CN103394331A - Hepatitis c virus adsorbent as well as preparation method and application thereof - Google Patents

Abstract

The invention discloses a hepatitis c virus adsorbent as well as a preparation method and an application thereof, and belongs to the field of medical and biological materials. The hepatitis c virus adsorbent comprises a carrier and a single strand desoxyribonucleic acid ligand combined with a hepatitis c virus envelope protein and connected to the carrier. The sequence of the ligand is as shown in SEQINNO.2. The hepatitis c virus adsorbent is obtained by obtaining a sensitive carrier surface through a chemical activating reaction and performing covalent linkage of the carrier surface with the artificially synthesized single strand desoxyribonucleic acid. The adsorbent is simple and convenient in synthetic method, short in process line and safe to prepare. The covalent bond is firm to connect and the ligand is stable to combine. The product has the characteristics of strong specificity, high absorption efficiency to hepatitis c virus particles, good regenerability and no toxicity and heat source reaction, and can be used for absorptive treatment of clinically and specifically eliminating hepatitis c virus particles in plasma and can be used for preparing anti-hepatitis c virus medicines.

Description

A kind of HCV adsorbent and preparation method thereof and application

Technical field

The invention belongs to medical technical field of biological material, be specifically related to a kind of HCV adsorbent and preparation method thereof and application.

Background technology

Hepatitis C causes by hepatitis C virus (HCV), and distributed pole is wide, easily develops into chronic hepatitis, cirrhosis and liver cancer.Except the only a few acute hepatitis C can be cured, in a single day most patients caught an illness all the life in spite of illness.There is no at present fully effective therapeutic scheme, clinically also without vaccine; Uniquely generally acknowledge that effective treatment means only have interferon, and must be in the early implementation of infecting, otherwise without obvious effect.

Virus in blood is the virulence factor of hepatitis C.Although early stage exploration has been arranged, but still undetermined be how special, effectively from blood, removing these viruses, and don't cause the infringement to body.Affine adsorbing therapy is a kind of important method of blood purification, its principle is a certain or several aglucons to be fixed on to stablize on apyrogenic carrier be built into affinity adsorption column, by the mode of extracorporal circulatory system, remove the virulence factor in blood samples of patients, purify the blood, break immunologic balance, improve microenvironment in body, immune system is had the advantage, thus the enforcement of auxiliary other treatment means.The current blood purification therapy of applying clinically can be by removing specifically the autoantibody of body, and treatment autoimmune disease, organ transplant rejection also have report by adsorbing low-density lipoprotein treatment hypercholesterolemia etc.Yet the hepatitis C virus in the aptamer adsorbed plasma that the aglucon phyletic evolution technology of utilization index enrichment (Systematic Evolution of Ligands by Exponential Enrichment, SELEX) screens yet there are no report.

Common aptamer molecule comprises single stranded DNA and single stranded RNA, is the ribonucleic acid that a class has the special space structure, and these structures are given their abilities with the target molecule efficient physical engages, and the two forms special " lock-key " closely structure.Technique is originated in the research of exploring early stage form of life, now has been widely used in all many-sides such as targeted drug, efficient fast detecting.Singlestranded RNA by random synthesis and target molecule take turns more in conjunction with and flushing, filter out the RNA sequence with the tool joint efficiency of target molecule.The current synthetic method that multiple maturation occurred, be easy to it is carried out to suitability for industrialized production, such as: microballoon paramagnetic particle method, asymmetric PCR etc.Recent practice shows, the captured targets molecule that this quasi-molecule can be efficient, quick, special, and the virus of removing in blood for specificity provides effective instrument.

Summary of the invention

Primary and foremost purpose of the present invention be to provide a kind of nontoxic, harmless, without immunogenicity, the third HCV adsorbent that Glisson's capsule protein adsorption efficiency is high and security performance is good, it can specificity removes hepatitis C virus particle in blood plasma.

Another object of the present invention is to provide the preparation method of above-mentioned HCV adsorbent.

A further object of the present invention is to provide the application of above-mentioned HCV adsorbent.

Purpose of the present invention is achieved through the following technical solutions:

A kind of HCV adsorbent, comprise carrier and be connected to the aglucon of the single stranded deoxyribonucleic acid in conjunction with hepatitis C virus envelope protein on carrier; Described connection is preferably by the mode of chemical coupling and fixes; It has following structure:

Wherein:

Represent carrier, Linker representative activation coupling arm group, anti-HCVaptamer represents the single stranded deoxyribonucleic acid aglucon of specific binding hepatitis C virus envelope protein.

Described carrier is preferably the material microballoon that glass, agarose, shitosan etc. have smooth surface and activated group, and microsphere diameter should be between 45 μ m to 165 μ m.Glass is a kind of safe material that often is used to fixed dna, and manufacture craft is ripe and simple, and quality controllable property processed is strong, easily obtains the glass microsphere of size homogeneous; Its smooth surface, blood compatibility is good, in Related product, as supporting carrier, uses.In addition, agarose, shitosan and pottery etc. have the material of smooth surface and activated group, all can be as supporting carrier.

the described aglucon of single stranded deoxyribonucleic acid in conjunction with hepatitis C virus envelope protein is preferably that (this sequence is open source literature Chen F in the aptamer sequence in conjunction with hepatitis C virus, Hu Y, Li D, Chen H, Zhang X-L (2009) CS-SELEX Generates High-Affinity ssDNA Aptamers as Molecular Probes for Hepatitis C Virus Envelope Glycoprotein E2.PLoS ONE4 (12): 5 ' and 3 ' the end nucleotide sequence that the single-strand DNA aptamer of efficient joint capacity is arranged hepatitis C virus envelope protein E 2 in e8142) adds respectively the nucleotide chain that length is the support arm of 10～25nt.Support the effect of arm that 2 points are arranged: 1) as the extension of aptamer self sequence and microballoon, needed sterically hindered when the protection aptamer is folding; 2) in the time of can as original position PCR, synthesizing simultaneously, be fixed on the primer sequence on ball, simplify the production technology of aptamer ball.

Wherein, as follows in conjunction with the aptamer sequence (SEQ ID NO.1) of hepatitis C virus:

5 '-CGCCCTAGGATACTGCGTAACTGGGAGTCGCTTCCTCGATCTAATAAGGAGTAAG CCGAGCCTGACAAGGGATATCACTCAGCATAATCTTAAGGCG-3 '; Wherein comprise 27 of adenines (A), 21 of thymidines (T), 24 of cytimidines (C), 25 of guanines (G), 5 ' end will form loop-stem structure with 3 ' end; After adding the support arm, make loop-stem structure freely to stretch at microsphere surface.

Preferably, the sequence of the described aglucon of single stranded deoxyribonucleic acid in conjunction with hepatitis C virus envelope protein (SEQ ID NO.2) is as follows:

5’-gggatccccgCGCCCTAGGATACTGCGTAACTGGGAGTCGCTTCCTCGATCTAATAAG GAGTAAGCCGAGCCTGACAAGGGATATCACTCAGCATAATCTTAAGGCGaacgcgtctg-3’；

This single stranded deoxyribonucleic acid aglucon has kept the space conformation that HCV is had to the physical engagement ability, makes it in perfusing course, can fully freely stretch its special space conformation.

The preparation method of above-mentioned HCV adsorbent, comprise the steps: synthetic single stranded deoxyribonucleic acid aglucon in conjunction with hepatitis C virus envelope protein, and this aglucon is connected on carrier and obtains the HCV adsorbent.

Because the aglucon sequence is longer, synthetic cost is higher in a large number, for cost-saving, can also be take synthetic aglucon as template, by original position PCR or asymmetric PCR, the single stranded deoxyribonucleic acid aglucon is increased in a large number, further obtain the HCV adsorbent, specifically comprise the steps:

Original position PCR:(1) the design amplification is in conjunction with primer A and the primer B of the single stranded deoxyribonucleic acid aglucon of hepatitis C virus envelope protein; (2) aglucon 5 ' end primer is connected on carrier, take synthetic aglucon as template, carries out original position PCR reaction, obtain the HCV adsorbent.

Asymmetric PCR: (1) design amplification is in conjunction with primer A and the primer B of the single stranded deoxyribonucleic acid aglucon of hepatitis C virus envelope protein; (2) take aglucon as template, carry out PCR reaction and make single stranded DNA be converted into two strands, take this double-stranded DNA as template, maybe this double-stranded DNA is inserted on cloning vector take this carrier as template, carry out the asymmetric PCR reaction, obtain aglucon; (3) aglucon is connected on carrier and obtains the HCV adsorbent.

When the sequence of the described aglucon of single stranded deoxyribonucleic acid in conjunction with hepatitis C virus envelope protein was 5 '-gggatccccgCGCCCTAGGATACTGCGTAACTGGGAGTCGCTTCCTCGATCTAATA AGGAG TAAGCCGAGCCTGACAAGGGATATCACTCAGCATAATCTTAAGGCGaacgcgtctg-3 ', primer A was preferably: 5 '-gggatccccgCGCCCTA-3 '; Primer B is preferably: 5 '-cagacgcgttCGCCTTA-3 '.

Describedly aglucon or primer are connected on carrier to the method that is preferably by chemical crosslinking realize, crosslinking agent is preferably dichromic acid pyridine (Pyridinium dichromate, PDC), one end of crosslinking agent occurs covalently bound by the functional group effect in oligonucleotides, the other end is connected with the carrier that surface chemical reaction occurs.

The application of above-mentioned HCV adsorbent in preparing anti hepatitis C virus drug.

A kind of anti hepatitis C virus drug, comprise above-mentioned HCV adsorbent.

The present invention has following advantage and effect with respect to prior art:

(1) the single stranded deoxyribonucleic acid aglucon, for extremely short and small oligomerization single stranded DNA is difficult for causing the immunogenicity reaction, has greatly reduced the immunological rejection risk.

(2) a large amount of enrichment single stranded deoxyribonucleic acid aglucons that develop into of multiple synthesizing single-stranded DNA technique provide good technology platform, for example, and original position PCR method, asymmetric PCR method, microballoon paramagnetic particle method etc.

(3) for protein operation, DNA is synthetic that flow process is short, cost is low, purity is high, quality controllability is strong, the excellent multinomial advantage of specificity.

(4) the present invention is in conjunction with the single stranded deoxyribonucleic acid aglucon of hepatitis C virus envelope protein, kept the space conformation that HCV is had to the physical engagement ability, in perfusing course, can fully freely stretch its special space conformation, easily with envelope protein, engage, benefit the efficiency that promotes blood perfusion.

(5) the present invention transforms disclosed aptamer sequence, make its effective binding site obtain protection, and utilize blood compatibility good, nontoxic, apyrogenic carrier microballoons is supported with fixing it, the preparation method is easy, the safe technology route is short, covalent bond is connected firmly, and aglucon is in conjunction with stable; HCV adsorbent gained regenerability is good, nonhazardous, without heat source response,, high specificity high to the adsorption efficiency of HCV.Can obtain large-scale production and popularization, have great more practical value.

The accompanying drawing explanation

Fig. 1 is static isothermal curve match adsorbent dissociation constant and adsorbent maximal absorptive capacity figure as a result.

Fig. 2 utilizes adsorbent continuous adsorption HCV E2 figure as a result, and wherein the number of times of adsorbent is changed in the abscissa representative, and ordinate represents percolation concentration ng/mL and adsorption efficiency.

The specific embodiment

The present invention is described in further detail below in conjunction with embodiment, but embodiments of the present invention are not limited to this.

The standby HCV adsorbent of embodiment 1 original position PCR legal system

(1) synthetic single stranded deoxyribonucleic acid aglucon in conjunction with hepatitis C virus envelope protein, sequence is as follows: 5 '-gggatccccgCGCCCTAGGATACTGCGTAACTGGGAGTCGCTTCCTCGATCTAATA AGGAG TAAGCCGAGCCTGACAAGGGATATCACTCAGCATAATCTTAAGGCGaacgcgtctg-3 '.

(2) the design amplification is in conjunction with the primer of the single stranded deoxyribonucleic acid aglucon of hepatitis C virus envelope protein, primer A:5 '-gggatccccgCGCCCTA-3 ', primer B:5 '-cagacgcgttCGCCTTA-3 '.

(3) entrust General Electric company by the method for chemical crosslinking, primer A to be connected on high flow rate agarose microbeads 6FF, take aglucon as template, supporting carrier is as an end primer, primer B carries out original position PCR reaction as the offside primer, and the primer A that makes to be fixed on carrier increases as the described sequence of step (1).

System composition and the regular-PCR of original position PCR reaction are basically identical, but need add bovine serum albumin(BSA) (BSA) to prevent TagDNA polymerase and the random coupling reaction of agarose microbeads generation under hot environment, reduce the efficiency of enzyme.In addition, because the mispairing meeting in the aptamer sequence directly affects its binding ability for target, so need to adopt the high-fidelity enzyme to guarantee the high consistency of product sequence.

PCR reaction system (solid volume is not listed consideration in): TaKaRa Ex Taq(5U/ μ L) 1 μ L, 10 * Ex Taq Buffer5 μ L, each 2.5mM of dNTP Mixture() 8 μ L, template DNA 1 μ L, primer A(25 μ M) 2 μ L, primer B(0.25 μ M) 2 μ L, ddH ₂O31 μ L.PCR response procedures: 94 ℃ of 6min; 94 ℃ of 60s, 62 ℃ of 180s, 32 circulations; 72 ℃ of 20min.In order to guarantee that reaction system exceeds loss at Thermal Cycling, apply limpid mineral oil the EP duct occlusion is got up.

(4) remove seal, reaction system is placed on 325 order nylon leaching nets, with 10 times of volume distilled waters, rinse and obtain the HCV adsorbent.

The standby HCV adsorbent of embodiment 2 asymmetric PCR legal systems

(1) and (2) with embodiment 1;

(3) the single stranded deoxyribonucleic acid aglucon that reacts in connection with hepatitis C virus envelope protein by PCR is converted into double-stranded DNA, double-stranded DNA is inserted into to cloning vector pUC19 upper to preserve; Take cloning vector or double-stranded DNA, as template, carry out the asymmetric PCR reaction, obtain the target single stranded DNA; The asymmetric PCR reaction condition is as follows: wherein the content of primer A is more than 100 times of primer B; PCR reaction system: TaKaRa Ex Taq(5U/ μ L) 0.5 μ L, 10 * Ex Taq Buffer5 μ L, each 2.5mM of dNTP Mixture() 4 μ L, template DNA 1 μ L, primer A(25 μ mol/L) 2 μ L, primer B(0.25 μ mol/L) 2 μ L, ddH ₂O35.5 μ L.PCR response procedures: 94 ℃ of 3min; 94 ℃ of 30s, 62 ℃ of 90s, 32 circulations; 72 ℃ of 20min, obtain single stranded DNA.

(4) method by chemical crosslinking after the single stranded DNA purifying is connected on the upper glass microballoon; The method of described chemical crosslinking is as follows:

1) glass microsphere surface preparation: boil and washed average diameter 85 μ m glass microsphere 10 minutes with 65% red fuming nitric acid (RFNA), then, with distillation washing (deionization washing 3 times, distillation washing 2 times, each 2 minutes), put into 37 ℃ of oven for drying;

2) APTES activation: get distilled water, acetone (analyzing pure), (γ aminopropyltriethoxy silane (APTES) ratio of 15:280:6 by volume is mixed with the APTES activated solution to the silanization coupling agent, then glass microsphere is immersed to 2 hours; With acetone washing slide 5 times (5min/ time), then microsphere surface is dried;

3) the dichromic acid pyridine is crosslinked: microballoon is put into to 0.2wt%PDC(dichromic acid pyridine) solution, be placed in baking oven 2 hours (37 ℃ of holding temperatures); From PDC, taking out microballoon, first use methanol wash 5 times (5min/ time), then, with acetone washing 2 times, finally with the distilled water washing once, dry;

4) the single stranded deoxyribonucleic acid aglucon is fixing: in 100 ℃ of heating 5min, ice bath is 90 seconds rapidly, with microballoon, mixes subsequently take microsphere volume (mL) by the single stranded deoxyribonucleic acid aglucon: single stranded DNA mass ratio (mg) is the ratio mixing of 1:20; On 42 ℃ of constant water bath box with sealer NTP solution (each 2.5mM) sealing 30 minutes, more lower PBS(0.01M pH8.0 is swung in microseism on 42 ℃ of water baths of constant temperature) wash 3 times, then room temperature dry, standby.

The maximal absorptive capacity measuring and calculating of embodiment 3 HCV adsorbents to HCAg E2

(1) mensuration of hepatitis C E2 concentration standard curve

Accurately take 25mg HCV E2 standard items, with the 0.01M PBS buffer preparation of pH=7.4, become the HCV E2 original solution 25mL of 1.0mg/mL.With PBS be diluted to successively 0.2,0.3,0.4,0.5,0.6,0.7,0.8,0.9, l.0mg/mL each 4mL of HCV E2 solution.Take PBS as blank, detect the absorbance at each solution 280nm place.Take mass concentration as abscissa, absorbance is ordinate drawing standard curve, and the pass that obtains both by linear fit is y=2.31x; R ²=0.9973.

(2) hepatitis C E2 Static Adsorption

Use PBS(0.01M pH7.4) the HCV E2 solution of buffer solution preparation certain mass concentration gradient, mass concentration is respectively 0.5,0.81,1.0,1.5,1.87,2.0,4.62,5.78mg/mL, respectively measures 10mL HCV E2 solution and adds in conical flask.Taking respectively 0.2g(, to amount to volume be 0.5mL) adsorbent of embodiment 1 preparation, add in conical flask, more than 25 ℃ of concussion 1.5h; Then change adsorption column over to, with a large amount of PBS, rinse and drain.The citric acid wash-out that adds about 8mL pH=2.5, collect eluent.Wash-out crosses and adds a small amount of Tris-base neutralization, at 280nm, detects absorbance.According to the method described above, parallel laboratory test is 3 times.HCV E2 mass concentration when adsorption band and adsorption equilibrium is calculated according to following formula. and get the empirical average value 3 times.

$q=\frac{A_{280}{\mathrm{<figure-callout\; id="2"\; label="V"\; filenames="130725115301.png"\; state="\{\{state\}\}">V</figure-callout>}}_2}{2.31V}$ （1），

$\mathrm{\&rho;}={\mathrm{\&rho;}}_0-\frac{A_{280}{\mathrm{<figure-callout\; id="2"\; label="V"\; filenames="130725115301.png"\; state="\{\{state\}\}">V</figure-callout>}}_2}{{2.31V}_1}$ （2）；

Wherein, q is adsorbance, mg/mL; HCV E2 mass concentration when ρ is adsorption equilibrium, mg/mL; ρ ₀For the HCV E2 mass concentration before percolation, mg/mL; A ₂₈₀For the absorbance of eluent at wavelength 280nm place; V ₁For the volume of HCV E2 solution, mL; V ₂For after percolation, collecting the volume of eluent, mL; V is the volume of sorbing material, mL.

(3) static isothermal curve Fitting Analysis

Adsorbance (q) and balance mass concentration (ρ) while by the static isothermal adsorption test of HCV E2, drawing a series of balance.Wherein the adsorbance during balance and the relation of balance mass concentration with the Langmuir isothermal adsorpting equation are:

$\frac{\mathrm{\&rho;}}{q}=\frac{\mathrm{\&rho;}}{q_{\max }}+\frac{k_d}{q_{\max }}$ （3）

In formula, q _maxFor the maximal absorptive capacity of filler, mg/mL; k _dFor dissociation constant, mg/mL.

With formula (3), carry out linear fit, by intercept and slope, calculate q _max=9.1mg/mL, k _d=0.25mg/mL, R at this moment ²=0.99, linear dependence good (as shown in Figure 1).After fixing, 1mL HCV affinity adsorbent is 9.1mg/mL to the maximal absorptive capacity of HCAg E2 fragment.

The continuous adsorption experiment of embodiment 4 HCV adsorbents

The adsorbent that 5mL embodiment 2 is obtained injects the 500mL conical flask, adds the PBS(0.01M pH7.4 of 100mL HCV E2 antigen) solution.In constant-temperature table, react, 37 ℃ vibrated 90 minutes, utilized respectively Elisa kit (purchased from river, Shanghai Lay bio tech ltd) to detect the concentration of HCV E2, got ratio and determined adsorption efficiency, and result is as shown in table 1.

Under table 1 shaking table condition adsorption efficiency

The adsorbent that 5mL embodiment 2 is obtained injects on the filter membrane of chromatographic column, uses soft pipe connection.PBS(0.01M pH7.4 by 100mL HCV E2 antigen) solution injects chromatographic column, with clean triangular flask, reclaims the HCV E2 antigenic solution of percolation.The solution of percolation implanted layer is again analysed to post, repeat " absorption-wash-out-absorption " reaction 50 bouts; Measure as stated above the adsorption efficiency of adsorbent to HCV E2, result is as shown in table 2 again.

Under table 2 perfusion condition adsorption efficiency

The adsorbent that 5mL embodiment 2 is obtained injects on the filter membrane of chromatographic column, uses soft pipe connection.Use PBS(0.01M pH7.4) HCV E2 antigen initial concentration is formulated as to 1000ng/mL, add up to 100mL accepted filtered absorption post.100mL HCV E2 antigenic solution is injected to chromatographic column, with clean triangular flask, reclaim percolation solution.The solution of percolation implanted layer is again analysed to post, repeat " absorption-wash-out-absorption " reaction 50 bouts, utilize respectively ultraviolet method to detect the concentration of every bout HCV E2, get ratio and determine adsorption efficiency; Then, every percolation 50 bouts are just changed adsorbent 1 time, until change adsorbent 8 times, simulate one time clinical treatment, and result as shown in Figure 2.Show reach absorption saturated before, the contact of repeatedly percolation is conducive to promote adsorption efficiency; After this sorbing material continuous adsorption, a large amount of HCV E2 albumen that exists can be reduced to the degree that can't check originally.

Embodiment 5 mouse safety experiments

By each 15mL of adsorbent in embodiment 1 and 2, wherein the bonded amount of aptamer is 300mg, puts into beaker and soaks 90 minutes with physiological saline, refills in two 80mL adsorption columns, with physiological saline, fully rinses pillar.Take the animal mouse as subjects, by after mouse anesthesia, from the femoral artery of mouse, with the speed of 30mL/min, pump blood, through blood separator, haemocyte and blood plasma are separated, speed with 20mL/min pours into blood plasma in adsorption column, after perfusion, with haemocyte, mixes the femoral vein that together injects mouse again.In 24 hours in experimentation and after experiment, all physical signs of animal used as test mouse are normal.Experimental result shows, the HCV adsorbent under two kinds of technique all can not cause the allergic reaction of animal.

Above-described embodiment is preferably embodiment of the present invention; but embodiments of the present invention are not restricted to the described embodiments; other any do not deviate from change, the modification done under Spirit Essence of the present invention and principle, substitutes, combination, simplify; all should be the substitute mode of equivalence, within being included in protection scope of the present invention.

SEQUENCE LISTING

<110 > Wuhan University

<120 > a kind of HCV adsorbent and preparation method thereof and application

<130> 1

<160> 4

<170> PatentIn version 3.5

<210> 1

<211> 97

<212> DNA

<213> Artificial Sequence

<220>

<223 > in conjunction with the aptamer of hepatitis C virus

<400> 1

cgccctagga tactgcgtaa ctgggagtcg cttcctcgat ctaataagga gtaagccgag 60

cctgacaagg gatatcactc agcataatct taaggcg 97

<210> 2

<211> 117

<212> DNA

<213> Artificial Sequence

<220>

<223 > in conjunction with the single stranded deoxyribonucleic acid aglucon of hepatitis C virus envelope protein

<400> 2

gggatccccg cgccctagga tactgcgtaa ctgggagtcg cttcctcgat ctaataagga 60

gtaagccgag cctgacaagg gatatcactc agcataatct taaggcgaac gcgtctg 117

<210> 3

<211> 17

<212> DNA

<213> Artificial Sequence

<220>

<223 > primer A

<400> 3

gggatccccg cgcccta 17

<210> 4

<211> 17

<212> DNA

<213> Artificial Sequence

<220>

<223 > primer B

<400> 4

cagacgcgtt cgcctta 17

Claims (10)

1. HCV adsorbent is characterized in that: comprise carrier and be connected on carrier in conjunction with hepatitis C virus

The single stranded deoxyribonucleic acid aglucon of poison envelope protein.

2. described HCV adsorbent according to claim 1, it is characterized in that: described carrier is glass, agar

Sugar or shitosan.

3. described HCV adsorbent according to claim 1, is characterized in that: described in conjunction with HCV

The single stranded deoxyribonucleic acid aglucon of envelope protein adds respectively for 5 ' and 3 ' end in the sequence shown in SEQ ID NO.1 the nucleotide chain that length is the support arm of 10 ~ 25nt.

4. described HCV adsorbent according to claim 3, is characterized in that: described in conjunction with HCV

The sequence of the single stranded deoxyribonucleic acid aglucon of envelope protein is as shown in SEQ ID NO.2.

5. the preparation method of the described HCV adsorbent of claim 1-4 any one, is characterized in that comprising following step

Suddenly: synthetic single stranded deoxyribonucleic acid aglucon in conjunction with hepatitis C virus envelope protein is connected to this aglucon on carrier and obtains

The HCV adsorbent;

Or (1) design amplification is in conjunction with primer A and the primer B of the single stranded deoxyribonucleic acid aglucon of hepatitis C virus envelope protein;

(2) aglucon 5 ' end primer is connected on carrier, take synthetic aglucon as template, carries out original position PCR reaction, obtain the HCV adsorbent; Or (1) design amplification is in conjunction with primer A and the primer B of the single stranded deoxyribonucleic acid aglucon of hepatitis C virus envelope protein;

(2) take aglucon as template, carry out PCR reaction and make single stranded DNA be converted into two strands, take this double-stranded DNA as template, maybe this double-stranded DNA is inserted on cloning vector take this carrier as template, carry out the asymmetric PCR reaction, obtain aglucon; (3) aglucon is connected on carrier and obtains the HCV adsorbent.

6. the preparation method of described HCV adsorbent according to claim 5 is characterized in that: when in conjunction with the third type liver

The sequence of the single stranded deoxyribonucleic acid aglucon of scorching virus envelope protein is as shown in SEQ ID NO.2 the time, and primer A is 5 '-gggatccccgCGCCCTA-3 ', and primer B is 5 '-cagacgcgttCGCCTTA-3 '.

7. the preparation method of described HCV adsorbent according to claim 5, is characterized in that: described by aglucon

Or primer is connected on carrier as the realization of the method by chemical crosslinking.

8. the preparation method of described HCV adsorbent according to claim 7, it is characterized in that: described chemistry is handed over

The crosslinking agent that uses in connection is the dichromic acid pyridine.

The described HCV adsorbent of claim 1 to 4 any one in preparing anti hepatitis C virus drug should

With.

10. an anti hepatitis C virus drug, is characterized in that: comprise described the third type liver of claim 1 to 4 any one

Scorching viruses adsorption agent.

Images