CN103374068A - Preparation method and application of novel monoclonal antibody - Google Patents
Preparation method and application of novel monoclonal antibody Download PDFInfo
- Publication number
- CN103374068A CN103374068A CN 201210130232 CN201210130232A CN103374068A CN 103374068 A CN103374068 A CN 103374068A CN 201210130232 CN201210130232 CN 201210130232 CN 201210130232 A CN201210130232 A CN 201210130232A CN 103374068 A CN103374068 A CN 103374068A
- Authority
- CN
- China
- Prior art keywords
- encoding gene
- antigen
- construction
- expression cassette
- promotor
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention discloses a preparation method and an application of a novel monoclonal antibody, a method for immunizing with a DNA (deoxyribonucleic acid) vaccine to obtain a high antibody titer, a system for expressing the biotinylation of the specific site of the interest protein in a mammalian cell and an enzyme-linked immunosorbent assay with extremely low demand for antigens.
Description
Technical field
The invention belongs to biological technical field; More particularly, the present invention relates to a kind of Preparation method and use of new monoclonal antibody, be suitable for the monoclonal antibody that large-scale preparation can be identified the natural antigen epi-position.
Background technology
Monoclonal antibody technique is the important tool of modern life science research, and it is having indispensable effect aspect structure and function research of gene and protein, and the vital role that can not be substituted is still being arranged aspect human and animal's the immunology diagnosis so far.
The ultimate principle of monoclonal antibody technique is: but induction of immunity reacted after mouse was subject to the external antigen stimulation, produced corresponding antibody, and this function is to be born by bone-marrow-derived lymphocyte.Tumour cell can infinitely go down to posterity under condition of in vitro culture, is permanent cell.The myeloma cell of mouse is merged under the mediations such as polyoxyethylene glycol with the mouse boosting cell of process immunity, hybridoma after the fusion has the characteristic of two kinds of cells, can secrete specific antibody on the one hand, also possessed on the one hand the tumour cell infinite multiplication ability, can or be transplanted to infinite multiplication in the body under condition of in vitro culture, thereby secrete a large amount of monoclonal antibodies.
Can immunization method and screening antigen be the important factors that determines to obtain high-affinity, can identify the monoclonal antibody of natural antigen epi-position.Dna vaccination claims again gene vaccine or nucleic acid vaccine, and this nucleic acid molecule is a kind of bacterial plasmid, after having cloned specific gene, can at the eukaryotic expression proteantigen, stimulate body to produce specific humoral immune reaction and cell immune response.Compare with other immune methods, dna vaccination has the following advantages: the risk that does not have infection; Bring out the antibody for the native protein epi-position, the long-term immune response that continues; Be convenient to make up and have synergistic cytokine vaccine; Purifying is easy, and production cost is low, and stability is temperature influence not.The key issue that dna immunization exists is how to improve immunogenicity and the humoral immune reaction of dna vaccination.Current main research direction concentrates on structure own, adjuvant and vaccination regimen and the approach of optimizing dna vaccination.
The hybridoma that the serum antibody titer assessment of immune animal and screening can be secreted specific recognition antigen needs high-quality antigen.The recombinant protein that utilizes protokaryon and eukaryotic system to express exists open defect: the albumen of escherichia coli expression can not be modified and correct folding, and the monoclonal antibody that screens often can not be identified the antigen of natural structure; Mammalian cell expression albumen is long experimental period, yields poorly, and cost is high, and some albumen difficulty are expressed for example transcription factor.The acquisition that is used for estimating the antigen of antibody titers and screening hybridoma is the bottleneck of restriction monoclonal antibody preparation.
Therefore, need the easy monoclonal antibody immunity strategy of exploitation and screening method, can identify the monoclonal antibody of natural antigen epi-position to be used for large-scale preparation.
Summary of the invention
The object of the present invention is to provide a kind of Preparation method and use of new monoclonal antibody.
In a first aspect of the present invention, a kind of method of screening monoclonal antibody is provided, comprising:
(1) provide construction 1, this construction 1 comprises (5 ' → 3 '): expression cassette 1, and it comprises (5 ' → 3 ') promotor 1, vitamin H ligase enzyme BirA encoding gene, terminator 1; With expression cassette 2, it comprises (5 ' → 3 ') promotor 2, AviTag encoding gene, antigen encoding gene, terminator 2;
With construction 1 transfection (such as transient transfection) mammalian cell, express obtaining biotinylated antigen, lysing cell obtains to contain the lysate of biotinylated antigen;
(2) provide construction 2, this construction 2 comprises (5 ' → 3 '): expression cassette 3, and it comprises (5 ' → 3 ') promotor 3, signal peptide encoding gene, GM-CSF encoding gene, terminator; With expression cassette 4, it comprises (5 ' → 3 ') promotor 4, signal peptide encoding gene, antigen encoding gene;
With construction 2 immune Mammalss, get the Mammals spleen cell and prepare hybridoma;
(3) lysate that contains biotinylated antigen that step (1) is obtained contacts with the solid phase carrier that is coated with avidin, thereby biotinylated antigen is fixed in solid phase carrier; Screen the antibody of the hybridoma secretion of step (2) acquisition with this biotinylated antigen, obtain the monoclonal antibody of the anti-described antigen of specificity.
In another aspect of this invention, provide a kind of method for preparing biotinylated antigen, comprising:
With construction 1 transfection mammalian cell, express obtaining biotinylated antigen.
In another aspect of this invention, provide a kind of method of Dispersal risk, comprising: construction 2 is provided, and this construction 2 comprises: expression cassette 3, and it comprises promotor 3, signal peptide encoding gene, GM-CSF encoding gene, terminator; With expression cassette 4, it comprises promotor 4, signal peptide encoding gene, antigen encoding gene;
With construction 2 immune Mammalss, obtain mammiferous immune serum, comprising the polyclonal antibody of anti-described antigen; Or with construction 2 immune Mammalss, obtain mammiferous spleen cell, the preparation monoclonal antibody.
In another aspect of this invention, provide a kind of method of tiring of assessing antibody, comprising:
With construction 1 transfection mammalian cell, express obtaining biotinylated antigen, lysing cell obtains to contain the lysate of biotinylated antigen;
The lysate that contains biotinylated antigen that obtains is contacted with the solid phase carrier that is coated with avidin, thereby biotinylated antigen is fixed in solid phase carrier; Assess the tiring of antibody (comprising polyclonal antibody or monoclonal antibody) of anti-this antigen of specificity with this biotinylated antigen.
In another preference, in the expression cassette 1, between promotor 1 and vitamin H ligase enzyme BirA encoding gene, also comprise the KOZAK gene; Or
In the expression cassette 2, between promotor 2 and AviTag encoding gene, also comprise (5 ' → 3 ') KOZAK gene and/or purification tag (including but not limited to: Flag, Myc etc.) encoding gene; Or
In the expression cassette 3, between promotor 3 and signal peptide encoding gene, also comprise the KOZAK gene; Or
In the expression cassette 4, between promotor 4 and signal peptide encoding gene, also comprise the KOZAK gene.
In another preference, described vitamin H ligase enzyme BirA encoding gene has the nucleotide sequence shown in the SEQ ID NO:7; Or.
Described AviTag has the nucleotide sequence shown in the SEQ ID NO:9; Or
Described GM-CSF encoding gene has the nucleotide sequence shown in the SEQ ID NO:4; Or
Described signal peptide is people IgE heavy chain signal peptide; More preferably, described IgE heavy chain signal peptide has the nucleotide sequence shown in the 16-69 position among the SEQ ID NO:3; Or
Described KOZAK gene has SEQ ID NO: in the nucleotide sequence shown in the 7-15 position; Or
Described purification tag is the Flag label; More preferably, described Flag label coding gene has the nucleotide sequence shown in the SEQID NO:10.
In another preference, described antigen is to stimulate immune system to make it to produce specific immune response, and the material of specific binding can occur in vivo and in vitro with corresponding immunne response product (antibody); Preferably, described antigen is selected from (but being not limited to): viral protein, bacterioprotein; More particularly, described viral protein includes, but is not limited to: the albumen (such as nucleocapsid protein) in hantaan virus (HTNV) source, the albumen (such as nucleocapsid protein) in ripple horse traction virus (Pumala) source, the albumen in influenza virus source, the albumen in avian influenza virus source, the albumen in simplexvirus source, the albumen in Pestivirus suis source, the albumen in flavivirus source, the albumen in hepatitis B virus source, the albumen in respiratory syncytial virus source; Described bacterioprotein includes, but is not limited to: the albumen in helicobacter pylori source, the albumen in candidiasis source, the albumen in plague bacillus source, the albumen in cholera bacteria source.
In another preference, described antigen is selected from but is not limited to: human neutrophil genatinase associated lipocalin antigen (NGAL), hantaan virus HTNV type Nucleocapsid protein P albumen, the albumen shown in hantaan virus HNTV type Nucleocapsid protein P and Pumala C-type virus C Nucleocapsid protein P fusion rotein or the SEQ IDNO:1.
In another preference, between each element, also can comprise in the expression cassette: connection peptides encoding gene, or multiple clone site gene.
In another preference, described promotor 1, promotor 2, promotor 3, promotor 4 are identical or different; Can be constitutive promoter (such as CMV, SV40, T7, pMC1, PGK etc.), inducible promoter or specific expressing promoter.
In another preference, described promotor 1, promotor 2, promotor 3, promotor 4 are selected from (but being not limited to): the early early stage enhanser promotor (CMV promotor) of cytomegalovirus, people's EF-1 subunit promotor (EF-1a promotor).
In another preference, described promotor 1 and promotor 3 are the CMV promotor; Described promotor 2 and promotor 4 are the EF-1a promotor.
In another preference, described construction is expression vector.
In another preference, the skeleton carrier of described expression vector is pBudCE4.1.
In another aspect of this invention, provide a kind of dna vaccination, comprising: expression cassette 3, it comprises promotor 3, signal peptide encoding gene, GM-CSF encoding gene, terminator; With expression cassette 4, it comprises promotor 4, signal peptide encoding gene, antigen encoding gene.
In another aspect of this invention, provide the purposes of described dna vaccination, for the preparation of stimulating immune system to make it to produce the composition of specific antibody.
In another aspect of this invention, provide a kind of construction for biotinylated antigen, it comprises (5 ' → 3 '): expression cassette 1, and it comprises (5 ' → 3 ') promotor 1, vitamin H ligase enzyme BirA encoding gene, terminator 1; With expression cassette 2, it comprises (5 ' → 3 ') promotor 2, AviTag encoding gene, antigen encoding gene, terminator 2.
In another aspect of this invention, provide the purposes of described construction, for the preparation of biotinylated antigen.
In another aspect of this invention, provide a kind of test kit a, comprising:
In another preference, described test kit a resists antibody, the screening monoclonal antibody of described antigen or assesses tiring of antibody for the preparation of biotinylated antigen, preparation.
In another aspect of this invention, provide a kind of test kit b, comprising:
In another preference, described test kit b is used for specific antigen is inserted into the multiple clone site of antigen encoding gene, and then resists antibody, the screening monoclonal antibody of described antigen or assess tiring of antibody for the preparation of biotinylated antigen, preparation.
Other side of the present invention is because the disclosure of this paper is apparent to those skilled in the art.
Description of drawings
The transformation synoptic diagram of Fig. 1, pBud-Dse double-promoter secretion expression carrier.
Sequence behind Fig. 2, BirA codon optimized.
The reading frame sequence of Fig. 3, pBirA-N carrier EF-1a promoter engineering.
Fig. 4, Western blot detect HNTV (N holds 1-119aa)-PUUV (N holds 1-119aa) albumen biotinylation situation in cell.Wherein, swimming lane 1 is the 293T cell pyrolysis liquid; Swimming lane 2 contains the cell pyrolysis liquid of the restructuring pBirA-N plasmid of HNTV (N holds 1-119aa)-PUUV (N holds 1-119aa) encoding gene for transfection; 3. transfection contains the restructuring Pbudce4.1 plasmid cell lysate of HNTV (N holds 1-119aa)-PUUV (N holds 1-119aa) encoding gene.
Fig. 5, ELISA method are determined the best coated concentration of Streptavidin.
Fig. 6, ELISA method determine that cell pyrolysis liquid dilutes dense degree.
The NP full-length proteins of Fig. 7, HNTV-84Fli is coated, the monoclonal antibody activity identification.
Fig. 8, natural NGAL full-length proteins (washing one's hair available from middle section English) is coated in porous plate, the monoclonal antibody of antagonism human neutrophil genatinase associated lipocalin carries out activity identification.
Embodiment
The inventor is through deep research, disclosed a kind ofly to obtain the dna vaccination immunization method of high antibody titers and based on the biotinylated expression system of target protein specific site in the mammalian cell, developed the extremely low enzyme-linked immunoassay method of a kind of antigen demand.
Term
As used herein, described " construction " refers to recombinant DNA molecules, and it comprises the nucleic acid coding sequence of expection, and it can comprise one or more expression cassettes.Described " construction " is comprised in the expression vector usually.
As used herein, described " expression cassette " refers to include the gene expression system of expressing the required element that is necessary of target protein, and it comprises element usually: the gene order of promotor, proteins encoded, terminator; Alternative comprises signal coding sequence etc. in addition.These elements are that operability links to each other.
As used herein, described " biotinylation " refers to: in mammalian cell, by the effect of vitamin H ligase enzyme BirA, with the protein of Avitag label can both by effectively, vitamin H on the mark specifically.
As used herein, described " promotor " or " promoter region (territory) " refers to a kind of nucleotide sequence, and the upstream (5 ' end) that it is present in the goal gene encoding sequence usually can be transcribed into mRNA by the guiding nucleus acid sequence.Usually, promotor or promoter region provide RNA polymerase and correct initial recognition site of transcribing necessary other factors.In this article, described promotor or promoter region comprise the variant of promotor, and it is by inserting or deletion regulation and control zone, and carry out at random or rite-directed mutagenesis etc. obtains.
As used herein, described " being operably connected " or " operability connection " refers to functional spatial disposition of two or more nucleic acid region or nucleotide sequence.For example: promoter region is placed in the specific position with respect to the goal gene nucleotide sequence so that nucleotide sequence transcribe the guiding that is subject to this promoter region, thereby promoter region is " operably connected " on this nucleotide sequence.
As used herein, described " containing ", " having " or " comprising " comprised " comprising ", " mainly by ... consist of ", " basically by ... consist of " and " by ... consist of "; " mainly by ... consist of ", " basically by ... consist of " and " by ... formation " belong to the subordinate concept of " containing ", " having " or " comprising ".
The preparation of efficient DNA vaccine
The invention provides a kind of method for preparing dna vaccination, comprise: construction 2 is provided, this construction 2 comprises (5 ' → 3 '): expression cassette 3, and it comprises (5 ' → 3 ') promotor 3, signal peptide encoding gene, GM-CSF encoding gene, terminator; With expression cassette 4, it comprises (5 ' → 3 ') promotor 4, signal peptide encoding gene, antigen encoding gene; This construction or the expression vector that contains this construction can be used for immune Mammals, stimulate Mammals to produce immunne response.
In the dna vaccination of the present invention, with GM-CSF and coexpression.The Main Function of GM-CSF is propagation and the differentiation that promotes antigen presenting cell, can be used as the adjuvant of dna vaccination, adds the Presentation of strong antigen, and then strengthens humoral immunoresponse(HI), the significantly generation of enhancement antigen specific antibody.
Any promotor that is suitable for carrying out protein expression all can be selected to the expression that drives GM-CSF encoding gene or antigen encoding gene, include but not limited to constitutive promoter (such as CMV, SV40, T7, pMC1, PGK etc.), inducible promoter or specific expressing promoter.Preferably, described promotor is selected from: CMV promotor, EF-1a promotor.More preferably, promotor 3 is the CMV promotor; Promotor 4 is the EF-1a promotor.
As more preferably mode of the present invention, in the expression cassette 3, between promotor 3 and signal peptide encoding gene, also comprise the KOZAK gene; Or in the expression cassette 4, between promotor 4 and signal peptide encoding gene, also comprise the KOZAK gene.Being added with of KOZAK gene order is beneficial to transcribing and translation efficiency when improving eukaryotic expression.
The multi-signal peptide can be applied to the present invention, as long as it can guide GM-CSF or antigen to carry out secreting, expressing.Signal peptide is the one section aminoacid sequence that is positioned at the N end of secretory protein (precursor), generally formed by 15～30 amino acid, comprise three districts: the N-terminal of a positively charged signal peptide, be called alkaline N-terminal: hydrophobic sequence in the middle of. take neutral amino acids as main, it is the major function district of signal peptide; Long electronegative C-terminal contains small molecules amino acid, is the signal sequence cleavage site.As more preferably mode of the present invention, described signal peptide is IgE heavy chain signal peptide.
As more preferably mode of the present invention, described GM-CSF encoding gene has the nucleotide sequence shown in the SEQ ID NO:4; Or described IgE heavy chain signal peptide has the nucleotide sequence shown in the 16-69 position among the SEQ ID NO:3; Or described KOZAK gene has SEQ ID NO: in the nucleotide sequence shown in the 7-15 position.The invention still further relates to the varient of above-mentioned polynucleotide, its coding has the polypeptide of identical aminoacid sequence or fragment, analogue and the derivative of polypeptide with the present invention.The varient of these polynucleotide can be the allelic variant of natural generation or the varient that non-natural occurs.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be replacement, disappearance or the insertion of one or more Nucleotide, but can be from the function of the polypeptide that changes in fact its coding.The invention still further relates to the polynucleotide with above-mentioned polynucleotide homology, they are to have at least 50% with above-mentioned polynucleotide, preferably at least 60%, more preferably at least 70%, more preferably at least 80%, more preferably at least 90%; More preferably at least 95%; The polynucleotide of at least 98% or 99% homogeny more preferably.The coded albumen of these polynucleotide also has the function identical with the coded albumen of aforementioned polynucleotide.In addition, can be according to the codon-bias of different mammalian bodies, to carry out codon optimizedly, the sequence of this optimization is also contained among the present invention.
The present invention provides a platform for the preparation of dna vaccination, wherein said antigen has no particular limits, as long as this antigen is to stimulate immune system to make it to produce specific immune response, and the material of specific binding can occur in vivo and in vitro with corresponding immunne response product (antibody); Preferably, described antigen is selected from but is not limited to: viral protein, bacterioprotein; More particularly, described viral protein includes but not limited to: the albumen (such as nucleocapsid protein) in hantaan virus source, the albumen of Pumala viral source (such as nucleocapsid protein), the albumen in influenza virus source, the albumen in avian influenza virus source, the albumen in simplexvirus source, the albumen in Pestivirus suis source, the albumen in flavivirus source, the albumen in hepatitis B virus source, the albumen in respiratory syncytial virus source; Described bacterioprotein includes but not limited to: the albumen in helicobacter pylori source, the albumen in candidiasis source, the albumen in plague bacillus source, the albumen in cholera bacteria source.More preferably, described antigen is selected from but is not limited to: NGAL antigen, hantaan virus NP albumen, the albumen shown in hantaan virus HNTV type Nucleocapsid protein P and Pumala C-type virus C Nucleocapsid protein P fusion rotein or the SEQ ID NO:1.
Usually, expression cassette is comprised in the expression vector, and multiple expression vector can be applied to the present invention, as long as it is suitable for expressing described GM-CSF and antigen.Preferably, described expression vector is carrier for expression of eukaryon.Preferably, described expression vector comprises at least 2 promotors so that set up double expression boxes.
As more preferably mode of the present invention, described expression vector is to obtain as the skeleton carrier transformation with the pBudCE4.1 carrier.The pBudCE4.1 carrier carries CMV promotor and EF 1-α promotor double-promoter, IgE signal peptide and new multiple clone site have been introduced respectively in CMV promotor and EF1-α promotor, carrier called after pBud-Dse, improved carrier is applicable to the secretion expression of albumen, be particularly suitable for the gene of the Codocyte factor (GM-CSF) and and the gene of specific antigens all be cloned in the same carrier, allow these two kinds of genes at same cell inner expression, improve animal for the immune response of specific antigens.
Can adopt method that those skilled in the art commonly use with dna vaccination immunity Mammals, produce immunne response in the mammalian body thereby stimulate.For example, a kind of method of immune mouse is as follows: 4-6 BALB/c female mice in age in week, carry out intramuscular injection in mouse two back leg upper arm musculus quadriceps, every injected in mice 80 μ g.Every three all immunity once, be total to immunity three times.Eye socket was got blood in immune rear ten days for the third time, and the ELISA method is measured titre.
The preparation of biotinylated antigen
The present invention also provides a kind of foreign protein biotinylated expression system in mammalian cell, provides on this basis a kind of antigen demand extremely low enzyme-linked immunoassay method, is used for the evaluation of animal immune serum and the screening of monoclonal cell strain.The biotinylation principle of mammalian cell foreign protein is as follows:
The method of biotinylated antigen of the present invention is as follows: construction 1 is provided, and this construction 1 comprises (5 ' → 3 '): expression cassette 1, and it comprises (5 ' → 3 ') promotor 1, vitamin H ligase enzyme BirA encoding gene, terminator 1; With expression cassette 2, it comprises (5 ' → 3 ') promotor 2, AviTag encoding gene, antigen encoding gene, terminator 2; With construction 1 transfection mammalian cell, express obtaining biotinylated antigen, lysing cell obtains to contain the lysate of biotinylated antigen.
AviTag is comprised of 17 amino-acid residues, in vivo or externally can both be connected a biotin molecule at lysine residue by vitamin H ligase enzyme BirA (such as aminoacid sequence GI:49175990), coexpression BirA enzyme and with the antigen protein of Avi label in mammalian cell can be realized biotinylation in the cell of foreign protein.
Any promotor that is suitable for carrying out protein expression all can be selected to the expression that drives vitamin H ligase enzyme BirA encoding gene, include but not limited to constitutive promoter (such as CMV, SV40, T7, pMC1, PGK etc.), inducible promoter or specific expressing promoter.Preferably, described promotor is selected from: CMV promotor, EF-1a promotor.More preferably, promotor 1 is the CMV promotor; Promotor 2 is the EF-1a promotor.
As optimal way of the present invention, in expression cassette 1, between promotor 1 and vitamin H ligase enzyme BirA encoding gene, also comprise the KOZAK gene; Or in the expression cassette 2, between promotor 2 and AviTag encoding gene, also comprise (5 ' → 3 ') KOZAK gene and/or purification tag (including but not limited to: Flag, Myc etc.) encoding gene.
Usually, expression cassette is comprised in the expression vector, and multiple expression vector can be applied to the present invention, as long as it is suitable for expressing described vitamin H ligase enzyme BirA or AviTag-antigen coalescence protein.Preferably, described expression vector is carrier for expression of eukaryon.Preferably, described expression vector comprises at least 2 promotors so that set up double expression boxes.As more preferably mode of the present invention, described expression vector is to obtain as the skeleton carrier transformation with the pBudCE4.1 carrier.The pBudCE4.1 carrier carries CMV promotor and EF1-α promotor double-promoter.
Different biological species has the preference of its oneself the son that accesses to your password, and it is codon optimized that the inventor also comprises that to other elements in BirA gene and the construction affinity tag and intervening sequence have carried out, and expresses to make it to improve.
As optimal way of the present invention, codon optimized BirA gene is cloned into pBudCE4.1 support C MV promotor back.With one section coding AviTag and Flag-tag and the multiple clone site sequence clone promotor back to EF-1a, the carrier called after pBirA-N of new structure.According to the cloning site of antigen gene structure and pBirA-N carrier, antigen gene is cloned into EF-1 α promotor back.
Can be with construction (such as expression vector) transfectional cell with at the biotinylated antigen of cell inner expression.Because optimization of the present invention only needs a small amount of antigen can realize that ELISA detects.Therefore, can prepare biotinylated antigen, simple operation by construction wink is turned cell.
Utilize the principle of vitamin H and the combination of Streptavidin high special, avidin (such as Streptavidin SA) is coated on the solid phase carrier, then add the cell pyrolysis liquid (cell inner expression has biotinylated antigen) after diluting, hatch.To by pre-coated avidin efficient capture, be carried out follow-up experiment according to the method for indirect ELISA by biotinylated antigen.
The method of screening antibodies
Further content of the present invention is effectively to combine based on the extremely low enzyme-linked immunoassay method of antigen demand of antigen biotinylation expression system with (a) dna vaccination immunization method with (b), these two kinds of technical tie-ups are applied in the preparation process of monoclonal antibody, cost and the difficulty of monoclonal antibody preparation have been reduced, shortened the experimental period of antigen preparatory stage, improve the quality of monoclonal antibody, be fit to the exploitation of large-scale commercial applications monoclonal antibody.
The method of screening monoclonal antibody of the present invention is mainly as follows: with described construction 1 transfection (such as transient transfection) mammalian cell, express and obtain biotinylated antigen, lysing cell obtains to contain the lysate of biotinylated antigen, this lysate that contains biotinylated antigen is contacted with the solid phase carrier that is coated with avidin, thereby biotinylated antigen is fixed in solid phase carrier; Simultaneously, with described construction 2 immune Mammalss, get the Mammals spleen cell and prepare hybridoma; Afterwards, screen the antibody of hybridoma secretion with this biotinylated antigen, obtain the monoclonal antibody of the anti-described antigen of specificity.
Based on optimisation technique of the present invention, a kind of method of tiring of assessing antibody also is provided, comprising: with construction 1 transfection mammalian cell, express obtaining biotinylated antigen, lysing cell obtains to contain the lysate of biotinylated antigen; The lysate that contains biotinylated antigen that obtains is contacted with the solid phase carrier that is coated with avidin, thereby biotinylated antigen is fixed in solid phase carrier; Assess the tiring of antibody (comprising polyclonal antibody or monoclonal antibody) of anti-this antigen of specificity with this biotinylated antigen.
Adopt dna vaccination immune animal of the present invention, dna vaccination immune serum antibody titers is higher than 10000, can replace traditional method with protein immunization, in conjunction with adopting antigen biotinylation expression system of the present invention, with construction transient transfection mammalian cell, recombinant antigen by biotinylation, saves purification step in cell, the avidin that directly is coated on 96 orifice plates catches.So that the screening time of monoclonal antibody shortens greatly, can within two weeks, finish.And the biotinylated antigen that the cell of 60mm culture dish provides just can be finished the screening process of monoclonal antibody.
The present invention do not need can accomplish great expression and purifying antigen to carry out animal immune and screening, and experimental period is short, and cost is low, and efficient is high, and the monoclonal anti weight is high, is particularly suitable for the monoclonal antibody preparation of the more unobtainable albumen of natural antigen.Adopt the novel method of preparation monoclonal antibody provided by the invention, the inventor has successfully prepared the monoclonal antibody of 11 strains anti-hantaan virus HNTV type and PUUV type NP albumen (N holds 1-119aa).
Beneficial effect
The invention provides and a kind ofly obtain the dna vaccination immunization method of high antibody titers and based on the biotinylated expression system of target protein specific site in the mammalian cell, developed the extremely low enzyme-linked immunoassay method of a kind of antigen demand.
The invention provides a kind of efficient, economical, prepare immunity and the screening novel method of monoclonal antibody easily, having overcome existing antigen with the restructuring purifying carries out animal immune and screens the monoclonal anti body method long in the antigen preparatory period, cost is high, the defectives such as the monoclonal antibody None-identified natural structure that filters out are particularly suitable for the preparation of the monoclonal antibody of the more unobtainable albumen of natural antigen.
Compare with traditional method, method of the present invention has been avoided antigen great expression and purification step, reduced cost, shorten experimental period, replace protein immune animal with dna vaccination, can simulate the immune response that natural antigen causes in animal body, the monoclonal antibody of easier acquisition identification native protein epi-position, compare with albumen, dna vaccination has that purifying is easy, and production cost is low, and stability is difficult for the advantages such as temperature influence, dna vaccination immunization method provided by the invention can obtain the antibody of higher titre, satisfies the requirement that hybridoma merges the antagonist titre fully.
Method of the present invention, acquisition from the vector construction to antigen can be finished within two weeks, demand to antigen is extremely low simultaneously, the cell pyrolysis liquid of a 60mm culture dish, do not need purifying, just can satisfy in the whole monoclonal antibody preparation process demand to antigen, tradition directly needs antigen coated method on microwell plate the albumen of 1mg purifying at least.In addition, eucaryotic organism elementization provided by the invention system is applicable to all mammalian cells, and the antigen of acquisition can be by correct modification and folding, and protein structure and natural antigen are approaching.
The preparation method of monoclonal antibody provided by the invention is particularly suitable for the preparation of the more unobtainable monoclonal antibody of natural antigen, viral protein for example, cell transcription factor etc.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used for explanation the present invention and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example is write according to normal condition such as J. Pehanorm Brooker etc. usually, molecular cloning experiment guide, Science Press, the condition described in 2002, or the condition of advising according to manufacturer.Unless otherwise indicated, otherwise per-cent and umber calculate by weight.
Unless otherwise defined, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any method similar or impartial to described content and material all can be applicable among the present invention.The usefulness that better implementation method described in the literary composition and material only present a demonstration.
Carrier pBudCE4.1 (available from Invitrogen company, article No.: V532-20), make up multiple construction as parent material.
The pBudCE4.1 plasmid has the double expression(DE) frame, has respectively two strong promoter CMV promotors and hEF1 α promotor to be responsible for, and can express simultaneously two foreign proteins, and both expression does not interfere with each other.PBudCE4.1 is particularly suitable for the gene of the Codocyte factor (IL-4, IL-2, IL-6, granulocyte colony stimulating factor etc.) and the gene of specific antigens all are cloned in the same carrier, allows these two kinds of genes at same cell inner expression.
Utilize pBudCE4.1 to make up pBud-Dse double-promoter secretion expression carrier, (Fig. 1) specific as follows: the encoding sequence of people's IgE heavy chain signal peptide (IgE-leader peptide) is carried out codon optimizedly expressing to improve.Introduce eukaryotic cell ribosome recognition site Kozak sequence GCCGCCACC before the initiator codon ATG; It is multiple clone site behind the signal peptide sequence, signal peptide and the multiple clone site sequence of the synthetic two sections optimizations of full gene, one section with restriction enzyme NotI and BglII digestion, and then connect multiple clone site in the hEF1 of pBudCE4.1 carrier α promotor back, another section nucleotide sequence digests with restriction enzyme BamHI and HindIII, be connected in the carrier of previous step structure, detect the clone who separates by order-checking, confirming does not have mistake to bring into.
Finally, the reading frame sequence following (SEQ ID NO:2) of hEF1 α promoter regulation on the pBud-Dse double-promoter secretion expression carrier of structure:
GCGGCCGC
GCCGCCACCATGGACTGGACCTGGATCTTATTCCTGG
TGGCCGCCGCCACCAGGGTGCACAGC?GGTACCAGCACAGTGGA
CTCGAGAGATCT
The reading frame sequence following (SEQ ID NO:3) of CMV-promoter regulation on the pBud-Dse double-promoter secretion expression carrier that makes up:
AAGCTT
GCCGCCACCATGGACTGGACCTGGATCTTATTCCTGGTG
GCCGCCGCCACCAGGGTGCACAGC?TTGCATTCCTGCAGGTCGACA
TCGATCTTAAGCAGTACTTCTAGAGGATCC
The pBud-Dse-GM-CSF plasmid construction is as follows: obtain the GM-CSF gene of home mouse, further transform on pBud-Dse double-promoter secretion expression carrier basis.Extracting RNA from the histocyte of mouse, counter-rotating cDNA, the GM-CSF gene of specific amplification erasure signal peptide-coding sequence, big or small 375bp utilizes restriction enzyme PstI and BamHI to be cloned in the reading frame of CMV promoter regulation.Detect the clone who separates by order-checking, confirming does not have mistake to bring into.
Wherein, the GM-CSF sequence among the pBud-Dse-GM-SCF following (SEQ ID NO:4):
GCACCCACCCGCTCACCCATCACTGTCACCCGGCCTTGGAAGCATGTA
GAGGCCATCAAAGAAGCCCTGAACCTCCTGGATGACATGCCTGTCAC
ATTGAATGAAGAGGTAGAAGTCGTCTCTAACGAGTTCTCCTTCAAGA
AGCTAACATGTGTGCAGACCCGCCTGAAGATATTCGAGCAGGGTCTAC
GGGGCAATTTCACCAAACTCAAGGGCGCCTTGAACATGACAGCCAGC
TACTACCAGACATACTGCCCCCCAACTCCGGAAACGGACTGTGAAAC
ACAAGTTACCACCTATGCGGATTTCATAGACAGCCTTAAAACCTTTCT
GACTGATATCCCCTTTGAATGCAAAAAACCAGTCCAAAAATGA
The amplimer sequence:
F：5’AACTGCAGGGCACCCACCCGCTCACC?3’(SEQ?ID?NO：5)；
R：5’CGGGATCCTTTTTGGACTGGTTTTTT?3’(SEQ?ID?NO：6)。
The pBirA-N plasmid is a kind ofly can make the biotinylated carrier for expression of eukaryon of foreign protein specific site in mammalian cell, and this carrier is the further transformation on the pBudCE4.1 basis.With vitamin H ligase enzyme BirA (aminoacid sequence GI:49175990), carry out codon optimized, the sequence after the optimization such as Fig. 2 (SEQID NO:7).966 bases of BirA full length gene, 234 bases are changed.The synthetic BirA gene of optimizing of full gene is connected in the reading frame of pBudCE4.1 support C MV promoter regulation by restriction enzyme BamHI and HindIII digestion.Detect the clone who separates by order-checking, confirming does not have mistake to bring into.
The small peptide label A viTag (MAGLNDIFEAQKIEWHE (SEQ ID NO:8)) that provides 17 amino-acid residues to form, upper by biotin molecule of BirA enzyme connection at lysine residue (K).The sequence (ATGGCCGGCCTGAACGACATCTTCGAGGCCCAGAAGATCGAGTGGCACGAG (SEQ ID NO:9)) of the synthetic one section N end of full gene coding avi label and the sequence of Flag sequence label (ATGGACTACAAGGACGACGACGACAAGCTGAAG (SEQ ID NO:10)) and multiple clone site, and this fragment gene codon is optimized to be beneficial to expression, such as Fig. 3.Be connected in the hEF1 α promoter regulation reading frame of the pBudCE4.1 carrier that includes the BirA encoding gene by restriction enzyme NotI and BglII digestion.Interested gene clone is on the multiple clone site of Avi label back, and the transient transfection mammal cell line can obtain the target protein of the specific site vitamin H of intracellular expression.
The foundation of embodiment 2, eucaryotic organism elementization system
1, hantaan virus HNTV type Nucleocapsid protein P (N holds 1-119aa)-PUUV type (N holds 1-119aa) eucaryotic organism elementization expression vector establishment
Hantaan virus HNTV type Nucleocapsid protein P (N holds 1-119aa)-PUUV (N holds 1-119aa) adopts full gene synthetic, is connected on the pBirA-N carrier in the interested gene clone site by restriction enzyme KpnI and BglII.With same method, this gene fragment is connected in the Pbudce4.1 carrier, as the negative control plasmid.
HNTV (N holds 1-119aa)-PUUV (N holds 1-119aa) gene order following (SEQ ID NO:1):
GAATTCATGGCAACTATGGAGGAATTACAGAGGGAAATCAATGCCCATGAGGGTCAATTAGTGATAGCCAGGCAGAAGGTGAGGGATGCAGAAAAACAGTATGAAAAGGATCCAGATGAGTTGAACAAGAGAACATTAACTGACCGAGAGGGCGTTGCAGTATCTATCCAGGCAAAAATTGATGAGTTAAAAAGGCAACTGGCAGATAGGATTGCAACTGGGAAAAACCTTGGGAAGGAACAAGATCCAACAGGGGTGGAGCCTGGAGACCATCTGAAAGAGAGGTCAATGCTCAGTTATGGTAATGTGCTGGATTTAAACCATTTGGATATTGATGAACCTACAGGACAGACAGCAGACTGG
ATGAGTGACTTGACAGACATCCAAGAGGAGATAACCCGCCATGAGCAACAACTTGTTGTTGCCAGACAAAAACTCAAGGATGCAGAGAGAGCAGTGGAAGTGGACCCGGATGACGTTAACAAAAACACACTACAAGCAAGGCAACAAACAGTGTCAGCATTGGAGGATAAACTCGCAGACTACAAGAGAAGAATGGCAGATGCTGTGTCCCGGAAAAAAATGGATACTAAGCCTACTGACCCGACTGGGATCGAACCTGATGATCATCTCAAGGAGAGATCAAGCCTTAGATATGGAAATGTCCTTGATGTAAATGCCATTGACATCGAAGAACCAAGTGGTCAGACAGCAGATTGG
CTCGAG
In the above-mentioned sequence, two ends respectively arrange a restriction endonuclease sites (underscore sign), the base that has comprised 15bp between hantaan virus HNTV type Nucleocapsid protein P (N holds 1-119aa) encoding sequence and PUUV type (N the holds 1-119aa) encoding sequence is used for coding flexible peptide linker (Gly)
5(square frame sign).
The restructuring pBirA-N plasmid called after pBirA-N-HNTV-PUUV that contains HNTV (N holds 1-119aa)-PUUV (N holds 1-119aa) encoding gene; The restructuring pBudce4.1 plasmid called after pBudce4.1-N-HNTV-PUUV (1-119aa) that will contain HNTV (N holds 1-119aa)-PUUV (N holds 1-119aa) encoding gene.With this Plasmid Transformation Trans10 competent escherichia coli cell (Beijing Quanshijin Biotechnology Co., Ltd, article No.: CD101-02), cultivate.Picking positive colony order-checking, to the checking of comparing of the Avitag label on purpose reading frame and the carrier, sequencing result is correct, a large amount of extracting plasmids, the removal intracellular toxin, OD260 measures concentration.
2, the expression of antigen and biotinylation
By liposome (available from Invitrogen company) method transient transfection 293T cell, carry out expression and the biotinylation of antigen HNTV (N holds 1-119aa)-PUUV (N holds 1-119aa).
(1) transfection the day before yesterday is with 1.2 * 10
6Cell is inoculated in the 60mm Tissue Culture Dish.
(2) 37 ℃ of 5%CO
2Cell culture incubator in cultivate 24h, cover with to 80-90%.
(3) reagent preparation:
The pBirA-N-HNTV-PUUV that adds 8 μ g among the Solution A:500 μ l Opti-MEM;
The liposome that adds 20 μ l among the Solution B:500 μ l Opti-MEM;
Solution B leaves standstill 5min in room temperature.
(4) mix Solution A and Solution B, gentleness is put upside down mixing, and room temperature is placed 20mins.
(5) above-mentioned mixed solution adds 1ml Opti-MEM, adds the 60mm ware behind the mixing.
(6) 37 ℃ of 5%CO
2Cell culture incubator in cultivate 6h.
(7) above-mentioned nutrient solution changes the nutrient solution that contains serum into.Serum free culture system liquid adds the vitamin H mixing in advance, and final concentration is 100 μ m.
(8) 37 ℃ of 5%CO
2Cell culture incubator cultivate 48h.
(9) lysing cell.Sop up cell conditioned medium stoste, wash cell twice with the 1 * PBS (PH=7.4) of 1ml precooling, that tries one's best removes not combined vitamin H.Add the cell pyrolysis liquid (precooling adds PMSF, final concentration 1mM) of 500-1000 μ l, mixing was placed 5-10 minute on ice.Wipe cell off with the cell sleaker, the collecting cell lysate is put in the centrifuge tube, and 4 ℃ of centrifugal 10mins of 10000g draw supernatant-20 ℃ packing and preserve, and the antigen HNTV of expression (N holds 1-119aa)-PUUV (N holds 1-119aa) is included in the supernatant.In addition, for follow-up checking, with the parallel transfection pBudce4.1-N-HNTV-PUUV of identical method (1-119aa) plasmid, collecting cell lysate supernatant.
3, Western Blot checking albumen is given birth to plainization situation in eukaryotic cell
Supernatant is got in the respectively cracking of the cell of the cell of 293T non-transfected cells, transient transfection pBirA-N-HNTV-PUUV, transfection pBudce4.1-N-HNTV-PUUV (1-119aa), and each 10 μ l adds the loading damping fluid, boil, loading adds sample-loading buffer, the SDS electrophoresis, transferring film, sealing after the washing, adds the Streptavidin of HRP mark, hatch, develop.Only have transfection as can be drawn from Figure 4 the cell of pBirA-N-HNTV-PUUV could be with HNTV (N holds 1-119aa)-PUUV (N holds 1-119aa) Biotin.Therefore, the inventor has successfully set up eucaryotic organism elementization system.
The structure of embodiment 3, dna vaccination and inoculation method
1, dna vaccine vector makes up
Amplification HNTV (N holds 1-119aa)-PUUV (N holds 1-119aa) coding gene sequence is inserted into dna vaccination combination carrier pBud-Dse-GM-SCF with among KpnI and the BglII with extension increasing sequence.Subsequently, to connect product and transform bacillus coli DH 5 alpha, choose mono-clonal behind 37 ℃ of cultivation 12-16h, take bacterium liquid as template, gene primer specific amplification goal gene, PCR product carry out the band that the goal gene size appears in nucleic acid electrophoresis and are decided to be positive colony, PCR rear electrophoresis result shows, HNTV (N holds 1-119aa)-PUUV (N holds 1-119aa) encoding gene has clear band at the 900bp place, and is consistent with the purpose stripe size, and it is entirely true to check order.Therefore, inventor's success constructed dna vaccine carrier, called after pBud-Dse-GM-SCF-HNTV-PUUV, it can be directly as dna vaccination.
2, mouse immune dna vaccination
The invention provides with dna vaccination and induce individual method for certain antigen, comprised the step that gives individual certain plasmid.
4-6 BALB/c female mice in age in week, carry out intramuscular injection in mouse two back leg upper arm musculus quadriceps, every injected in mice 100 μ l dna vaccination mixing solutionss, pBud-Dse-GM-SCF-HNTV-PUUV in the mixing solutions (80 μ g dna vaccinations are dissolved in 100 μ l PBS).With alcohol wipe injected in mice position, can see the skin of injected area clearly before the injection; Perhaps shave off the hair of injected area, so that skin surface exposes, be beneficial to injection.During injection, keep the planar section of pin hole outwardly, slowly push vaccine, then 90-degree rotation is slowly extracted, and prevents that vaccine from leaking into the outside, and every back leg is injected 50 μ l vaccine mixing solutionss.After the injection, use the electrode of 5mm distance at once, the muscle that inserts injected area in the pin hole both sides shocks by electricity, and voltage is 100v, and duration is 50ms, carries out altogether 5 pulses.The electric shock instrument is Electro Square Porator T830M (BTX, San Diego, CA).Every 3 week immunity 1 time, immunity is 3 times altogether.
3, the ELISA method based on streptavidin SA detects mouse blood serum special antibody
(1) the coated concentration of streptavidin SA determines
Gradient is coated with streptavidin SA, and package amount changes from 0-40 μ g/ml, spends the night in 100 μ l/ holes, 4 ℃, and after the washing, mass volume ratio 2%BSA (PBST solution dilution) sealing after the washing, adds biotin labeled HRP (available from R﹠amp; D), hatch 1h after, the washing, add substrate, the colour developing, data processing.
Result such as Fig. 5 can find out that therefrom the saturation concentration scope of Streptavidin at 20-40 μ g/ml, in order to save albumen, adopts the coated concentration of 20 μ g/ml.
(2) the cell pyrolysis liquid optimum dilution degree determines
4 ℃ of coated streptavidins that spend the night, coated concentration 20 μ g/ml, 100 μ l/ holes, seal with mass volume ratio 4%BSA (PBST solution dilution) after the washing, the lysis stoste (referring to " 2 " among the embodiment 2) that contains biotinylation HNTV (N holds 1-119aa)-PUUV (N holds 1-119aa) albumen is diluted with PBS, extension rate is respectively 10 from high to low, 31.6,100,316,1000,3160,10000,31600 times of totally 8 gradients, join in the micropore, 100 μ l/ holes, after hatching, washing, the mice serum that adds the dna vaccination immunity, the goat anti-mouse igg (washing one's hair bio tech ltd available from upper marine section English) that adds again the HRP mark, colour developing, reading.Processing data.
Result such as Fig. 6, the saturated extension rate of visible cell lysate is between 316-1000.
(3) detect the titre of dna immunization mice serum based on the ELISA method of streptavidin SA
(1) coated streptavidin SA, 20 μ g/ml, 100 μ l/ holes, 4 ℃ of placements are spent the night.
(2) add 3%BSA (37 ℃ of sealings of PBST dilution 2h) after the washing.
(3) add the lysis stoste that contains biotinylation HNTV (N holds 1-119aa)-PUUV (N holds 1-119aa) albumen after the washing, 1:300 doubly dilutes, and 1-2mins is shaken at shaking table in 100 μ l/ holes, fully mixing.Hatch 45mins-1h for 37 ℃.
(4) after the washing, the dna vaccination mice serum is done the dilution of a series of gradients, and 2h is hatched for 37 ℃ in 100 μ l/ holes.
(5) after the washing, add two and resist, 1000 times of the how anti-dilutions of sheep anti-mouse igg (H+L), 1h is hatched for 37 ℃ in 100 μ l/ holes.
(6) add enzyme reaction substrate, 100 μ l/ holes, 2M sulfuric acid termination reaction after the washing.
(7) reading, disposal data.
Result such as table 1, the antibody of the high titre that as seen in mice serum, obtains.
Antibody titers after table 1, for the third time dna vaccination immunity in the mice serum
As a result, adopt dna vaccination immunization method provided by the invention, the serum antibody titer of mouse is more than 10000.
The fusion of embodiment 4, hybridoma and clone
1, cell is prepared
Myeloma cell's preparation: collect through the garbled murine myeloma cell NS-1 of 8-anaguanine, SP2/0 (all washing one's hair bio tech ltd available from upper marine section English), the microscopically observation of cell is active, count behind the cell washing of the logarithmic proliferation phase that activity is good, cell suspension is for subsequent use in the DMEM nutrient solution.
The preparation of feeder layer cells: merge the day before yesterday, 5ml DMEM nutrient solution is injected mouse peritoneal, rock gently rear extraction peritoneal fluid, centrifugal, counting, adjusting cell concn is 1 * 10
5/ ml is inoculated in 96 well culture plates, 50 μ l/ holes.
The preparation of spleen cell: dissect mouse behind dna vaccination (pBud-Dse-GM-SCF-HNTV-PUUV) booster immunization utilize aforementioned preparation, get spleen, disperse splenocyte with mechanical process, get splenocyte suspension through strainer filtering, counting after the washing of DMEM nutrient solution.
2, cytogamy
Get 1 * 10
7Myeloma cell's (NS-1 or SP2/0 cell) and 5 * 10
7Mouse boosting cell (in 1: 5 ratio) is mixed in the 50ml centrifuge tube, adds serum-free medium, and centrifugal, 1500rpm 3 minutes, abandons supernatant.The loose sedimentation cell that shakes dropwise adds 50%PEG 1ml, and the limit edged rocks, and adds in 1 minute.Left standstill 90 seconds, and allowed PEG continuation effect.Then in 2.5 minutes, dropwise add the serum-free medium 10ml of 37 ℃ of pre-temperature, left standstill 5 minutes, stop the effect of PEG.Cell suspension is centrifugal after merging, 1000rpm, 3 minutes.Abandon supernatant, sedimentation cell is beaten even gently, adds the 25ml complete culture solution, is inoculated in 96 orifice plates that are added with feeder layer cells 50 μ l/ holes, every hole 2 * 10
4The myeloma cell.Put 37 ℃, 5%C0
2Cultivate in the incubator.Second day adds the complete culture solution of 2 * HAT, and 100 μ l/ holes make that final concentration is 1 * HAT in the hole in, kill the not myeloma cell of fusion.
3, filtering hybridoma
(1) foundation of ELISA detection method
Establishment method is with reference to " 3 " among the embodiment 3.
It is coated in 96 orifice plates that Streptavidin albumen is diluted to 40 μ g/ml with the ELISA coating buffer, 100 μ l/ holes.After the diluent sealing, add biotinylation HNTV (N holds 1-119aa)-PUUV (N holds 1-119aa) protein cleavage diluent (the lysis stoste of biotinylation HNTV (N holds 1-119aa)-PUUV (N holds 1-119aa) albumen is diluted with PBS), hatch rear washing and remove foreign protein, add and treat Hybridoma Cell Culture supernatant in the gaging hole, add simultaneously positive, negative control, positive control is the rear mice serum of the immunity of diluting, and negative control is fresh medium.Add subsequently the goat anti-mouse igg antibody (ELIAS secondary antibody) of HRP enzyme labelling, use TMB-H behind the incubation
2O
2Colour developing was reacted after 10 minutes, added 2mol/L H
2SO
4Termination reaction is surveyed the OD value with wavelength 450nm.
(2) hybridoma of the screening monoclonal antibody positive
Merged rear about 10 days, and when treating that the hybridoma colony grows at the bottom of the hole 1/5 area, namely used the ELISA method screening fused cell antibody positive hole of aforementioned (1).
(3) hybridoma cell clone
Select the high hole of antibody positive and titre with limiting dilution assay wherein hybridoma to be carried out cloning, generally be diluted to 1 cells/well.When treating cell cultures to 20% plate floorage, draw cells and supernatant and use the again positive hole of screening antibodies of ELISA method.If continuous 3 time clonings, each cloning efficiency less than 2/3 and positive rate all be 100%, the cell of acquisition is mono-clonal like this.
Table 2,11 strain monoclonal antibody fusion rate and positive rates
Characteristic measurement such as the table 3 of 11 strain monoclonal antibodies.
The characteristic of table 3, anti-Chinese beach NP protein monoclonal antibody
With reference to the detection method that provides in Wan Tai company hantaan virus (84Fli strain and L99 strain) the IgG antibody assay kit (HFRS-IgG ELISA), the inventor has verified the recognition capability of 11 strain antibodies for hantaan virus NP albumen total length.
Result such as Fig. 7, as seen, 5 strain antibodies (OD is greater than 0.5) wherein can be identified the NP full-length proteins of Chinese epidemic isolates HNTV-84Fli.
The monoclonal antibody of embodiment 6, anti-human NGAL
Adopt as front same method, difference is antigen is replaced with human neutrophil genatinase associated lipocalin (67-600 position among the GenBank accession number EU644752 of its encoding gene).As a result, prepared the monoclonal antibody of the anti-human NGAL of 7 strains.
With reference to the detection method that provides in the hantaan virus IgG of the Wan Tai company antibody assay kit (euzymelinked immunosorbent assay (ELISA)), the inventor has verified the recognition capability of 7 strain antibodies for natural NGAL antigen (its aminoacid sequence is referring to 20-198 position among the GenBank accession number GenBank:CAA67574.1).
Result such as Fig. 8, this 7 strain antibody all can be identified natural NGAL antigen.
To sum up, adopt the novel method of preparation monoclonal antibody provided by the invention, successfully prepare the monoclonal antibody of the anti-Chinese of 11 strains beach NP albumen (N holds 1-119aa).The inventor adopts to use the same method and has prepared the monoclonal antibody of the anti-human NGAL of 7 strains, all can identify natural NGAL antigen.
All quote in this application as a reference at all documents that the present invention mentions, just as each piece document is quoted separately as a reference.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (13)
1. method of screening monoclonal antibody comprises:
(1) provide construction 1, this construction 1 comprises: expression cassette 1, and it comprises promotor 1, vitamin H ligase enzyme BirA encoding gene, terminator 1; With expression cassette 2, it comprises promotor 2, AviTag encoding gene, antigen encoding gene, terminator 2;
With construction 1 transfection mammalian cell, express obtaining biotinylated antigen, lysing cell obtains to contain the lysate of biotinylated antigen;
(2) provide construction 2, this construction 2 comprises: expression cassette 3, and it comprises promotor 3, signal peptide encoding gene, GM-CSF encoding gene, terminator; With expression cassette 4, it comprises promotor 4, signal peptide encoding gene, antigen encoding gene;
With construction 2 immune Mammalss, get the Mammals spleen cell and prepare hybridoma;
(3) lysate that contains biotinylated antigen that step (1) is obtained contacts with the solid phase carrier that is coated with avidin, thereby biotinylated antigen is fixed in solid phase carrier; Screen the antibody of the hybridoma secretion of step (2) acquisition with this biotinylated antigen, obtain the monoclonal antibody of the anti-described antigen of specificity.
2. method for preparing biotinylated antigen comprises:
Construction 1 is provided, and this construction 1 comprises: expression cassette 1, and it comprises promotor 1, vitamin H ligase enzyme BirA encoding gene, terminator 1; With expression cassette 2, it comprises promotor 2, AviTag encoding gene, antigen encoding gene, terminator 2;
With construction 1 transfection mammalian cell, express obtaining biotinylated antigen.
3. the method for a Dispersal risk, comprising: construction 2 is provided, and this construction 2 comprises: expression cassette 3, it comprises promotor 3, signal peptide encoding gene, GM-CSF encoding gene, terminator; With expression cassette 4, it comprises promotor 4, signal peptide encoding gene, antigen encoding gene;
With construction 2 immune Mammalss, obtain mammiferous immune serum, comprising the polyclonal antibody of anti-described antigen; Or with construction 2 immune Mammalss, obtain mammiferous spleen cell, the preparation monoclonal antibody.
4. method of tiring of assessing antibody comprises:
Construction 1 is provided, and this construction 1 comprises: expression cassette 1, and it comprises promotor 1, vitamin H ligase enzyme BirA encoding gene, terminator 1; With expression cassette 2, it comprises promotor 2, AviTag encoding gene, antigen encoding gene, terminator 2;
With construction 1 transfection mammalian cell, express obtaining biotinylated antigen, lysing cell obtains to contain the lysate of biotinylated antigen;
The lysate that contains biotinylated antigen that obtains is contacted with the solid phase carrier that is coated with avidin, thereby biotinylated antigen is fixed in solid phase carrier; Assess the tiring of antibody of anti-this antigen of specificity with this biotinylated antigen.
5. such as the arbitrary described method of claim 1-4, it is characterized in that, in the expression cassette 1, between promotor 1 and vitamin H ligase enzyme BirA encoding gene, also comprise the KOZAK gene; Or
In the expression cassette 2, between promotor 2 and AviTag encoding gene, also comprise KOZAK gene and/or purification tag encoding gene; Or
In the expression cassette 3, between promotor 3 and signal peptide encoding gene, also comprise the KOZAK gene; Or
In the expression cassette 4, between promotor 4 and signal peptide encoding gene, also comprise the KOZAK gene.
6. such as the arbitrary described method of claim 1-4, it is characterized in that described vitamin H ligase enzyme BirA encoding gene has the nucleotide sequence shown in the SEQ ID NO:7; Or.
Described AviTag has the nucleotide sequence shown in the SEQ ID NO:9; Or
Described GM-CSF encoding gene has the nucleotide sequence shown in the SEQ ID NO:4; Or
Described signal peptide is people IgE heavy chain signal peptide; More preferably, described IgE heavy chain signal peptide has the nucleotide sequence shown in the 16-69 position among the SEQ ID NO:3; Or
Described KOZAK gene has SEQ ID NO: in the nucleotide sequence shown in the 7-15 position; Or
Described purification tag is the Flag label; More preferably, described Flag label coding gene has the nucleotide sequence shown in the SEQID NO:10.
7. such as the arbitrary described method of claim 1-4, it is characterized in that described antigen is to stimulate immune system to make it to produce specific immune response, and the material of specific binding can occur in vivo and in vitro with corresponding immunne response product; Preferably, described antigen is selected from: viral protein, bacterioprotein; More particularly, described viral protein comprises: the albumen in hantaan virus source, the albumen of ripple horse traction viral source, the albumen in influenza virus source, the albumen in avian influenza virus source, the albumen in simplexvirus source, the albumen in Pestivirus suis source, the albumen in flavivirus source, the albumen in hepatitis B virus source, the albumen in respiratory syncytial virus source; Described bacterioprotein comprises: the albumen in helicobacter pylori source, the albumen in candidiasis source, the albumen in plague bacillus source, the albumen in cholera bacteria source.
8. dna vaccination comprises: expression cassette 3, and it comprises promotor 3, signal peptide encoding gene, GM-CSF encoding gene, terminator; With expression cassette 4, it comprises promotor 4, signal peptide encoding gene, antigen encoding gene.
9. the purposes of dna vaccination claimed in claim 8 is for the preparation of stimulating immune system to make it to produce the composition of specific antibody.
10. construction that is used for biotinylated antigen, it comprises: expression cassette 1, it comprises promotor 1, vitamin H ligase enzyme BirA encoding gene, terminator 1; With expression cassette 2, it comprises promotor 2, AviTag encoding gene, antigen encoding gene, terminator 2.
11. the purposes of construction claimed in claim 10 is for the preparation of biotinylated antigen.
12. a test kit a, comprising:
Construction 1, this construction 1 comprises: expression cassette 1, it comprises promotor 1, vitamin H ligase enzyme BirA encoding gene, terminator 1; With expression cassette 2, it comprises promotor 2, AviTag encoding gene, antigen encoding gene, terminator 2; And/or
Construction 2, this construction 2 comprises: expression cassette 3, it comprises promotor 3, signal peptide encoding gene, GM-CSF encoding gene, terminator; With expression cassette 4, it comprises promotor 4, signal peptide encoding gene, antigen encoding gene.
13. a test kit b, comprising:
Construction 1, this construction 1 comprises: expression cassette 1, it comprises promotor 1, vitamin H ligase enzyme BirA encoding gene, terminator 1; With expression cassette 2, it comprises promotor 2, AviTag encoding gene, is used for inserting multiple clone site, the terminator 2 of antigen encoding gene; And/or
Construction 2, this construction 2 comprises: expression cassette 3, it comprises promotor 3, signal peptide encoding gene, GM-CSF encoding gene, terminator; With expression cassette 4, it comprises promotor 4, signal peptide encoding gene, is used for inserting the multiple clone site of antigen encoding gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210130232 CN103374068A (en) | 2012-04-27 | 2012-04-27 | Preparation method and application of novel monoclonal antibody |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 201210130232 CN103374068A (en) | 2012-04-27 | 2012-04-27 | Preparation method and application of novel monoclonal antibody |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103374068A true CN103374068A (en) | 2013-10-30 |
Family
ID=49459949
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 201210130232 Pending CN103374068A (en) | 2012-04-27 | 2012-04-27 | Preparation method and application of novel monoclonal antibody |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103374068A (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103694358A (en) * | 2013-12-26 | 2014-04-02 | 潍坊医学院 | Locus specificity biotin labeled recombinant IgG (Intravenous Gamma Globulin) affine peptide and application thereof in IgG antibody three-dimensional oriented fixation |
| CN110982839A (en) * | 2019-12-25 | 2020-04-10 | 上海药明生物技术有限公司 | Method for biotin labeling protein at cellular level |
-
2012
- 2012-04-27 CN CN 201210130232 patent/CN103374068A/en active Pending
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103694358A (en) * | 2013-12-26 | 2014-04-02 | 潍坊医学院 | Locus specificity biotin labeled recombinant IgG (Intravenous Gamma Globulin) affine peptide and application thereof in IgG antibody three-dimensional oriented fixation |
| CN103694358B (en) * | 2013-12-26 | 2015-12-02 | 潍坊医学院 | Locus specificity biotin labeling restructuring IgG affinity peptide and the application fixed at three-dimensional orientation in IgG antibody thereof |
| CN110982839A (en) * | 2019-12-25 | 2020-04-10 | 上海药明生物技术有限公司 | Method for biotin labeling protein at cellular level |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111234036B (en) | African swine fever virus p72 fusion protein and preparation method and application thereof | |
| CN103328649B (en) | For improving the protein expression of recombinase and other albumen and the signal sequence of the new of secretion | |
| CN112209995B (en) | Preparation method of SARS-CoV-2 surface protein receptor binding region | |
| JP2009529868A5 (en) | ||
| CN110041411B (en) | Stable atypical swine fever virus subunit protein, vaccine, preparation method and application thereof | |
| CN112390863B (en) | Modified new coronavirus Spike protein extracellular domain and application thereof | |
| CN117466990A (en) | Recombinant human XVII type collagen and preparation method and application thereof | |
| CN101245106B (en) | Anti-VRGF acceptor monoclone antibody, preparation method and application thereof | |
| Koller et al. | Recombinant Streptomyces lividans secretes a fusion protein of tendamistat and proinsulin | |
| CN103374068A (en) | Preparation method and application of novel monoclonal antibody | |
| US9957307B2 (en) | Expression vectors for cell-surface expression of polypeptides comprising a transmembrane domain of glycophorin A | |
| CN109758590B (en) | Method for screening human prostate cancer tumor antigen epitope peptide | |
| CN103360497A (en) | Novel antitumor fusion protein vaccine, and preparation method and application thereof | |
| CN110872354B (en) | Chicken-derived monoclonal antibody and single-chain antibody of mammal cell recombinant anti-human TK1, and preparation method and application thereof | |
| CN107686519B (en) | Preparation method and application of anti-mouse MXRA7 monoclonal antibody | |
| CN114181314B (en) | Nanobody for screening high-expression-level cell lines, method and kit | |
| US20220195442A1 (en) | Protein Engineering via Error-Prone Orthogonal Replication and Yeast Surface Display | |
| CN104974226A (en) | Signal peptide for protein expression | |
| CN112251444A (en) | Modified AMH gene sequence and method for preparing AMH by using same | |
| CN102766202B (en) | PHF14 C-terminal protein, its polyclonal antibody and application thereof | |
| CN103626869B (en) | A kind of method preparing sheep MSTN gene monoclonal antibody vaccine | |
| CN108753734B (en) | Anti-tree shrew CD8 molecular monoclonal antibody, hybridoma cell strain secreting antibody and application | |
| CN107034198A (en) | A kind of chimeric norovirus P particles and its preparation and application | |
| CN117106728A (en) | Hybridoma cell strain 769H4, monoclonal antibody secreted by same and application thereof | |
| CN112250768A (en) | Bovine parainfluenza virus recombinant antigen and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20131030 |