CN103374583A - Flavanone-6-hydroxylase (SbF6H) gene in scutellaria baicalensis georgi as well as product coded by same and application of gene - Google Patents
Flavanone-6-hydroxylase (SbF6H) gene in scutellaria baicalensis georgi as well as product coded by same and application of gene Download PDFInfo
- Publication number
- CN103374583A CN103374583A CN2012101130732A CN201210113073A CN103374583A CN 103374583 A CN103374583 A CN 103374583A CN 2012101130732 A CN2012101130732 A CN 2012101130732A CN 201210113073 A CN201210113073 A CN 201210113073A CN 103374583 A CN103374583 A CN 103374583A
- Authority
- CN
- China
- Prior art keywords
- gene
- sbf6h
- flavanone
- hydroxylase
- root
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses a flavanone-6-hydroxylase (SbF6H) gene in scutellaria baicalensis georgi as well as a protease coded by the same and application of the gene. The gene is cloned from scutellaria baicalensis georgi by constructing a full-length cDNA (complementary deoxyribonucleic acid) library for the first time and fills in the gap in separating and cloning the flavanone-6-hydroxylase (SbF6H) gene from the traditional Chinese herbal medicine scutellaria baicalensis georgi in China. The flavanone-6-hydroxylase (SbF6H) gene has nucleotide sequences shown in SEQ ID NO.1 or homologous sequences obtained through addition, substitution, insertion or deletion of one or a plurality of nucleotides or nucleotide sequences derived from alleles of the gene and the gene. A protein coded by the gene has amino acid sequences shown in SEQ ID NO.2 or homologous sequences obtained through addition, substitution, insertion or deletion of one or a plurality of amino acids. The flavanone-6-hydroxylase (SbF6H) gene provided by the invention can increase the content of baicalein in scutellaria baicalensis georgi through biotechnology, is conductive to improvement of the quality of the medicinal scutellaria baicalensis georgi, simultaneously can carry out variety breeding and has good application prospects.
Description
Technical field
The invention belongs to biological technical field, relate generally to and utilize cDNA library clone root of large-flowered skullcap flavanone-6-'-hydroxylase gene and coded product and application, relating in particular to biosynthesizing has flavones fermentoid gene and coded product and the application of pharmacological component, belongs to the Gene Engineering of Medicinal Plants field.
Background technology
The formation of active components in medicinal plant (secondary metabolite) is the product of peculiar gene group in the Secondary Metabolism of Plant approach.Along with plant functional genomics research extensively with deeply, show unique characteristics and have the research of the synthetic correlation function gene of medicinal plant secondary metabolism of broad prospect of application to become gradually the focus of research, these gene clonings will be provided fundamental basis for the formation that biosynthetic pathway and the regulatory mechanism thereof of parsing active components in medicinal plant are conciliate release material quality, bring wide application space for utilizing biotechnology to improve target component content or direct production effective constituent or intermediate simultaneously.
Flavonoid compound is one of secondary metabolite important in the plant, and a lot of activeconstituentss such as scutellarin, luteolin etc. are flavonoid compound in medicinal plant.Medicinal plant root of large-flowered skullcap Scutellaria baicalensis Georgi is conventional Chinese medicine simply, has heat-clearing and damp-drying drug, and cool blood is antiabortive, and the effect of detoxicating functions is the main component of numerous compounds, healthcare products.The main active ingredient of the root of large-flowered skullcap comprises baicalin, scutellarin, wogonoside, wogonin etc., and wherein scutellarin is formed by flavanone-6-hydroxylase (SbF6H) catalysis.
Therefore flavanone-6-hydroxylase (SbF6H) gene cloning and analysis is for the content that improves root of large-flowered skullcap efficient part with genetic engineering means provides important foundation.Before the present invention comes forth, any disclose or reported skullcapflavone fermentoid gene and aminoacid sequence thereof mentioned in the present patent application are arranged not yet.
Summary of the invention
The object of the present invention is to provide a kind of root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) gene.
Second purpose of the present invention provides the protein of this genes encoding.
The present invention also provides recombinant vectors and the host cell that contains this gene.
Another object of the present invention is to provide the application of this gene.
Root of large-flowered skullcap flavanone provided by the present invention-6-hydroxylase (SbF6H) is one of following nucleotide sequence:
(1) has the nucleotide sequence shown in the SEQ ID NO.1;
(2) nucleotide sequence that add, replace, insert or delete the homologous sequence of one or more Nucleotide or its allelotrope and derive of the nucleotide sequence shown in the SEQ ID NO.1.
The protein of this coded by said gene is root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H), is one of following aminoacid sequence:
(1) has the aminoacid sequence shown in the SEQ ID NO.2;
(2) SEQ ID NO.2 add, replace, insert or delete one or more amino acid whose homologous sequences.
The recombinant vectors that contains root of large-flowered skullcap flavanone of the present invention-6-hydroxylase (SbF6H) gene complete sequence or partial sequence, such as protokaryon class carrier, eucaryon class expression vector and RNAi carrier all belong to protection scope of the present invention.
Contain the host cell of root of large-flowered skullcap flavanone of the present invention-6-hydroxylase (SbF6H) gene complete sequence or partial sequence, as the host cell that contains above-mentioned recombinant vectors also belongs to protection scope of the present invention.
Described host cell is valuable living materials.
The application of root of large-flowered skullcap flavanone of the present invention-6-hydroxylase (SbF6H) gene comprises and uses described recombinant vectors, such as the plant expression vector transformed plant cells; Perhaps cultivate altogether with described Agrobacterium and the vegetable cell that contains this gene, obtain genetically modified plant rooting system; Perhaps use described root of hair cell regeneration plant; Perhaps use described root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) gene complete sequence or partial sequence to transform and obtain transgenic organism.
The concept particular content that relates in the technical solution of the present invention is as follows:
The dna molecular of said root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) gene comprises: coding has the nucleotide sequence of the polypeptide of root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) gene activity, and shows at least 70% homology from the nucleotides sequence of Nucleotide 1-1191 position among described nucleotide sequence and the SEQ ID NO.1; Perhaps described nucleotide sequence can be under 40-55 ℃ of condition with SEQ ID NO.1 in from the nucleotide sequence hybridization of Nucleotide 1-1191.Described sequence encoding has the polypeptide of the aminoacid sequence shown in the SEQ ID NO.2.The isolated root of large-flowered skullcap flavanone of the present invention-6-hydroxylase (SbF6H) gene polypeptide comprises: have polypeptide or its conservative property variation polypeptide or its active fragments of SEQ ID NO.2 aminoacid sequence, or its reactive derivative.Dna molecular among the present invention comprises 8-100 continuous nucleotide in the described dna molecular.In the present invention, " separation ", " purifying " DNA refer to, the own sequence that is arranged in its both sides under native state of this DNA or fragment is separated, refer to that also this DNA or fragment with under the native state follow the component of nucleic acid to separate, and separate with the protein of in cell, following it.
Term among the present invention " root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) " gene refers to: coding has the nucleotide sequence of the active polypeptide of root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H), such as 1-1002 position nucleotide sequence and degenerate sequence thereof among the SEQ ID NO.1.This degenerate sequence refers to, is arranged in the encoder block 1-1191 position Nucleotide of SEQ ID NO.1 sequence, the sequence that has one or more codons to be encoded to produce after the degenerate codon of same amino acid replaces.Because the degeneracy of codon, thus with SEQ ID NO.1, in 1-1002 position nucleotide sequence homology be low to moderate about 70% the degenerate sequence described sequence of SEQ ID NO.2 of also encoding out.Also comprising can be under the rigorous condition of moderate, better under highly rigorous condition with SEQ ID NO.1 in from the nucleotide sequence of the nucleotide sequence hybridization of Nucleotide 1-1002 position.Also comprise with SEQ ID NO.1 in from the homology at least 70% of the nucleotide sequence of Nucleotide 1-1002 position, preferably at least 80%, more preferably at least 90%, at least 95% nucleotide sequence best.Also comprising to encode has the variant form of open reading frame sequence among the SEQ ID NO.1 with the albumen of natural root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) identical function.These variant forms comprise (but being not limited to): several (are generally, 1-90, preferably, 1-60, more preferably, 1-20,1-10 best) disappearance, insertion and/or the replacement of Nucleotide, and (being generally in 60, preferably is in 30 to add several at 5 ' and/or 3 ' end, more preferably being in 10, is in 5 best) Nucleotide.
Term among the present invention " root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) albumen or polypeptide " refers to: the polypeptide with the active SEQ ID NO.2 sequence of root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H).This term also comprises the variant form that has with the SEQ ID NO.2 sequence of natural root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) identical function.These variant forms comprise (but being not limited to): several (are generally 1-50, preferably 1-30, more preferably 1-20,1-10 best) amino acid whose disappearance, insertion and/or replacement, and add one or several at C-terminal and/or N-terminal and (be generally in 20, preferably being in 10, more preferably is in 5) amino acid.For example, in the art, when replacing with the close or similar amino acid of performance, usually can not change the function of protein.Again such as, add the function that or several amino acid also can not change protein usually at C-terminal and/or N-terminal.This term also comprises active fragments and the reactive derivative of root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H), also comprises operationally being connected in the derivative that signal peptide, promotor or ribosome bind site sequence form.The variant form of red sage root root of large-flowered skullcap flavanone of the present invention-6-hydroxylase (SbF6H) polypeptide comprises: homologous sequence, conservative property varient, allelic variant, natural mutation, induced mutation body, under high or low rigorous condition can with the coded albumen of the DNA of root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) DNA hybridization and the polypeptide or the albumen that utilize the serum of root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) polypeptide to obtain.
Root of large-flowered skullcap flavanone among the present invention-6-hydroxylase (SbF6H) conservative property variation polypeptide refers to: compare with the aminoacid sequence of SEQ ID NQ.2, there are 10 at the most, preferably at the most 8, more preferably 5 amino acid similar performances or close amino acid are replaced and are formed polypeptide at the most.These conservative propertys variation polypeptide can be according to table 1, replaces and produces.
The present invention also comprises the analogue of root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) or polypeptide.The difference of these analogues and natural root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) polypeptide can be the difference on the aminoacid sequence, also can be the difference that does not affect on the modified forms of sequence, perhaps haves both at the same time.These polypeptide comprise genetic variant natural or that induce.The induce variation body can obtain by various technology, as by radiation or be exposed to mutagenic compound and produce random mutagenesis, also can pass through site-directed mutagenesis method or the biological technology of other known moleculars.Analogue also comprises having the analogue that is different from the amino acid whose residue of natural L-(such as D-amino acid), and the analogue with that non-natural exists or synthetic amino acid (such as β, gamma-amino acid).Should be understood that polypeptide of the present invention is not limited to the above-mentioned representational polypeptide that exemplifies.Described modification (usually not changing primary structure) form comprises: chemically derived form such as the acetylize or carboxylated of the polypeptide that body is interior or external.Modification also comprises glycosylation, carries out glycosylation modified and polypeptide that produce in the procedure of processing such as those in the synthetic and processing of polypeptide or further.This modification can be carried out glycosylated enzyme (such as mammiferous glycosylase or deglycosylating enzyme) and finishes by polypeptide is exposed to.Modified forms also comprises have the phosphorylated amino acid residue sequence of (such as Tyrosine O-phosphate, phosphoserine, phosphothreonine).Thereby also comprise the polypeptide that has been improved its proteolysis performance or optimized solubility property by modifying.
In the present invention, can select various carrier known in the art, the carrier as commercially available comprises plasmid, clay etc.
Table 1: the replacement residue in the conservative property variation polypeptide
| Initial residue | Representational replacement residue | The preferred residue that replaces |
| Ala(A) | Val；Leu；IIe | Val |
| Arg(R) | Lys；GIn；Asn | Lys |
| Asn(N) | Gln；His；Lys；Arg | Gln |
| Asp(D) | Glu | Glu |
| Cys(C) | Ser | Ser |
| Gln(Q) | Asn | Asn |
| Glu(E) | Asp | Asp |
| Gly(G) | Pro；Ala | Ala |
| His(H) | Asn；Gln；Lys；Arg | Arg |
| Ile(I) | Leu；Val；Met；Ala；Phe | Leu |
| Leu(L) | Ile；Val；Met；Ala；Phe | Leu |
| Lys(K) | Arg；Gln；Asn | Arg |
| Met(M) | Leu；Phe；Ile | Leu |
| Phe(F) | Leu；Val；Ile；Ala；Tyr | Leu |
| Pro(P) | Ala | Ala |
| Ser(S) | Thr | Thr |
| Thr(T) | Ser | Ser |
| Trp(W) | Tyr；Phe | Tyr |
| Tyr(Y) | Trp；Phe；Thr；Ser | Phe |
| Val(V) | Ile；Leu；Met；Phe；Ala | Leu |
When producing the root of large-flowered skullcap flavanone of the present invention-former enzyme polypeptide of 6-hydroxylase (SbF6H), the nucleotide sequence of root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) gene operationally can be connected in expression regulation sequence, thereby form root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) expression vector.Described " operationally being connected in " refers to a kind of like this situation, and namely some part of linear DNA sequence can affect the activity of same other parts of linear DNA sequence.For example, if signal peptide DNA as precursor expression and participate in the secretion of polypeptide, signal peptide (secretion leader sequence) DNA operationally is connected in polypeptid DNA so; If transcribing of promotor control sequence, it is operationally to be connected in encoding sequence so; When if ribosome bind site is placed in the position that can make its translation, it is operationally to be connected in encoding sequence so.Generally, " operationally being connected in " means adjacent, then means in reading frame adjacent for the secretion leader sequence.Host cell is prokaryotic cell prokaryocyte or eukaryotic cell among the present invention.Prokaryotic host cell commonly used comprises intestinal bacteria; Eukaryotic host cell commonly used comprises yeast cell, tobacco cell and other vegetable cell.
The present invention is the expression of available Northern blotting technical Analysis root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) gene product also, namely analyzes existence and the quantity of rna transcription thing in cell of root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H).
In addition, the nucleic acid molecule that can be used as probe among the present invention has 8-100 continuous nucleotide of root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) nucleotide coding sequence usually, preferably has 15-50 continuous nucleotide.This probe can be used for whether existing in the test sample nucleic acid molecule of coding root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H).The present invention relates to whether exist in the test sample method of root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) nucleotide sequence, it comprises with above-mentioned probe and sample and hybridizing then whether detection probes combination has occured.Preferably, this sample is the product behind the pcr amplification, and wherein the pcr amplification primer is corresponding to root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) nucleotide coding sequence, and can be positioned at both sides or the centre of this encoding sequence.Primer length is generally 15-50 Nucleotide.In addition, according to root of large-flowered skullcap flavanone of the present invention-6-hydroxylase (SbF6H) nucleotide sequence and aminoacid sequence, can be on the homology basis of nucleic acid homology or marking protein, screening root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) source gene or homologous protein.
In order to obtain the dot matrix with root of large-flowered skullcap flavanone-root of large-flowered skullcap cDNAs that 6-hydroxylase (SbF6H) is relevant, can screen root of large-flowered skullcap cDNA library with dna probe, these probes are under low rigorous condition, with 3
2P root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) gene all or part of cooked the radioactivity mark and.The cDNA library that is best suited for screening is the library from the root of large-flowered skullcap.Structure is that biology field is well-known from the method for the cDNA library of interested cell or tissue.In addition, many such cDNA libraries also can buy, for example available from Clontech, and Stratagene, Palo Alto, Cal..This screening method can be identified the nucleotide sequence of the gene family of root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H).
The Nucleotide full length sequence of the gene family of root of large-flowered skullcap flavanone of the present invention-6-hydroxylase (SbF6H) or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually needs to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplifies is stitched together by proper order.In case obtained relevant sequence, just can obtain in large quantity relevant sequence with recombination method.This normally is cloned into carrier with it, changes cell over to again, then separates obtaining relevant sequence from the host cell after the propagation by ordinary method.In addition, also can will suddenly change by chemosynthesis and introduce in the protein sequence of the present invention.Except producing with recombination method, the fragment of albumen of the present invention is available solid phase technique also, is produced (people such as Stewart, (1969) Solid-hase Peptide Synthesis by direct peptide synthesis, WH Freeman Co., San Francisco; Merrifield J. (1963) J.Am Chem.Soc85:2149-2154).Can carry out by hand or automatically at external synthetic protein.For example, can come automatic pressing to become peptide with the 431A type peptide synthesizer (Foster City, CA) of Applied Biosystems.Can distinguish each fragment of chemosynthesis albumen of the present invention, then be connected to produce the molecule of total length with chemical process.Utilize root of large-flowered skullcap flavanone of the present invention-6-hydroxylase (SbF6H), by various conventional screening methods, can filter out with root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) interactional material occurs, perhaps acceptor, inhibitor or antagonist etc.
Root of large-flowered skullcap flavanone provided by the present invention-6-hydroxylase (SbF6H) gene is to clone first preparation from the root of large-flowered skullcap, utilize the present invention can improve by genetic engineering technique the content of scutellarin in the plants such as the root of large-flowered skullcap, transgene result shows that root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) gene pairs promotes the raising of scutellarin content that obvious effect is arranged.Root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) gene can be used for improving by transgenic technology research and the industrialization of scutellarin content, especially the quality-improving that can be used for the Chinese medicinal materials root of large-flowered skullcap, can alleviate the weary problem of the serious plaque of root of large-flowered skullcap resource, have preferably promoter action to improving scutellarin output, have good application prospect.
Description of drawings:
Fig. 1: root of large-flowered skullcap RNA, cDNA, cDNA library clone's pcr amplification electrophorogram;
Fig. 2: SbF6H functional domain forecast analysis (deriving from ncbi database);
Fig. 3: SbF6H systematic evolution tree (adjacent method);
Embodiment
The structure of embodiment 1, root of large-flowered skullcap cDNA library
1, the separation and detection of the total RNA of the root of large-flowered skullcap
Get the root of large-flowered skullcap (Scutellaria baicalensis Georgi) root 2g, in mortar with the quick grind into powder of liquid nitrogen, (CTAB (W/V) 2%, Tris-HCl (pH8.0) 100mmolL in the 10mL Extraction buffer of fast transfer to 65 ℃ preheating
-1, EDTA 25m molL
-1, NaCl 2.0molL
-1, PVP40 2%, spermidine 0.5g/L, mercaptoethanol 2%), mixing fully vibrates; With equal-volume chloroform extracting twice, centrifugal 15 minutes of 7500g.Supernatant liquor adds the 10M LiCl of 1/4 volume, places 4 ℃ of precipitations behind the mixing and spends the night; Centrifugal 20 minutes of 7500g, (SDS 0.5%, NaCl 1molL with 500 μ L SSTE for precipitation
-1, Tris-HCl (pH8.0) 10mmolL
-1, EDTA 1mmolL
-1, 65 ℃ of dissolvings 5 minutes.With the extracting of equal-volume chloroform, centrifugal 5 minutes of 13000g; Supernatant liquor adds 2 times of volume dehydrated alcohols, places 2h for-70 ℃; Centrifugal 20 minutes of 4 ℃ of 13000g, the precipitation drying at room temperature is dissolved in after 10 minutes in the water that 100 μ L DEPC process, and detects the integrity of RNA with 1.0% agarose electrophoresis, with GenQuant nucleic acid quantification instrument mensuration A260, A280 ratio and concentration.Place-80 ℃ of refrigerators for subsequent use.
2, the structure of cDNA library
Adopt mRNA purification kit (QuichprepTM Micro mRNA PurifiCation Kit, Pharmacia company) behind the separating mRNA, adopt the Creator Smart cDNA Library Construction Kit (Cat.No.634903) of Clontech company to build the storehouse, principle is SMART (switch mechanism at 5 ' end of mRNA template).
Embodiment 2: the clone of root of large-flowered skullcap genes involved
5000 mono-clonals of picking carry out bacterium colony PCR evaluation at random.Get an amount of PCR thin-walled tube, place on ice, every pipe adds first the aqua sterilisa of 17.3ul.10ul lancet choicest with the bacterium of going out is got the mono-clonal hickie to aqua sterilisa, the vibration mixing.Add successively: Taq buffer 2.5 μ L, MgCl
2(25mM) 1.8 μ L, dNTP (2.5mM) 1 μ L, M13+ primer (10pmol) 1 μ L, M13-primer (10pmol) 1 μ L, Taq enzyme 0.4 μ L.Each reagent gets rid of on the whizzer after all adding well, makes it to sink to the bottom, and places on the PCR instrument.The PCR reaction conditions is 94 ℃ of denaturations after 5 minutes, 94 ℃ 40 seconds, 54 ℃ 40 seconds, 72 ℃ 4 minutes, 4 ℃ of preservations were extended in rear 72 ℃ of 35 circulations 10 minutes.After the PCR reaction enters 4 ℃, take off the PCR thin-walled tube, get the 7ulPCR product and add the leakage of electricity swimming of 3ul bromine Finland, take a picture after half an hour, observe glue figure, identify roughly size and the small segment rate (Fig. 1) of Insert Fragment according to glue figure.
Select the single amplified production of band to deliver to the large genome company of China and check order, obtain root of large-flowered skullcap genes involved sequence.
The bioinformatic analysis of embodiment 3, SbF6H gene
The length of the root of large-flowered skullcap flavanone that the present invention relates to-6-hydroxylase (SbF6H) full length gene cDNA is 1002bp, and detailed sequence is seen the sequence 1 in the sequence table, and wherein opening code-reading frame is positioned at 109～921bp.Root of large-flowered skullcap full length cDNA sequence is carried out the nucleotide homology retrieval with blast program in Non-redundant GenBank+EMBL+DDBJ+PDB and Non-redundant GenBank CDS translation+PDB+Swissprot+Superdate+PIR database.This gene on amino acid levels with other species in F3H higher homology is arranged, have simultaneously typical 2OG-Fe (II) oxygenase superfamily and flavanone-3-hydroxylase structural domain.Such as Fig. 2 and 3.
The research of embodiment 4, SbF6H gene function
1, the structure of escherichia coli expression engineering bacteria
According to the ORF of root of large-flowered skullcap SbF6H full length gene cDNA sequence (SEQ ID NO.1), the primer of the complete open reading frame of design amplification is introduced respectively respectively restriction enzyme site EcoR I and HindIII, forward primer sequence P1:5 ' on forward and reverse primer
GAATTCATGGAAACAAAGGT 3 '; Reverse primer sequence P2:5 '
AAGCTTGGCTCAATAAACTAACT 3 '.Take the full-length cDNA fragment as template, behind pcr amplification, to be cloned into through the purpose fragment of the root of large-flowered skullcap SbF6H gene that enzyme is cut on pET32a (+) expression vector that enzyme cut, and transform e. coli bl21 (DE3), the PCR that carries out recon identifies and order-checking is identified.
2, protein expression induces
The picking engineering bacteria is inoculated in the LB liquid nutrient medium (containing ammonia benzyl mycin) of 2mL, spends the night in 37 ℃ of shaking culture.Join in 50mL LB liquid nutrient medium by dilution in 1: 100 next day, and 37 ℃ of shaking culture are to OD
600Be 0.3-0.5, add IPTG to final concentration 0.4mM, induce target protein to express, continue at 30 ℃ of shaking tables and cultivated 3-4 hour.When microbial culture to OD
600Be 1.0 o'clock, centrifugal 5 minutes of 10000rpm abandons supernatant, collects thalline.
3, the analysis of SbF6H prokaryotic expression
Get above-mentioned induced product 1ml, 4 ℃, the centrifugal 1min of 12000rpm, abandoning supernatant; Precipitation is resuspended in the 100 μ l sample loading buffers, 100 ℃ of heating 3min; The centrifugal 1min of 12000rpm; Get supernatant liquor 25ml, with tetrabromophenol sulfonphthalein mixing point sample; 80V constant voltage electrophoresis to sample enters separation gel, transfers to 120V again; Stop electrophoresis when moving to the gel lower boundary Deng bromjophenol blue.Glue put into fill coomassie brilliant blue staining liquid culture dish, the about 2h of dyeing on the shaking table; Outwell staining fluid, adding decolours on the destainer shaking table spends the night, and should change according to circumstances destainer 1～2 time therebetween, until band is clear, background is shallow, even does not have background.Reuse after the recyclable filtration of staining fluid.
4, the SbF6H protein function is analyzed
4.1 expression of recombinant proteins
1) with the LB substratum of the intestinal bacteria access 20mL kalamycin resistance that transforms, 37 ℃, the 250rpm shaking culture is spent the night;
2) 100 μ l intestinal bacteria overnight culture are all changed over to the LB substratum of 10mL Pyocianil resistance, 37 ℃, the 250rpm shaking culture to OD600 be 0.6;
3) adding final concentration is the IPTG of 0.4mmol/L, 30 ℃, cultivates 4h;
4) bacterium liquid divides and is filled to centrifugal bottle, and 4 ℃, the centrifugal 10min of 10000g collects thalline;
5) discard bacterium liquid supernatant, gained precipitation at the bottom of the bottle is placed on ice, the PBS Extraction buffer that contains mercaptoethanol with 1mL will precipitate fully resuspended;
6) will use Ultrasonic Cell Disruptor in the resuspended liquid ice bath of thalline, power 220W, broken 5s/ gap 5s/100 time, until bacterium liquid is no longer adhered, color lightens bright transparent;
7) the bacterium liquid after the fragmentation divides and is filled to centrifuge tube, and 4 ℃, 5500g, 5min, supernatant liquor is for subsequent use;
4.2 enzymatic reaction is identified
With enzymatic reaction mixed system (50mM Tris-HCl (pH 7.0), the 100nmol a-ketoglutaric acid, the 20nmol ferrous sulfate, the 2nmol xitix, 429 μ M are dissolved in the substrate of methylcyclohexane) mix with the enzyme crude extract, final volume is 250 μ l, hatch 30min for 37 ℃, 25 ℃., reaction 30min, reaction directly adds extraction solvent and stops.With the ethyl acetate extracting of 2mL, second and third time 1mL extracting, each whirlpool concussion 15s draws supernatant.Nitrogen dries up, and the 0.5mL dissolve with methanol is crossed 0.45 μ m film, upper LC-MS.Respectively with chrysin as substrate, with the scutellarin standard substance in contrast, the result shows that substrate can form scutellarin under the effect of enzyme crude extract.
Embodiment 5, sudden change SbF6H functional analyses of genes
According to SEQ ID No.1 sequences Design mutant primer, and add EcoR I restriction enzyme site at 5 ' end, 3 ' end adds the HindIII restriction enzyme site, give birth to worker biotech company synthetic primer by Shanghai, sequence is as follows: P1:5 '-GAATTCatggaGacaaaAgtga-3 ', P2:5 '-AAGCTTggctcaataaactaact-3 '.Obtain 1 SbF6H gene that contains 2 base mutations by the PCR method amplification, do not form but change amino acid.Mutator gene is cloned in the pET32a expression vector, and the abduction delivering of albumen, purifying and external enzymatic reaction identify that concrete grammar is with embodiment 4.The result shows that the enzymatic reaction product of mutator gene and SbF6H gene do not have significant difference.
Claims (5)
1. root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) gene is characterized in that it is one of following nucleotide sequences:
(1) dna sequence dna of SEQ ID No.1;
(2) nucleotide sequence that add, replace, insert or delete the homologous sequence of one or more Nucleotide or its allelotrope and derive of the nucleotide sequence shown in the SEQ ID No.1.
2. root of large-flowered skullcap flavanone-6-hydroxylase (SbF6H) is characterized in that, is one of following aminoacid sequence:
(1) has the aminoacid sequence shown in the SEQ ID No.2;
(2) SEQ ID No.2 add, replace, insert or delete one or more amino acid whose homologous sequences.
3. recombinant vectors is characterized in that: contain root of large-flowered skullcap flavanone claimed in claim 1-6-hydroxylase (SbF6H) gene complete sequence or partial sequence.
4. vegetable cell, it is characterized in that: described vegetable cell contains root of large-flowered skullcap flavanone claimed in claim 1-6-hydroxylase (SbF6H) gene complete sequence or partial sequence.
5. the application of gene claimed in claim 1 in the root of large-flowered skullcap or other plant breeding.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101130732A CN103374583A (en) | 2012-04-16 | 2012-04-16 | Flavanone-6-hydroxylase (SbF6H) gene in scutellaria baicalensis georgi as well as product coded by same and application of gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012101130732A CN103374583A (en) | 2012-04-16 | 2012-04-16 | Flavanone-6-hydroxylase (SbF6H) gene in scutellaria baicalensis georgi as well as product coded by same and application of gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103374583A true CN103374583A (en) | 2013-10-30 |
Family
ID=49460415
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012101130732A Pending CN103374583A (en) | 2012-04-16 | 2012-04-16 | Flavanone-6-hydroxylase (SbF6H) gene in scutellaria baicalensis georgi as well as product coded by same and application of gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103374583A (en) |
-
2012
- 2012-04-16 CN CN2012101130732A patent/CN103374583A/en active Pending
Non-Patent Citations (1)
| Title |
|---|
| DOMINIQUE ANZELLOTTI，ET AL: "Molecular characterization and functional expression of flavonol 6-hydroxylase", 《BMC PLANT BIOLOGY》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101928717A (en) | Salvia miltrorrhiza squalene synthase (SmSQS) gene and encoding protein and application thereof | |
| CN101418300B (en) | Gene for improving plant salt tolerance and drought resistance and use thereof | |
| CN101928716A (en) | SmFPS (Salviamiltiorrhizabge Farnesyl Pyrophosphate Synthase) gene as well as coded protein and application thereof | |
| CN102465133B (en) | Lonicera japonica chalcone synthase (LjCHS) gene, protein coded by LjCHS gene and application of LjCHS gene | |
| CN102220353B (en) | Encoding sequence of Cinnamic acid-4-hydroxylase protein in sweet potato and application of same | |
| CN102465136B (en) | Lonicera japonica chalcone isomerase (LjCHI) gene, LjCHI gene coded protein and their application | |
| CN101928715A (en) | Salviamiltiorrhizabge-cytochrome P450 (SmP450) gene as well as coded protein and application thereof | |
| CN101250544B (en) | Salvia 3-hydroxy-3-methylglutaryl A reductase gene and its coding protein and application | |
| CN101942422B (en) | Genes of D-lactic dehydrogenase from serratia marcescens and research of cloning and expressing recombinant strains and recombinant enzymes | |
| CN101250543B (en) | Japan snakeroot strictosidine synthase gene and its coding protein and application | |
| CN1948339B (en) | Preparation and purification of telomerase activity inhibition protein | |
| CN102604975A (en) | Squalene synthase gene of Panax japonicus and application of the gene | |
| CN101250541B (en) | Salvia 1-deoxidation xylulose-5-phosphate synthase gene 1 and its coding protein and application | |
| CN102465135A (en) | Scutellaria baicalensis Georgi caffeoyl-CoA-3-O-methyltransferase (SbCCOMT2) gene, and coding product and application thereof | |
| CN104388446B (en) | Pinellia ternate squalene synthase gene as well as coded protein and application thereof | |
| CN100360664C (en) | Nanjing bass 3-hydroxyl-3-methyl glutaryl coenzyme A reductase protein encoding sequence | |
| CN102399798B (en) | Inonotus obliquus squalene synthase gene and its coded protein and use | |
| CN103374583A (en) | Flavanone-6-hydroxylase (SbF6H) gene in scutellaria baicalensis georgi as well as product coded by same and application of gene | |
| CN1760363B (en) | Coded sequence of reductase enzyme protein of eucommia 3-hydroxy-3-coenzyme of methyl glutaryl A | |
| CN101250545B (en) | Scopoloa acutangula 1,4-tetramethylenediamine-nitrogen-methyltransferase 1 and its coding protein and application | |
| CN101475947B (en) | Salvia 1-deoxy-D-xylulose-5-phosphate synthetase II gene, and encoding protein and use thereof | |
| CN101168740B (en) | Scopoloa acutangula tropinone reductase I gene and its coding protein and application | |
| CN101250542B (en) | Salvia 3-hydroxy-3-methylglutaryl A synthase gene and its coding protein and application | |
| CN100406559C (en) | Lechang michelia 3-hydroxy-3-methy glutaryl CoA reductase protein coding sequence | |
| CN101168739A (en) | Scopoloa acutangula tropinone reductase II gene and its coding protein and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20131030 |