CN103405468A - Use of low-molecular weight oligomannuronate in preparation of drug or health care product for preventing or treating Parkinson's disease - Google Patents
Use of low-molecular weight oligomannuronate in preparation of drug or health care product for preventing or treating Parkinson's disease Download PDFInfo
- Publication number
- CN103405468A CN103405468A CN2013103571734A CN201310357173A CN103405468A CN 103405468 A CN103405468 A CN 103405468A CN 2013103571734 A CN2013103571734 A CN 2013103571734A CN 201310357173 A CN201310357173 A CN 201310357173A CN 103405468 A CN103405468 A CN 103405468A
- Authority
- CN
- China
- Prior art keywords
- molecular
- weight
- low
- mannuronic acid
- disease
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention provides a use of low-molecular weight oligomannuronate in preparation of a drug or a health care product for preventing or treating Parkinson's disease. According to the invention, marine acidic polysaccharose as a raw material is prepared into a water-soluble low-molecular weight mannuronic acid compound. An experiment proves that the low-molecular weight mannuronic acid can be used for preventing and treating or improving Parkinson's disease, has obvious pharmacological effects and no toxic or side effects on nerve cells and can be taken for a long time. The low-molecular weight mannuronic acid is a marine natural product, has the advantages of rich resources, easy industrialization, high safety, unique structure and good oral absorption, and has a wide market application prospect in prevention and treatment of Parkinson's disease.
Description
Technical field
The invention belongs to field of medicaments, be specifically related to a kind of low-molecular-weight mannuronic acid oligosaccharide in preparation prevention or the medicine for the treatment of Parkinson's disease or the application in health product.
Background technology
Parkinson's disease (Parkinson ' s disease, PD) be a kind of central nervous system degenerative disease.According to statistics, China's Parkinson's disease patients 1984 was to rise to 1.4% in 0.47%, 2000 year, nearest national statistics are 1,700,000, estimate approximately 100,000 people of annual newly-increased PD patient, and this ratio is higher in rural area, the about 2-3 ‰ of sickness rate, and present obvious ascendant trend.
Parkinson's disease is more common in the old people, about 50% people at 60 years old with sequela, another 50% before 60 years old, the some patients were l that falls ill about 40 years old even.Tremble, extremity are stiff, the dyskinesia is the most common, the most typical symptom of Parkinson's disease.Research shows, Parkinson's disease morbidity after 5 years disability rate reach 30-35%, have investigation to show that the big city such as Beijing and Shanghai approximately has 47.6% Parkinson's disease disease people never to go to the hospital medical, Xi'an is up to 81%, the situation in rural area and west area is even more serious, and that wherein never seeks medical advice accounts for significant proportion.The cause of disease of Parkinson's disease is still unclear regrettably, does not still find the method that delays, stops or prevent Parkinson's disease.Current all Therapeutic Method all can only relief of symptoms, and can not cure diseases.Although the pathomechanism of Parkinson's disease it be unclear that, but no matter be that Parkinson's disease and the Mitochondrial oxidative damage that inherited genetic factors or environmental factors cause all has direct relation, and finally all show as substantia nigra of midbrain dopamine (dopamine, DA) the serotonergic neuron mortality causes the chatter paralysis, has a strong impact on patient's quality of life.Along with the development of molecular biology and biotechnology, dawn has also appearred in the research of Parkinson's disease in recent years, particularly, to the biological research of mitochondrion, has had been found that the relation between Mitochondrial oxidative damage and Parkinson's disease.Mitochondrion is the most important organelle of organism production capacity, is the hinge of energy metabolism.It is the key character that Parkinson's disease occurs that mitochondrial function reduces, and as at the Parkinson's disease patients nigrostriatum, the activity of electron transport chain composite I has obvious decline; Some suppress the medicine of electron transport chain composite I activity, as insecticide 1-methyl 4-phenyl-1,2,3,6-tetrahydropyridine (MPTP) and herbicide rotenone (Rotenone) etc., the activity that can suppress mitochondrial complex I becomes the environment inducement of Parkinson's disease morbidity.Mitochondrion is not only the source of free radical and self the most easily is subjected to radical damage, so the mitochondrial function damage plays a crucial role in the Parkinson's disease pathogenic process.Therefore, the deposition of improving mitochondrial function, elimination body oxidative damage, suppress or delay functional protein is prevention and one of the key method for the treatment of Parkinson's disease and measure.
Algin is a kind of safe food additive, the water soluble compound that it is comprised of mannuronic acid and guluronic acid, molecule contains carboxyl and hydroxy functional group, energy and various albumen, lipid and each metal ion species interact, be a kind of biomolecule with health role, and found that it has multiple biological activity.Besterman finds that in nineteen fifty-seven low Sulfated Algin has obvious effect for reducing blood fat, Otterlei can induce mononuclear cell to produce cytokine profiles in report Algin in 1991, Fujihara has very strong resistance in report Algin in 1992 to various mouse tumor cells, and find that Algin can strengthen phagocytosis and the cytolysis of macrophage, the growth promoting function of Algin also draws attention in medicine and other fields in addition.But because polysaccharide gel is strong, be difficult for being absorbed, in application facet, be very limited, and after it was degraded into to low-molecular-weight, good water solubility, be beneficial to absorption of human body.Low-molecular-weight algal glue is because of the difference of monomer molecule binding site and bond type, Various Functions simultaneously.In recent years, along with the physiological action of low-molecular-weight algal glue is constantly revealed, its activity and medical value exploitation have become new focus.Polymannuronate is construction unit special in the Algin molecule; by orientation degrade and the substep classification it is prepared into to the low-molecular-weight mannuronic acid; good, the easy absorption of this compound water soluble and safe; than under low dosage, having extremely significantly neuroprotective cell mitochondrial damage, suppress the effect of parkinson characteristic α-synuclein proteinosis simultaneously.Although Chinese invention patent (application number 2004100238270 was once arranged, 2005800093965) disclosed the application of low-molecular-weight algal glue in dementia and diabetes that 1 of reducing end contains carboxyl, and the personnel of this seminar (number of patent application CN00111363.1) have disclosed the preparation method of guluronic acid of the single degree of polymerization and the application in antitumor thereof, but at present, about the low-molecular-weight mannuronic acid oligosaccharide, there is not yet report in the application aspect the control Parkinson's disease, compound of the present invention possesses the advantage of the acid oligosaccharide of low-molecular-weight, not only water solublity is strong, easily absorb, and source is abundant, mechanism of action uniqueness, has wide industrialization development application prospect.
Summary of the invention
The purpose of this invention is to provide a kind of low-molecular-weight mannuronic acid oligosaccharide in preparation prevention or the medicine for the treatment of Parkinson's disease or the application in health product, by low-molecular-weight mannuronic acid oligosaccharide of the present invention for the preparation of prevention, treat and improve the medicine of Parkinson's disease, or for preventing and improve the health product of Parkinson's disease, described low-molecular-weight mannuronic acid oligosaccharide toxic and side effects is extremely low, and this product preparation method is simple, easily operation, raw material sources used are abundant.
For achieving the above object, the present invention adopts following technical proposals to be achieved:
The application of a kind of low-molecular-weight mannuronic acid oligosaccharide in preparation prevention or treatment Parkinson's disease medicine or health product.
Further, described low-molecular-weight mannuronic acid oligosaccharide structural formula is as follows:
N=2-20, molecular weight 300-7000Da.
Further, effective use amount of described low-molecular-weight mannuronic acid oligosaccharide is 1～100 μ mol/L.
Further, described low-molecular-weight mannuronic acid can effectively suppress MPP
+The decline of the mitochondrial membrane potential caused.
Further, described low-molecular-weight mannuronic acid can effectively be protected MPP
+The decline of the cell mitochondrial composite I activity caused.
Further, described low-molecular-weight mannuronic acid can effectively be protected MPP
+The reduction of the cell GSH content caused.
Further, described low-molecular-weight mannuronic acid can effectively be protected MPP
+The DNA damage caused.
Further, described low-molecular-weight mannuronic acid can be removed MPP effectively
+The increase of the cytoactive oxygen ROS caused.
Further, described low-molecular-weight mannuronic acid can effectively suppress MPP
+The gathering of the increase that the α induced-core synapsin is expressed, the external α of upper mediation that α-core synapsin mRNA transcribes-core synapsin.
Further, the composite formation compound of described low-molecular-weight mannuronic acid oligosaccharide and thioctic acid, levodopa, carbidopa or bromocriptine.
Compared with prior art, advantage of the present invention and good effect are: the present invention's application low-molecular-weight mannuronic acid oligosaccharide, by it at Parkinson's disease disease model-MPP
+The SK-N-MC neurocyte intervention study of damage, observe the protective effect of low-molecular-weight mannuronic acid oligosaccharide for the neurocyte mitochondrial injury, and suppress cell inner expression and the external deposition of α-core synapsin; Proved that by experiment low-molecular-weight mannuronic acid oligosaccharide neuroprotective cell avoids the characteristic of the mitochondrial function composite I that MPP causes and descend; the decline of mitochondrial membrane potential; the overexpression of α-core synapsin, and the destruction of DNA oxidative damage and Cellular Oxidation reduction balance.And confirmed further that by external model the low-molecular-weight mannuronic acid oligosaccharide suppresses the effect of α-core synapsin deposition.Therefore the low-molecular-weight mannuronic acid oligosaccharide can be applied to prepare prevention, treat or improve the medicine of Parkinson's disease well.
The present invention be take the ocean acidic polysaccharose with beta configuration and is raw material, has obtained water-soluble low-molecular mannuronic acid compound, and first passage of the present invention experimental results show that the low-molecular-weight mannuronic acid in control or the application in improving Parkinson's disease; The pharmacological action of low-molecular-weight mannuronic acid is very obvious, and through evidence to neurocyte without any toxic and side effects, be suitable for long-term taking; And low molecule mannuronic acid of the present invention derives from marine natural products, have aboundresources, be easy to industrialization, safe, the advantage that structure is unique, oral absorption is good, have wide market application foreground aspect preventing and treating at Parkinson's disease.
After reading the specific embodiment of the present invention by reference to the accompanying drawings, it is clearer that the other features and advantages of the invention will become.
The accompanying drawing explanation
Fig. 1 is the shows fluorescent microscopy images of the unicellular DNA damage experiment of SK-N-MC in the present invention.
The specific embodiment
Below in conjunction with the drawings and specific embodiments, technical scheme of the present invention is described in further detail.
Embodiment 1
The invention provides a kind of purposes of low-molecular-weight mannuronic acid oligosaccharide, for the preparation of the preparation that prevents, treats or improve Parkinson's disease, or health product.The present invention proves the neuroprotective cell mitochondrial damage effectively of low-molecular-weight mannuronic acid by experiment first; significantly suppress expression and the deposition of Parkinson's disease α-synuclein characteristic protein, therefore can be used for prevention, treat or improve Parkinson's disease.
The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: lab guide (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Unless otherwise defined, the same meaning that all specialties of using in literary composition and scientific words and one skilled in the art are familiar with.In addition, any method similar or impartial to described content and material all can be applicable in the present invention.The use that better implementation method described in literary composition and material only present a demonstration.
One, material
1, reagent and consumptive material
Cell culture medium MEM, Sodium Pyruvate is bought from Invitrogen company; Hyclone is bought from Hyclone company; Penicillin, streptomycin, Antimycin A, NaN3, CoQ1, ATP, Triton X-100 buy the company in Sigma; NaHCO3, EDTA, DMSO, dehydrated alcohol, tween 80 buy the Solution on Chemical Reagents in Shanghai company in Chinese Medicine group; Low melting-point agarose, Tris, Hepes are bought the company in Amresco; Jc-1, DCF-DA buy the company in Molecular Probe; DCPIP buys the company in Merk; BCA protein quantification test kit (purchased from PIERCE company); Anti-α-synuclein monoclonal antibody (purchased from Calbiochem company); The oxidisability protein detection kit is bought the company in Chemicon; Protein lysate is bought in green skies biotechnology research institute; Glutathion GSH detection kit, buy and in Nanjing, build up biotechnology research institute.
2, mannuronic acid oligosaccharide preparation
Low-molecular-weight mannuronic acid in the present invention can pass through classification and degraded from the Algin that extraction Thallus Laminariae (Thallus Eckloniae), Macrocystis pyrifera (L.) Ag., Fucus Vesiculosus, yellow tang, Thallus Laminariae (Thallus Eckloniae) or Chorda filum (L.) Stackh. obtains and obtain.
According to existing patent (ZL01107952.5) technology, adopt the oxidizing acid edman degradation Edman from Algin, separating preparation low-molecular-weight mannuronic acid, between the saccharide residue of described low-molecular-weight mannuronic acid by β-1, the 4-D-mannuronic acid forms, and its weight average molecular weight is distributed in 300-7000 dalton.
Two, experimental technique
1. cell culture
The present invention adopts MPP to induce the neural fibroblast of SK-N-MC to set up the Parkinson's disease disease model.This model has the clinicopathologic feature of similar Parkinson's disease: the activity of mitochondrial complex I obviously reduces, the abnormal gathering of α-core synapsin albumen, mitochondria dysfunction.
The SK-N-MC neuronal cell cultures, in the MEM of Earle's buffer culture medium, adds 15% calf serum in culture medium, 5mM glucose, 2mM glutamic acid, 1mM Sodium Pyruvate, non essential amino acid, the penicillin of 50U/ml and streptomycin.
2. blue (MTT) method of tetramethyl azo azoles detects cytoactive
The SK-N-MC neurocyte is arranged respectively to blank group, 500 μ M MPP
+Model group and variable concentrations LM+MPP
+Test group, in described test group, LM concentration is respectively 1.0umol/L, 10umol/L, 50umol/L, 100umol/L, culture medium was all used above-mentioned variable concentrations low-molecular-weight mannuronic acid (LM) protection 96 hours, afterwards with containing MPP
+Serum-free medium processed 24 hours.Cell culture is processed in 96 orifice plates after, add the 5mg/ml MTT of 50 μ l, be placed in the cell culture incubator incubation after 3 hours, discard MTT, add 200 μ l DMSO dissolve purple products, read the 550nm light absorption value in microplate reader (Molecular Device, Spectra Max340).Detect blank group, 500 μ M MPP
+Model group and the index of test group after processing, result is as shown in table 1.
Table 1 low-molecular-weight mannuronic acid (LM) is induced the impact of SK-N-MC cell survival rate on MPP+
Adopt blue (MTT) method of tetramethyl azo azoles to detect the quantized result of cytoactive; * p<0.05, compare with matched group; #p<0.05, compare with model group, is used for statistical test more than the experimental results of three times.Table 1 shows that the low-molecular-weight mannuronic acid can prevent MPP
+Induce the decline of SK-N-MC cells survival rate.
3. mitochondrial membrane potential analysis (MMP)
With JC-1, measure mitochondrial membrane potential (Tirosh et al, 2000), JC-1 is a kind of pair of utilizing emitted light, the molecular probe of electromotive force sensitivity, when mitochondria potential is very low or low concentration monomer transmitting green light (529nm) when existing, high concentration is own polymerization red-emitting (590nm).Two kinds of compositions are all very responsive to electromotive force, and the ratio of HONGGUANG and green glow can provide the analysis of mitochondrion electromotive force.Cell was hatched 15 minutes with the JC-1 of 10uM/ml.After hatching, use the PBS washed twice, detect by dual wavelength/bis-light microplate reader.
Table 2 low-molecular-weight mannuronic acid is to MPP
+Induce the impact of SK-N-MC mitochondrial membrane potential in anoxic
Experimental result is as shown in table 2, the quantized result that table 2 detects for mitochondrial membrane potential; * p<0.05, compare with matched group; #p<0.05, compare with model group, is used for statistical test more than the experimental results of three times.Table 2 shows that the low-molecular-weight mannuronic acid can effectively suppress MPP
+The decline of the mitochondrial membrane potential caused.
4. mitochondrial complex I activity analysis
The SK-N-MC cell method separate mitochondria (Humphries and Szweda, 1998) of differential centrifugation.The cell PBS washed twice of pre-cooling, with Extraction buffer re-suspended cell (0.25M sucrose, 5mM Tris-HCl buffer, pH7.5, and 1mM EDTA pH8.0) and grind with the glass grinding device, do not have broken cell to use centrifugal 15 minutes of 600g, centrifugal 25 minutes of suspension 10000g, the mitochondrion precipitation is with extracting the medium washing once, the active kinetics of mitochondrial complex I, by measuring DCPIP, reduce mensuration (Smith, 1967) at the absorption light value of 600nm.
Table 3 low-molecular-weight mannuronic acid is induced the impact of SK-N-MC cell mitochondrial composite I activity on MPP+
The SK-N-MC cell is used LM pretreatment 96 hours, then processes 24 hours with 500 μ M MPP+.Experimental result is as shown in table 3, and result means with average ± SD, and * p<0.05, compare with matched group; #p<0.05, compare with model group, is used for statistical test more than the experimental results of three times.Table 3 shows that the low-molecular-weight mannuronic acid can effectively suppress MPP
+The decline of the cell mitochondrial composite I activity caused.
5.GSH horizontal detection
Cell is grown on 6 orifice plates, make cell breakage with the NACL solution of 0.4ml0.9%, and the cell pellet uniform particles distributes.Low temperature 3000g; Centrifugal 10 minutes, collect supernatant.According to glutathion GSH detection kit description, carry out the GSH assay, the principle of this test kit is that dithio dinitrobenzoic acid and sulfhydryl compound reaction produce a kind of yellow compound, thereby carries out colorimetric determination.
Table 4LM is to MPP
+Induce the impact of SK-N-MC cell GSH level
The SK-N-MC cell is used LM pretreatment 96 hours, then, after with 500 μ M MPP+, processing 24 hours, carries out the detection of reduced glutathion content, and the cell that does not add medicine, MPP+ of take is blank.* p<0.05, compare with matched group; #p<0.05, compare with model group, is used for statistical test more than the experimental results of three times.Experimental result is as shown in table 4, and table 4 shows that the low-molecular-weight mannuronic acid can effectively protect the reduction of the cell GSH content that MPP+ causes.
6.DNA oxidative damage
Use the comet electrophoretic analysis.This conventional method was verified (Olive etal, 1990,2005 by forefathers; Tice et al, 2000).Insulin with 0.25% and the culture fluid of dilution are processed cell are scattered.0.6% the low melting-point agarose of the cell of 10ul (1x104) and 90ul, 37 degrees centigrade of mixing, is coated with rapidly the agarose of the normal melting point of one deck 1% on microscope slide.Microscope slide is immersed to 100ml mixed solution (2.5MNaCl, 100mM EDTA, 10mM Tris, pH10), add the DMSO of 10mlTriton X-100 and 10ml.Then insert (PH is greater than 13 for 300Mm NaOH, 1Mm EDTA) low temperature in electrophoretic buffer and placed 20 minutes, make DNA loose before electrophoresis.Electrophoresis, at 4 degrees centigrade of 0.73V/cm, ran 20 minutes under the 28mA condition.Microscope slide immerses 0.4M Tris, and pH7.5, by the 2ug/ml DAPI rear covered of fading, in the fluorescence microscopy Microscopic observation, under ultraviolet excitation, whether observation of cell core hangover occurs in electrophoresis, number goes out the percentage ratio of band hangover cell in total cell, as the index of DNA damage.
Table 5LM is to MPP
+Induce the impact of SK-N-MC cell DNA oxidative damage
The SK-N-MC cell is respectively by blank group (Control), 500 μ M MPP+(model group, Model) and after LM+MPP+ processes, carry out unicellular electrophoresis test, Fig. 1 is shown in by the photo of fluorescence microscopy Microscopic observation, the cell that visible MPP+ processes has hangover mostly, and LM+500 μ M MPP
+Cell and matched group after processing are similar, rare conditions of streaking.The hangover cell that result adopts microscopic examination to come out accounts for the ratio of total cell; In table 5, * p<0.05, compare with matched group; #p<0.05, compare with model group, is used for statistical test more than the experimental results of three times.Fig. 1 is the fluorescence microscope situation of unicellular electrophoresis experiment.Fig. 1 and table 5 show the DNA damage that the low-molecular-weight mannuronic acid can effectively protect MPP+ to cause.
7. active oxygen detects
Cell covers with in 24 orifice plates.Siphon away culture fluid, in each hole, add 500ul0.25M sucrose, 20mM MOPS, the 0.05mg/ml digitonin, adjust pH to 7.4, and room temperature was placed 3 minutes.Again with containing 0.25M sucrose, 20mMMOPS, the digitonin buffer of 20mM EDTA, adjust pH to 7.4, and room temperature was placed 5 minutes, rear drying.Add again and contain 0.25M sucrose, 20mM MOPS, 20mM EDTA, the 5mM inorganic phosphate, 1mM ADP, 5mM glutamic acid, the breathing buffer of 1mM L MALIC ACID, adjust pH to 7.4 and add 10uM carboxyl H2DCFDA under the condition of 37 degrees centigrade, to measure mitochondrial ROS30 minute.Replace buffer, wash with PBS, cell is moved on to the Eppendorf pipe, and carry out flow cytometry analysis.
Table 6LM is to MPP
+Induce the impact of SK-N-MC cytoactive oxygen level
The SK-N-MC cell is with LM pretreatment 96 hours, then after with 500 μ M MPP+, processing 24 hours, adds the content of flow cytometer detection ROS after the fluorescent probe labelling.The cell that does not add medicine, MPP+ of take is blank.* p<0.05, compare with matched group; #p<0.05, compare with model group, is used for statistical test more than the experimental results of three times.Table 6 shows that the low-molecular-weight mannuronic acid can remove the increase of the cytoactive oxygen ROS that MPP+ causes effectively.
8.Western blotting detects
Collecting cell, extracting protein matter, make on the experiential basis that Western blotting detects and revise forefathers, concise and to the point step is as follows: the dissolved buffer (50mMTris-HCl of cell, 250mM NaCl, 5mM EDTA, 50mM NaF, 1%NP40,2ug/ml aprotinin, 2ug/mlleupeptin, 1mM phenylmethylsulfonyl fluoride, 700U/ml DNase I, the above reagent of 1%beta-mercaptoethanol is all purchased from Sigma company).By the quantitative soluble protein of BCA protein quantification test kit, the Coomassie brilliant blue leveling detects insoluble protein.Equal protein matter adds after the 15%SDS-PAGE electrophoresis transferring film to nitrocellulose filter, with 5%BSA add TBS-T (20mM Tris, 500mM NaCl, 0.1% both mix 20) room temperature shakes and fixes 2 hours.When film soaks in a-synuclein antibody (1:2000), 4 degrees centigrade of overnight incubation.Afterwards with TBST washing six times, each 5 minutes.Add and two anti-(1:4000 sheep anti-mouse antibody, the horseradish peroxidase of phase coupling), room temperature 1-2 hour.Fluorography makes light reaching the film.
9. the setting of reverse transcription primer and reverse transcriptional PCR is quantitative
The cDNA chain is synthetic with reverse transcription XL (purchased from Takara, Shiga, Japan company) by the total RNA of 1ug and a small amount of dNTP.The positive primer sequence of β-actin is tcaccatggatgatgatatcgcc (SEQ ID No:1); The anti-primer sequence of β-actin is ccacacgcagctcattgtagaagg (SEQ ID No:2); α-positive primer of core synapsin is aggactttcaaaggccaagg (SEQ ID No:3); α-core synapsin anti-primer is tcctccaacatttgtcacttgc (SEQ ID No:4).With the repeatedly circulation of RT-PCR instrument, increase the purpose that reaches quantitative (Bio-Rad, Hercules, CA).The amount of these two kinds of PCR products is quantitative in this stepping line trace of the last annealing of each circulation by the fluorescence reception device of IQTM SYBER.Reaction completes in containing the positive and negative system of 25ul because of thing of 200nmol.Data are expressed as: 2
-Δ Ct, Δ Ct=Ct – Ct18S.
Table 7LM induces SK-N-MC cell α-core synapsin to express and do not have the impact of rna expression on MPP+
Western blot method detects, and cartogram is the photodensitometry more than three experiments, and the fluorescence quantitative PCR detection mitochondrion generates signaling molecule, and statistical table is more than three interpretations, and * * p<0.05, compare with matched group; #p<0.05, compare with model group.Table 7 shows that the low-molecular-weight mannuronic acid can effectively suppress MPP
+The rise that the increase that the α induced-core synapsin is expressed and mRNA transcribe.
10. the detection of α-core synapsin aggregation in vitro phenomenon
The LM of recombinant alpha-core synapsin and variable concentrations is 37 degrees centigrade of common hatching 48 hours, and the α deposited-core synapsin occurs can, with after in fluorescent dye ThT dark, hatching 15 minutes, detect (Ex440nm, Em480nm) in multi-functional microplate reader.
The impact of table 8LM on α-core synapsin aggregation in vitro
The α assembled-core synapsin amount, occur to characterize in multi-functional microplate reader fluorescence intensity, and statistical table is more than three interpretations, and * * p<0.05, compare with matched group; #p<0.05, compare with model group.Table 8 means that the low-molecular-weight mannuronic acid can effectively suppress the gathering of external α-core synapsin.
Above-mentioned all numerical value means with mean ± standard error, carries out t check or variance analysis (ANOVA), when P<0.05, thinks, between processed group and matched group, significant difference is arranged, and p<0.01 is considered to have extremely dominant difference.
Above embodiment is only in order to technical scheme of the present invention to be described, but not is limited; Although with reference to previous embodiment, the present invention is had been described in detail, for the person of ordinary skill of the art, still can modify to the technical scheme that previous embodiment is put down in writing, or part technical characterictic wherein is equal to replacement; And these modifications or replacement do not make the essence of appropriate technical solution break away from the spirit and scope of the present invention's technical scheme required for protection.
Claims (10)
1. the application of low-molecular-weight mannuronic acid oligosaccharide in preparation prevention or treatment Parkinson's disease medicine or health product.
2. the application of a kind of low-molecular-weight mannuronic acid oligosaccharide according to claim 1 in preparation prevention or treatment Parkinson's disease medicine or health product, it is characterized in that: described low-molecular-weight mannuronic acid oligosaccharide structural formula is as follows:
N=2-20, molecular weight 300-7000Da.
3. the application of a kind of low-molecular-weight mannuronic acid oligosaccharide according to claim 1 and 2 in preparation prevention or treatment Parkinson's disease medicine or health product, it is characterized in that: effective use amount of described low-molecular-weight mannuronic acid oligosaccharide is 1～100 μ mol/L.
4. the application of a kind of low-molecular-weight mannuronic acid oligosaccharide according to claim 1 and 2 in preparation prevention or treatment Parkinson's disease medicine or health product, it is characterized in that: described low-molecular-weight mannuronic acid can effectively suppress MPP
+The decline of the mitochondrial membrane potential caused.
5. the application of a kind of low-molecular-weight mannuronic acid oligosaccharide according to claim 1 and 2 in preparation prevention or treatment Parkinson's disease medicine or health product, it is characterized in that: described low-molecular-weight mannuronic acid can effectively be protected MPP
+The decline of the cell mitochondrial composite I activity caused.
6. the application of a kind of low-molecular-weight mannuronic acid oligosaccharide according to claim 1 and 2 in preparation prevention or treatment Parkinson's disease medicine or health product, it is characterized in that: described low-molecular-weight mannuronic acid can effectively be protected MPP
+The reduction of the cell GSH content caused.
7. the application of a kind of low-molecular-weight mannuronic acid oligosaccharide according to claim 1 and 2 in preparation prevention or treatment Parkinson's disease medicine or health product, it is characterized in that: described low-molecular-weight mannuronic acid can effectively be protected MPP
+The DNA damage caused.
8. the application of a kind of low-molecular-weight mannuronic acid oligosaccharide according to claim 1 and 2 in preparation prevention or treatment Parkinson's disease medicine or health product, it is characterized in that: described low-molecular-weight mannuronic acid can be removed MPP effectively
+The increase of the cytoactive oxygen ROS caused.
9. the application of a kind of low-molecular-weight mannuronic acid oligosaccharide according to claim 1 and 2 in preparation prevention or treatment Parkinson's disease medicine or health product, it is characterized in that: described low-molecular-weight mannuronic acid can effectively suppress MPP
+The gathering of the increase that the α induced-core synapsin is expressed, the external α of upper mediation that α-core synapsin mRNA transcribes-core synapsin.
10. the application of a kind of low-molecular-weight mannuronic acid oligosaccharide according to claim 1 and 2 in preparation prevention or treatment Parkinson's disease medicine or health product, is characterized in that: the composite formation compound of described low-molecular-weight mannuronic acid oligosaccharide and thioctic acid, levodopa, carbidopa or bromocriptine.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310357173.4A CN103405468B (en) | 2013-08-16 | 2013-08-16 | The application of a kind of low-molecular-weight mannuronic acid oligosaccharide in the medicine preparing prevention or treatment Parkinson's disease or health product |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310357173.4A CN103405468B (en) | 2013-08-16 | 2013-08-16 | The application of a kind of low-molecular-weight mannuronic acid oligosaccharide in the medicine preparing prevention or treatment Parkinson's disease or health product |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103405468A true CN103405468A (en) | 2013-11-27 |
| CN103405468B CN103405468B (en) | 2015-08-19 |
Family
ID=49598542
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310357173.4A Active CN103405468B (en) | 2013-08-16 | 2013-08-16 | The application of a kind of low-molecular-weight mannuronic acid oligosaccharide in the medicine preparing prevention or treatment Parkinson's disease or health product |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103405468B (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103800348A (en) * | 2014-03-13 | 2014-05-21 | 中国科学院海洋研究所 | Application of mannose glucuronic acid oligosaccharide in preparation of medicine and/or healthcare product for treating or preventing Parkinson's disease and/or senile dementia |
| CN106008613A (en) * | 2015-03-27 | 2016-10-12 | 全南大学校产学协力团 | Non-reducing-end Unsaturated Mannuronic Acid Oligosaccharides and Composition comprising the same as Active Ingredient |
| CN106349298A (en) * | 2015-07-17 | 2017-01-25 | 上海绿谷制药有限公司 | Application of sodium alginate oligose and derivative to improvement of sleep disorders |
| CN106344592A (en) * | 2015-07-17 | 2017-01-25 | 上海绿谷制药有限公司 | Application of mannuronic acid oligose with carboxyl at 1-position of reducing end and derivative to treatment of Parkinson's disease |
| WO2020001640A1 (en) * | 2018-06-29 | 2020-01-02 | 上海绿谷制药有限公司 | Application of composition of d-mannuronic diacid in treatment of parkinson's disease |
| CN110882264A (en) * | 2019-11-13 | 2020-03-17 | 青岛海洋生物医药研究院股份有限公司 | Pharmaceutical composition of gastrodin and mannuronic acid oligosaccharide and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1408360A (en) * | 2001-10-01 | 2003-04-09 | 青岛海洋大学 | Use of algin oligosaccharide in anti-senility and anti-dementia |
| CN102488697A (en) * | 2011-12-09 | 2012-06-13 | 中国海洋大学 | Application of oligomeric mannuronic acid to preparation of medicine for resisting influenza A virus subtype H1N1 |
| CN102920729A (en) * | 2012-11-06 | 2013-02-13 | 中国海洋大学 | Oligomerization mannuronic acid and application of medicinal salts of oligomerization mannuronic acid in leucopenia prevention medicines |
-
2013
- 2013-08-16 CN CN201310357173.4A patent/CN103405468B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1408360A (en) * | 2001-10-01 | 2003-04-09 | 青岛海洋大学 | Use of algin oligosaccharide in anti-senility and anti-dementia |
| CN102488697A (en) * | 2011-12-09 | 2012-06-13 | 中国海洋大学 | Application of oligomeric mannuronic acid to preparation of medicine for resisting influenza A virus subtype H1N1 |
| CN102920729A (en) * | 2012-11-06 | 2013-02-13 | 中国海洋大学 | Oligomerization mannuronic acid and application of medicinal salts of oligomerization mannuronic acid in leucopenia prevention medicines |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103800348A (en) * | 2014-03-13 | 2014-05-21 | 中国科学院海洋研究所 | Application of mannose glucuronic acid oligosaccharide in preparation of medicine and/or healthcare product for treating or preventing Parkinson's disease and/or senile dementia |
| CN103800348B (en) * | 2014-03-13 | 2015-07-01 | 中国科学院海洋研究所 | Application of mannose glucuronic acid oligosaccharide in preparation of medicine and/or healthcare product for treating or preventing Parkinson's disease and/or senile dementia |
| CN106008613A (en) * | 2015-03-27 | 2016-10-12 | 全南大学校产学协力团 | Non-reducing-end Unsaturated Mannuronic Acid Oligosaccharides and Composition comprising the same as Active Ingredient |
| US10272100B2 (en) | 2015-03-27 | 2019-04-30 | Industry Foundation Of Chonnam National University | Non-reducing end unsaturated mannuronic acid oligosaccharides and compositions containing same as active ingredient |
| CN106008613B (en) * | 2015-03-27 | 2019-11-05 | 全南大学校产学协力团 | The unsaturated type mannuronic acid oligosaccharide of non reducing end and the composition comprising it as effective component |
| CN106349298A (en) * | 2015-07-17 | 2017-01-25 | 上海绿谷制药有限公司 | Application of sodium alginate oligose and derivative to improvement of sleep disorders |
| CN106344592A (en) * | 2015-07-17 | 2017-01-25 | 上海绿谷制药有限公司 | Application of mannuronic acid oligose with carboxyl at 1-position of reducing end and derivative to treatment of Parkinson's disease |
| WO2020001640A1 (en) * | 2018-06-29 | 2020-01-02 | 上海绿谷制药有限公司 | Application of composition of d-mannuronic diacid in treatment of parkinson's disease |
| CN110652516A (en) * | 2018-06-29 | 2020-01-07 | 上海绿谷制药有限公司 | Use of compositions of mannuronic acid for the treatment of parkinson's disease |
| US11406654B2 (en) | 2018-06-29 | 2022-08-09 | Green Valley (Shanghai) Pharmaceuticals Co., Ltd. | Use of mannuronic diacid composition in treatment of Parkinson's disease |
| CN110882264A (en) * | 2019-11-13 | 2020-03-17 | 青岛海洋生物医药研究院股份有限公司 | Pharmaceutical composition of gastrodin and mannuronic acid oligosaccharide and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103405468B (en) | 2015-08-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103405468B (en) | The application of a kind of low-molecular-weight mannuronic acid oligosaccharide in the medicine preparing prevention or treatment Parkinson's disease or health product | |
| Choi et al. | Hypoxia promotes noncanonical autophagy in nucleus pulposus cells independent of MTOR and HIF1A signaling | |
| McKay et al. | Mechanisms of collagen crosslinking in diabetes and keratoconus | |
| Jiang et al. | Resveratrol plays a protective role against premature ovarian failure and prompts female germline stem cell survival | |
| Zuo et al. | Icariin alleviates IL-1β-induced matrix degradation by activating the Nrf2/ARE pathway in human chondrocytes | |
| Radhouani et al. | Biological performance of a promising Kefiran-biopolymer with potential in regenerative medicine applications: A comparative study with hyaluronic acid | |
| Wang et al. | Antihyperuricemic and anti-gouty arthritis activities of Aurantii fructus immaturus carbonisata-derived carbon dots | |
| Gao et al. | Anti‐Inflammatory and Antioxidant Effect of Eucommia ulmoides Polysaccharide in Hepatic Ischemia‐Reperfusion Injury by Regulating ROS and the TLR‐4‐NF‐κB Pathway | |
| Böttger et al. | Horizontal gene transfer contributed to the evolution of extracellular surface structures: the freshwater polyp Hydra is covered by a complex fibrous cuticle containing glycosaminoglycans and proteins of the PPOD and SWT (sweet tooth) families | |
| Wang et al. | Excessive zinc chloride induces murine photoreceptor cell death via reactive oxygen species and mitochondrial signaling pathway | |
| Zhou et al. | 2, 4‐dichlorophenoxyacetic acid induces ROS activation in NLRP3 inflammatory body‐induced autophagy disorder in microglia and the protective effect of Lycium barbarum polysaccharide | |
| Mencucci et al. | GlicoPro, novel standardized and sterile snail mucus extract for multi-modulative ocular formulations: new perspective in dry eye disease management | |
| Han et al. | Limitations of the use of MTT assay for screening in drug discovery | |
| Olfati et al. | Riboflavin recovery of spermatogenic dysfunction via a dual inhibition of oxidative changes and regulation of the PINK1-mediated pathway in arsenic-injured rat model | |
| Ye et al. | Uridine relieves MSCs and chondrocyte senescence in vitvo and exhibits the potential to treat osteoarthritis in vivo | |
| Bao et al. | Sulfated galactofucan from Sargassum thunbergii induces senescence in human lung cancer A549 cells | |
| Xie et al. | Inhibition of NF-κB activation improves insulin resistance of L6 cells | |
| Zhang et al. | Knockdown of GCN2 inhibits high glucose‐induced oxidative stress and apoptosis in retinal pigment epithelial cells | |
| Shi et al. | Human umbilical cord mesenchymal stem cells protect against renal ischemia-reperfusion injury by secreting extracellular vesicles loaded with miR-148b-3p that target pyruvate dehydrogenase kinase 4 to inhibit endoplasmic reticulum stress at the reperfusion stages | |
| Mumtaz et al. | Antioxidant and anti-aging role of silk sericin in D-galactose induced mice model | |
| Tan et al. | Proanthocyanidins prevent high glucose-induced eye malformation by restoring Pax6 expression in chick embryo | |
| CN101870974A (en) | Preparation method of proteinase activated receptors agonist and use thereof | |
| Kaya et al. | A study of the effects of metformin, a biguanide derivative, on annulus fibrosus and nucleus pulposus cells | |
| Kokot et al. | Application of Principal Component Analysis for evaluation of chemical and antimicrobial properties of honey bee (Apis mellifera) venom | |
| Niu et al. | The in vivo roles of galectin-2 from Nile tilapia (Oreochromis niloticus) in immune response against bacterial infection |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C53 | Correction of patent of invention or patent application | ||
| CB03 | Change of inventor or designer information |
Inventor after: Hao Jiejie Inventor after: Yu Guangli Inventor after: Guan Huashi Inventor before: Yu Guangli Inventor before: Hao Jiejie Inventor before: Guan Huashi |
|
| COR | Change of bibliographic data |
Free format text: CORRECT: INVENTOR; FROM: YU GUANGLI HAO JIEJIE GUAN HUASHI TO: HAO JIEJIE YU GUANGLI GUAN HUASHI |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |