2.3.2.13 proenzyme mutant E62D-tag1 construction process is as follows: 1) according to Streptomyces hygroscopicus CCTCC No.M203062 genomic data, by PCR or chemical complete synthesis method, obtain Transglutaminase EC2.3.2.13 gene order and upstream and downstream sequence thereof, sequence, as shown in Genbank:EU477523, is cloned into expression vector; 2) Del1-4 Transglutaminase EC2.3.2.13 proenzyme mutant is obtained by deletion mutantion; 3) with in step 2) on the mutant basis that obtains, by rite-directed mutagenesis, E62 is suddenlyd change, obtain mutant Del1-4/E62D Transglutaminase EC2.3.2.13 proenzyme mutant; 4) in step 3) on the mutant basis that obtains, merge tag1 and obtain Transglutaminase EC2.3.2.13 proenzyme mutant E62D-tag1 as shown in SEQ ID NO.1, transformation of E. coli obtains the engineering bacteria containing Transglutaminase EC2.3.2.13 proenzyme mutant.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310340689.8A CN103409385B (en) | 2013-08-07 | 2013-08-07 | Method for producing proenzyme of transglutaminase through fermentation |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310340689.8A CN103409385B (en) | 2013-08-07 | 2013-08-07 | Method for producing proenzyme of transglutaminase through fermentation |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103409385A CN103409385A (en) | 2013-11-27 |
| CN103409385B true CN103409385B (en) | 2015-06-03 |
Family
ID=49602427
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310340689.8A Active CN103409385B (en) | 2013-08-07 | 2013-08-07 | Method for producing proenzyme of transglutaminase through fermentation |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103409385B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104830745B (en) * | 2015-04-28 | 2018-06-05 | 江南大学 | A kind of method for producing γ-aminobutyric acid |
| CN107815446B (en) * | 2017-10-16 | 2018-09-28 | 浙江大学 | A kind of fermentation process in high density of recombination nitrile hydratase Recombinant organism |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1493685A (en) * | 2003-09-05 | 2004-05-05 | 江南大学 | Glutamine transaminase high productive bacteria and its screening method and fermentation method producing glutamine transaminase using said bacterial strain |
| CN101698836A (en) * | 2009-11-23 | 2010-04-28 | 江南大学 | Method for supplementing material in the fermentation process of transglutaminase |
| CN102660515A (en) * | 2012-05-10 | 2012-09-12 | 江南大学 | Glutamine transaminase with improved enzymatic activity and thermal stability |
-
2013
- 2013-08-07 CN CN201310340689.8A patent/CN103409385B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1493685A (en) * | 2003-09-05 | 2004-05-05 | 江南大学 | Glutamine transaminase high productive bacteria and its screening method and fermentation method producing glutamine transaminase using said bacterial strain |
| CN101698836A (en) * | 2009-11-23 | 2010-04-28 | 江南大学 | Method for supplementing material in the fermentation process of transglutaminase |
| CN102660515A (en) * | 2012-05-10 | 2012-09-12 | 江南大学 | Glutamine transaminase with improved enzymatic activity and thermal stability |
Non-Patent Citations (2)
| Title |
|---|
| The pro-region of Streptomyces hygroscopicus transglutaminase affects its secretion by Escherichia coli.;Liu S等;《FEMS Microbiol Lett》;20111231;第324卷(第2期);98-105 * |
| 微生物谷氨酰胺转胺酶的表达及分子改造研究进展;刘松等;《生物工程学报》;20111231;第27卷(第12期);1681-1689 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103409385A (en) | 2013-11-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103243042B (en) | There is the coryneform bacteria microorganism belonging to genus of the 1B productive rate of enhancing and use the method for described microorganisms producing 1B | |
| CN107574159A (en) | A kind of mutant for the glutamine transaminage expressed in an active | |
| CN101600796A (en) | Have the coryneform bacteria microorganism belonging to genus of enhanced L-lysine productivity and the method for using described microorganisms producing L-Methionin | |
| CN105658793A (en) | Microorganism with enhanced l-lysine productivity and method for producing l-lysine by using same | |
| CN101831414B (en) | Process for extracellularly producing recombinant alpha-cyclodextrin glucosyltransferase | |
| EP3927809A1 (en) | Industrial fermentation process for bacillus using defined medium and trace element feed | |
| CN107739734A (en) | The glutamine transaminage mutant that a kind of enzyme activity improves | |
| CN105505969A (en) | Method for improving conversion rate of L-threonine and application of method | |
| WO2020169563A1 (en) | Industrial fermentation process for bacillus using defined medium and magnesium feed | |
| CN101531988A (en) | Alkaline pectinase genetic engineering bacteria and construction method thereof | |
| CN103275882B (en) | Gene engineering bacteria highly expressing transglutaminase, and applications thereof | |
| CN103409385B (en) | Method for producing proenzyme of transglutaminase through fermentation | |
| CN111218437A (en) | High-yield alkaline lipase, gene, strain and application | |
| CN105420206A (en) | Glutamine transaminase improving heat stability | |
| CN105316306A (en) | Fermentation method for efficiently producing keratinase through recombinant escherichia coli | |
| JP6938633B2 (en) | Microorganisms that produce 5'-xanthylic acid and methods for producing 5'-xanthylic acid using this | |
| CN103421753B (en) | Transglutaminase mutant with improved enzyme activity and thermal stability and construction method of transglutaminase mutant | |
| CN116144571B (en) | Bacillus pumilus independent of antibiotics and capable of stabilizing high-yield alpha-amylase, and construction method and application thereof | |
| CN113493799B (en) | Aspergillus niger strain for high yield of acid lactase | |
| CN102234668B (en) | Preparation of glutamic acid through three stages of fermentation | |
| CN105505931B (en) | A kind of strong promoter and its application in raising Nattokinase expression | |
| CN111424048A (en) | Gene for expressing acidic β -mannase, vector and application thereof | |
| CN108102934B (en) | Aspergillus niger strain capable of producing pectin lyase at high yield | |
| US7494801B2 (en) | Method of selecting Escherichia coli strain which highly expresses exogenous genes, Escherichia coli mutant strains selected by this method and process for producing enzymes and compounds using the same | |
| CN105950527B (en) | A kind of bacillus subtilis of high efficient expression Fe3+ dependent form food-grade acid urase |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |