CN103361379A - Construction, screening and application of shRNAs expression vector of lung cancer targeted CHRNA5 gene - Google Patents
Construction, screening and application of shRNAs expression vector of lung cancer targeted CHRNA5 gene Download PDFInfo
- Publication number
- CN103361379A CN103361379A CN2013102853396A CN201310285339A CN103361379A CN 103361379 A CN103361379 A CN 103361379A CN 2013102853396 A CN2013102853396 A CN 2013102853396A CN 201310285339 A CN201310285339 A CN 201310285339A CN 103361379 A CN103361379 A CN 103361379A
- Authority
- CN
- China
- Prior art keywords
- chrna5
- shchrna5
- plasmid
- oligonucleotide
- pllu2g
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention relates to construction, screening and application of a shRNAs expression vector of a lung cancer targeted CHRNA5 gene. A RNA (Ribonucleic Acid) interference technique is utilized, and two expression plasmids CHRNA5-shRNA1/2 capable of expressing shRNA in mammalian cells are constructed by aiming at different target sequences of the CHRNA5 gene and taking pLLU2G as a vector. The shRNAs expression vector of the lung cancer targeted CHRNA5 gene is capable of efficiently and specifically inhibiting CHRNA5 gene expression, and is used for preparing gene medicaments for treating lung cancers with high-expression CHRNA5 genes.
Description
Technical field
The present invention relates to express CHRNA5(cholinergic receptor nicotinic alpha5) gene therapy medicament of the lung cancer of gene, be specifically related to the shRNAs expression vector of lung cancer-targeted CHRNA5 gene structure, the screening and uses thereof, belong to the biological medicine technology field.
Background technology
Lung cancer is a kind of common pulmonary malignant tumour, and its mortality ratio accounts for first of the cancer mortality.Nicotine in the tobacco is one of most important carcinogenic factor that causes the lung cancer generation of generally acknowledging, but its exact mechanism is not yet clear.NAChR (Nicotinic Acetylcholine Receptor, nAChR) signal pathway is one of focus of in recent years lung cancer target research.2008, three independent molecule epidemiological studies on Nature and the Nat Genet are reported in succession, it is closely related to be positioned at the variation of the long-armed nAChR gene cluster CHRNA5/A3/B4 of No. 15 karyomit(e) and lung cancer and cigarette smoking, wherein, the CHRNA5 gene of coding for alpha 5-nAChR occurs particularly relevant with lung cancer.We find early-stage Study, α 5-nAChR high expression level in cancerous lung tissue, and propagation, adhesion and migration with the short lung carcinoma cell of Nicotine, show that tentatively the α 5-nAChR lung cancer relevant with tobacco occurs closely related, referring to CHRNA5Variants Related to Nicotine Sensitivity in Lung Cancer in Vitro.BMEI'10,2010.
Research in recent years confirms, the epithelial cell of the many cells of whole body such as lymphocyte, scavenger cell, dendritic cell, adipocyte, keratinocyte, endotheliocyte and enteron aisle and lung is all expressed nAChR, and the rise of nAChR or downward modulation can produce physiological effect to cardiovascular systems, respiratory system, endocrine system and central nervous system.Nicotine is combined with the nAChRs on lung carcinoma cell surface receptor protein, promotes propagation, migration, invasion and attack and the neonate tumour blood vessel of lung carcinoma cell; Apoptosis-induced suppressor gene suppresses Increase Apoptosis of Lung Cancer Cells simultaneously.Nicotine is based on nAChRs in the extensive distribution of pulmonary epithelial cells to the various effects of respiratory system, but the Main Function subunit of nAChRs in different effect it be unclear that, full genome related (GWAS) is analyzed to wait and be studies show that, the CHRNA5 genovariation of coding for alpha 5-nAChR and lung cancer occur closely related, α 5-nAChR and smoking dependency lung cancer have specificity, and CHRNA5 may be the candidate gene that lung cancer occurs.The research report, the expression of CHRNA5mRNA in adenocarcinoma of lung is higher than normal lung tissue, and the expression of CHRNA5 is relevant with its genovariation, shows that CHRNA5 may play an important role in the process that lung cancer occurs.The nicotine content that absorbs with the experimental mouse of CHRNA5 genovariation shows that apparently higher than normal experimental mouse CHRNA5 effect gene body is to the absorption of Nicotine.By the expression of blocking-up CHRNA5 in lung carcinoma cell, and then affecting its biological activity, may be the New Policy for the treatment of high expression level CHRNA5 lung cancer simultaneously in conjunction with other treatment means.
ShRNA: little hair fastener or ShorthairpinRNA (a small hairpin RNA or shorthairpin RNA, shRNA) are one section RNA sequences with tight hair fastener ring (tight hairpin turn), often are used to the expression that RNA disturbs reticent target gene.Utilize carrier the shRNA transfered cell, the U6 promotor in the carrier guarantees that shRNA always expresses; Loaded the shRNA carrier and can be passed in the daughter cell and go, thereby made the silence of gene can be by heredity.The hairpin structure of shRNA can be cut into siRNA by cell mechanism, and then siRNA is attached to RNA and induces (RNA-induced silencing complex, RISC) on the reticent mixture, and this mixture can be attached to purpose mRNAs and with its degraded.
RNA interference effect molecule siRNA (small interfering RNA, siRNA) can induce silencing complex (RNA-induced silencing complex with RNA, RISC) combination, slough a chain, then with RISC together with said target mrna on corresponding base sequence pairing combination.Under the RISC effect, specificity degraded target gene mRNA, 3 ' terminal sequence is degraded by enzymes in tenuigenin, and the complex body of siRNA and RISC breaks away from destroyed said target mrna, continues to cut other said target mrna.5 ' remaining end generates complementary strand under RNA RNA-dependent polymerase (RNA-dependent RNA polymerase, RdRP) effect, newborn dsRNA can generate more siRNA under the effect of Dicer enzyme, continues to induce said target mrna reticent.So circulation generally can be kept 96-120 hour or 3-4 cell cycle so that within for some time, the protein expression of target mRNA is suppressed.The discoveries such as recent Brummelkamp are by expressing the plasmid of siRNA to cytoduction, kept 2 months with can making the RNA interference stability, referring to Brummelkamp T R, Bernards R, Agami R.A system for stable expression of short interfering RNAs in mammalian cells.Science, 2002,296 (5567) 550-553.
Tumour is multigenic disease, disturbs at field of gene RNA to be particularly suitable for certain Overexpression or because the disease due to the vivo mutations genetic expression.Utilize RNA to disturb the correlation technique can be for the proto-oncogene that in cell carcinogenesis, plays a significant role, cancer suppressor gene, apoptosis-related genes, somatomedin and acceptor thereof and part key enzyme etc.; the overexpression of mutation inhibiting genetic expression or gene under the prerequisite that does not affect the normal gene function, thus reach the purpose for the treatment of tumour.
Summary of the invention
The present invention is directed to the deficiencies in the prior art, provide a kind of lung cancer target CHRNA5 gene the shRNAs expression vector establishment, the screening and uses thereof.
The term explanation:
The CHRNA5 gene, cholinergic receptor nicotinic alpha5, refer to Nicotine acetylcholine receptor alpha 5 genes, the α 5-Nicotine acetylcholine receptor of its coding (α 5-nicotinic acetylcholine receptor, α 5-nAChR).The molecule epidemic disease-ology research report, it is closely related to be positioned at the variation of the long-armed nAChR gene cluster CHRNA5/A3/B4 of No. 15 karyomit(e) and lung cancer and cigarette smoking, wherein, the CHRNA5 gene of coding for alpha 5-nAChR is particularly relevant with the lung cancer generation, is one of focus of in recent years lung cancer target research.
The pLLU2G carrier is a kind of expression vector, uses restriction endonuclease to cut out the end that is harmonious with goal gene, adopts dna ligase to connect, and transfered cell is realized expressing.
The present invention to be to utilize the RNA interference technique as main, for the different target sequences of CHRNA5 gene, made up two energy are expressed shRNA in mammalian cell expression plasmid pLLU2G-shCHRNA5-1/2, hereinafter to be referred as CHRNA5-shRNA1/2.Its signal collection of illustrative plates is seen Fig. 1, can efficient specific inhibitions CHRNA5 genetic expression, can be used for preparing the genomic medicine of the lung cancer for the treatment of high expression level CHRNA5 gene.
Technical scheme of the present invention is as follows:
The shRNAs expression vector of target CHRNA5 gene, it is characterized in that take pLLU2G as carrier, for Nicotine acetylcholine receptor alpha 5(CHRNA5) two sections sequences of gene coding region, performance RNA interference effect in than the lung cancer cell line A549 of high expression level CHRNA5; Two sections CHRNA5 specific RNAs interfere target sequences to be respectively: 1. 5'-GTCTTCTATCTTCCTTCAAAT-3 ' originates in 1101; 2. 5'-GCAGGTGTTTAATGCCATTTA-3 ' originates in 3472, is for the therapeutic substance by CHRNA5 gene-correlation lung cancer, is made by following methods:
(1) design of the selection of RNA interference target sequence and insertion sequence is with synthetic
Two sections sequences of selection CHRNA5 gene coding region are 5'-GTCTTCTATCTTCCTTCAAAT-3 ' 1., and 2. 5'-GCAGGTGTTTAATGCCATTTA-3 ' designs and the external oligonucleotide sequence that synthesizes two pairs of complementations of difference, and sequence is as follows:
1. the shCHRNA5 oligonucleotide sequence 1:
Positive-sense strand:
5'-TGTCTTCTATCTTCCTTCAAATCTCGAGATTTGAAGGAAGATAGAAGACTTTTTC-3'
Antisense strand:
5'-TCGAGAAAAAGTCTTCTATCTTCCTTCAAATCTCGAGATTTGAAGGAAGATAGAAGACA-3'
2. the shCHRNA5 oligonucleotide sequence 2:
Positive-sense strand:
5'-TGCAGGTGTTTAATGCCATTTACTCGAGTAAATGGCATTAAACACCTGCTTTTTC-3’
Antisense strand:
5'-TCGAGAAAAAGCAGGTGTTTAATGCCATTTACTCGAGTAAATGGCATTAAACACCTGCA-3'
(2) synthetic oligonucleotide be connected with linear carrier pLLU2G respectively, the extraction of conversion, amplification and plasmid.
The a pair of shCHRNA5 oligonucleotide equivalent mixing of the sequence 1 that step (1) is synthetic, 95 ℃ of effects slowly were cooled to room temperature after 2 minutes, obtained the double chain oligonucleotide shCHRNA5-1 of combination;
The a pair of shCHRNA5 oligonucleotide equivalent mixing of the sequence 2 that step (1) is synthetic, 95 ℃ of effects slowly were cooled to room temperature after 2 minutes, obtained the double chain oligonucleotide shCHRNA5-2 of combination;
Then above-mentioned double chain oligonucleotide shCHRNA5-1, shCHRNA5-2 are connected with the pLLU2G plasmid vector respectively and obtain pLLU2G-shCHRNA5-1 or pLLU2G-shCHRNA5-2, be transformed into respectively at last the stb13 bacterium, the amoxicillin screening, select single bacterium colony and cultivate in a large number, extract plasmid DNA purification with plasmid extraction kit; The extraction purifying of plasmid operates according to the test kit specification sheets.
(3) evaluation of plasmid
With the plasmid DNA agarose gel electrophoresis that step (2) is extracted, to use primer pLLU2G-flank-f and pLLU2G-flank-r and carry out the PCR evaluation, concentration and the purity of plasmid DNA is measured in the ultraviolet spectrophotometer analysis, inserts the segment sequence verification.
What the present invention obtained is pLLU2G-shCHRNA5-1 and the pLLU2G-shCHRNA5-2 plasmid vector that contains the purpose fragment.
The application of the shRNAs expression vector of lung cancer target CHRNA5 gene of the present invention in the genomic medicine of the lung cancer of preparation treatment expression CHRNA5.
For to CHRNA5 gene shRNAs expression plasmid to the inhibition of CHRNA5 gene and the restraining effect of lung carcinoma cell is identified, the liposome transfection cell, extract total RNA, the RT-PCR method is measured the restraining effect to the CHRNA5mRNA expression level, and western blotting measures the impact that suppresses behind the CHRNA5 the CHRNA5 protein expression level.
Of the present invention is the therapeutant that can be used for high expression level CHRNA5 lung cancer for the gene constructed 2 kinds of shRNAs expression plasmids (pLLU2G-shCHRNA5-1 and pLLU2G-shCHRNA5-2) of CHRNA5, wherein the efficient of pLLU2G-shCHRNA5-1 inhibition lung carcinoma cell CHRNA5 expression is higher, can be used for further studying the function of CHRNA5 gene and carry out gene therapy research in experimental animals.
The preparation method of the shRNAs expression vector of lung cancer target CHRNA5 gene of the present invention and the evaluation of biologic activity mainly comprise following content:
One, the preparation of plasmid comprises design that RNA interferes the selection of target sequence and insert template with synthetic, with above-mentioned synthetic oligonucleotide be connected with linear carrier pLLU2G respectively, the extraction of conversion, amplification and plasmid DNA, the evaluation of plasmid.
Two, the evaluation of plasmid biologic activity comprises the calculating of transfection, the liposome transfection efficient of plasmid, expression, the western blotting(Western immunoblotting that RT-PCR detects the CHRNA5 gene) measure the impact that suppresses behind the CHRNA5 the CHRNA5 protein expression level.
The concrete operation method of each step among the preparation method of the shRNAs expression vector of the below's detailed description lung cancer target CHRNA5 gene of the present invention:
1.RNA the design and synthetic 25-27 Nucleotide along continuous two AA of mRNA sequence search and back interfering the selection of target sequence and insert template, by homology relatively, select with other any genes without the sequence of homology namely as potential siRNA target site (target site does not contain the identical sequence more than 3, and GC content is about 30%-50%).According to the explanation of support agent box, for the encoding sequence of CHRNA5 gene, for finding the target site with best reticent effect, choose two sections target sequences, select 2 qualified target sites from middle and upper reaches respectively, be respectively:
①CHRNA5-11101GTCTTCTATCTTCCTTCAAAT
②CHRNA5-23472GCAGGTGTTTAATGCCATTTA
Design and synthesize the oligonucleotide sequence of two pairs of complementations, in each forward single stranded oligonucleotide, oligonucleotide (25-27nt) is with forward and reverse combination, take TTCAAGAGA as hairpin loop sequence interval, make oligonucleotide form hairpin structure, the core sequence reverse complemental of every pair of oligonucleotide; The every pair of oligonucleotide two ends respectively with linearized vector pLLU2G on mutually complementary Xho I and Hpa I restriction enzyme site, it is necessary that this is that ligase enzyme is cut carrier.By the above, the oligonucleotide sequence after two target sequences design as previously mentioned.
Synthetic oligonucleotide be connected with linear carrier pLLU2G respectively, the extraction of conversion, amplification and plasmid.
Two pairs of oligonucleotide equivalent mixings that at first will synthesize, 95 ℃ of effects slowly were cooled to room temperature after 2 minutes, then in connection with double chain oligonucleotide be connected (pLLU2G-shCHRNA5-1 and pLLU2G-shCHRNA5-2) with the pLLU2G plasmid vector, be transformed at last the stb13 bacterium, the amoxicillin screening, select single bacterium colony and cultivate in a large number, the plasmid extraction purifying operates according to the test kit specification sheets.
The ligation system:
3. the evaluation plasmid DNA of plasmid is used primer pLLU2G-flank-f and pLLU2G-flank-r and is carried out the PCR evaluation through agarose gel electrophoresis, and concentration and the purity of plasmid DNA are measured in the ultraviolet spectrophotometer analysis, and inserts the segment order-checking.
The constructed plasmid identification of its biological activity method of aforesaid method is as follows:
1. the transfection A549 cell cultures of lung carcinoma cell cultivation and plasmid places 37 ℃, 5%CO in the RPMI-1640 that contains 10% new-born calf serum
2In the incubator.Front 24 hours of transfection, with tumor cell inoculation on 6 well culture plates, every hole about 5 * 10
5Individual cell reaches more than 90% every porocyte saturation ratio before transfection, do not use during bed board to contain antibiotic nutrient solution.Behind kind of the plate 24 hours, get plasmid 5 μ l, add 250 μ l transfection reagent opti-MEM, mixing is pressed Lipofectamine gently
TM2000 transfection reagents (Invitrogen) specification sheets method is carried out transient transfection.Dosage ratio is selected design in its suggested range, divide three groups according to liposome and plasmid proportioning, be respectively the blank group, 8 μ l:4 μ g group, 10 μ l:4 μ g group, prepare respectively and add 500 μ l transfection composites in liposome/plasmid transfection mixture 6 orifice plates, the culture plate that moves around makes transfection composite fully contact with cell.Behind 37 ℃ of cultivation 6h, add the fresh DMEM substratum that contains 10% new-born calf serum, continue to hatch.48h detects the expression of green fluorescent protein in fluorescent microscope after transfection.
2. the quantitative RT-PCR of the synthetic and RNA interference effect of the extraction of total RNA, cDNA detects
(1) extracts lung cell A549 after total RNA gets transfection, with PBS rinsing 2 times, by 10
6-10
7Individual cell adds 1ml RNA extraction agent Trizol (Invitrogen company) lysing cell, lysate goes to the 1.5ml size without the centrifuge tube (Ep pipe) of RNA enzyme (RNase-free), add 200 μ l chloroforms, thermal agitation 30 seconds, 12000 rev/mins 4 ℃ centrifugal 5 minutes, carefully get the Ep pipe that supernatant moves to 1.5ml size RNase-free, add and the isopyknic Virahol of supernatant, room temperature place after 5 minutes 12000 rev/mins 4 ℃ centrifugal 5 minutes, carefully abandon supernatant, 70% ethanol (preparation of DEPC water) washing precipitation 2 times is dried under the room temperature naturally, uses ddH
2O (containing 1%DEPC) dissolving, lower continuous reaction.
(2) the RT-PCR test kit of Takara company is used in the synthetic and RT-PCR reaction of cDNA, first by 50 ℃ of 30min, and 99 ℃ of 5min, the step of 5 ℃ of 5min is synthetic cDNA respectively, and reaction totally is 10 μ l, comprises MgCl
22 μ l, 10X RT Buffer1 μ l, dNTPs mixture 1 μ l, RNase Inhibitor0.25 μ l, AMV reversed transcriptive enzyme (Reverse Transcriptase) 0.5 μ l, Oligo dT-Adaptor Primer0.5 μ l, RNA4.8 μ l; Then get cDNA1 μ l and carry out quantitative pcr amplification in PCR instrument (PE5700), reaction conditions is 95 ℃, 60s denaturation, 95 ℃, 15s60 ℃, 1min40 circulation.Reaction totally is 20 μ l, comprise SYBR Green quantitative fluorescent PCR mixture (SYBR Green Realtime PCR Master Mix) 10 μ l, each 0.4 μ l of CHRNA5 upstream and downstream primer, confidential reference items beta-actin (each 0.4 μ l of the upstream and downstream primer of β-actin), cDNA2 μ l, dH
2O7.2 μ l.PCR primer sequence following table 1.
Table 1 goal gene PCR primer sequence and expanding fragment length
3. the variation of protein level checking CHRNA5 expression
(1) culturing cell protein extraction step: take out culturing cell, discard old nutrient solution, ice precooling PBS washes 1 time.Add 1 * SDS sample-loading buffer (Loading buffer) lysing cell, with the cell sleaker cell is scraped off, and be transferred in the Ep pipe, remain on ice.Shear DNA10-15s, reduce the sample viscosity.95～100 ℃ of heating 10min, cooled on ice, 4 ℃ of centrifugal 11000 * 4min.Draw supernatant to 0.5m lEp pipe ,-80 ℃ of preservations.
(2) protein sample electrophoresis step: pour into first the separation gel of about 10ml, solidify about 30min; Then pour into the concentrated glue of about 4ml, solidify about 20min.Offset plate is put into electrophoresis chamber, fill it up with electrophoresis liquid.Protein sample is joined in the hole 4 ℃ of 90v voltage electrophoresis 1.5～2h.
(3) transferring film step: pvdf membrane is processed: methyl alcohol soaks 10s, and deionized water soaks 5min, and 1 * transfering buffering liquid soaks 15min.(wear gloves when cutting film, prevent the protein contamination film of being infected with on hand)., put well according to the order of three metafiltration paper, gel, PVDF membrane (PVDF) film, three metafiltration paper to anodal by negative pole.(size of the size 〉=filter paper of film〉size of glue; Bubble can not appear between each layer), 4 ℃ of current stabilization 50mA shift 12～14h.
(4) antibody incubation step: wash film, room temperature 5min with 25ml film washing liquid TBS after the transferring film.Room temperature is hatched on the film 1h(shaking table with the sealing damping fluid and is shaken).25ml tween film washing liquid (TBST) is washed film 3 times * 5min/ time.The primary antibodie diluent is hatched 4 ℃ of the slight vibrations of film and is spent the night.TBST washes film 3 times * 5min/ time.Two anti-diluent (diluting with confining liquid) incubated at room film 1h of horseradish peroxidase (HRP)-mark.TBST washes film 3 times * 5min/ time.Filter membrane is placed in bottle ware, adds the DAB substrate solution of an amount of fresh configuration, can develop the color in 5-15 minute, water flushing termination reaction is also taken a picture.
Constructed plasmid and bioactive qualification result are as follows:
1. UV spectrophotometer measuring result each plasmid concentration as shown in the table is as follows; The A260/A280 ratio of each plasmid all about 1.83, in conjunction with the agarose gel electrophoresis result, confirms that institute's upgrading grain purity is higher, can be used for follow-up test.The concentration of plasmid DNA that UV spectrophotometer measuring is carried and purity such as following table 2.
Concentration and the purity of table 2. plasmid DNA that UV spectrophotometer measuring is carried
| Sample | Concentration (ng/ μ L) | OD 260/OD 280 |
| A549/shcontrol | 592.9 | 1.86 |
| A549/sh CHRNA5-1 | 621.2 | 1.85 |
| A549/sh CHRNA5-2 | 1030.8 | 1.86 |
2.PCR qualification result is used primer pLLU2G-flank-f and pLLU2G-flank-r carries out PCR evaluation (seeing Fig. 2).
3. sequencing result has verified that by order-checking (Fig. 3) oligonucleotide sequence that insertion sequence and we synthesize meets fully, illustrates that we have successfully made up pLLU2G-shCHRNA5-1 and pLLU2G-shCHRNA5-2.
4. transfection efficiency calculation result 48h after transfection detects the expression of green fluorescent protein in flow cytometer.Take liposome/plasmid vector as 8 μ l:4 μ g transfection effects best (transfection efficiency is as 91% as shown in Figure 4), and liposome is less to the toxicity of cell, is the proper ratio of plasmid and transfection agents.When the shRNA final concentration was larger, transfection efficiency did not significantly increase.
5. after the as a result transfection of quantitative PCR 48 hours, the real-time fluorescence quantitative PCR result showed (Fig. 5), A549/sh CHRNA5-1 relative expression quantity blank group A549/shcontrol:0.22 ± 0.04, A549/sh CHRNA5-2:0.79 ± 0.04.Wherein more obvious with CHRNA5-shRNA1, inhibiting rate is 78%, shows that the efficient of this plasmid inhibition CHRNA5 is higher.
6.Western bloting detects the CHRNA5-shRNA interference plasmid to affect after the transfection 48 hours of CHRNA5 expression level, extract each experimental group total protein of cell, Western bloting detects, the target protein expression has appearred in about 53kD position, the gray level ratio of CHRNA5 and GAPDH shows, the CHRNA5 brightness of shCHRNA5-RNA1 and CHRNA5-shRNA2 all weakens to some extent, wherein more obvious with CHRNA5-shRNA1, inhibiting rate is 65%, illustrates that the efficient of this plasmid inhibition CHRNA5 is higher.(see figure 6).
The shRNAs expression vector of target CHRNA5 gene of the present invention, energy be the CHRNA5 of the interior high expression level of inhibition tumor cell significantly, and then affects its biological activity, uses in the genomic medicine of the lung cancer for preparing treatment high expression level CHRNA5.
Excellent results of the present invention is as follows:
The present invention is directed to the CHRNA5 gene, utilize the RNA perturbation technique successfully to make up 2 kinds of shRNAs expression plasmids of CMV promoters driven in conjunction with gene recombination technology, and by in lung cancer cell line A549, expressing CHRNA5 specificity shRNAs molecule, the specific expression that suppresses the CHRNA5 gene, and filter out the highest a kind of shRNA expression plasmid pLLU2G-shCHRNA5-1 of inhibiting rate, to reach specificity, effectively to block that CHRNA5 expresses and the purpose for the treatment of lung cancer.
But the I. expression of 2 kinds of CHRNA5 specificity shRNAs expression plasmid establishment CHRNA5 genes of the present invention's structure.Mainly have the following advantages: 1. this plasmid can increase in the stb13 bacterium in a large number, can constantly obtain to express the carrier of shRNAs; 2. in the CHRNA5 coding region, the upstream designed respectively the target site that RNA disturbs, thereby found the higher site of CHRNA5 gene inhibition efficient; 3. safe, dangerous without insertion mutation, also react without immunotoxicity.
II. the specificity shRNAs expression plasmid of the present invention's structure, screening is for the CHRNA5 gene, and inhibition is obvious.The shRNAs expression plasmid that the present invention is directed to the CHRNA5 gene is the therapeutant that can be used for the relevant lung cancer of CHRNA5, significantly the inhibition tumor cell growth also can be induced its apoptosis, can further study the function of CHRNA5 gene and carries out gene therapy in experimental animals.
III. shRNA technology of the present invention can be on mRNA and protein level interference base because of expression.The hairpin structure of shRNA can be cut into siRNA by cell mechanism, and then siRNA is attached to RNA and induces (RNA-induced silencing complex, RISC) on the reticent mixture, and this mixture can be attached to purpose mRNAs and with its degraded.The plasmid shRNA interference expression vector that this institute makes up adopts the CMV promotor, can promote the expression of goal gene and transcribes.This plasmid at first synthesizes the shRNA with stem-ring structure of an about 73nt by the mode of transcribing in the body, under the effect of specific nucleic acid restriction endonuclease Dicer, generate the strand shRNA molecule of hairpin, can with the specific combination of target sequence, thereby degraded said target mrna, stop its protein translation, namely RNA disturbs (RNA interference).
Description of drawings
Fig. 1 is CHRNA5-shRNA1/2 carrier structure collection of illustrative plates.
Fig. 2 is pLLU2G-shCHRNA5PCR evaluation figure, and A:pLLU2G-shCHRNA5-1PCR identifies figure;
B:pLLU2G-shCHRNA5-2PCR identifies collection of illustrative plates, 1: positive control; 2: negative control; 3～10:1～No. 8 clone.
Fig. 3 is the gene sequencing figure of Insert Fragment, A: plasmid CHRNA5-shRNA1 sequencer map; B: plasmid CHRNA5-shRNA2 sequencer map.
Fig. 4 is that fluorescent microscope detects transfection efficiency, the A:Hochest B that dyes: the experimental group after the transfection.
Fig. 5 is the expression that the CHRNA5-shRNA transfection suppresses CHRNA5mRNA in the A549 cell.
Fig. 6 is that Western bloting detects transfection inhibition to A549 cell CHRNA5 protein expression after CHRNA5-shRNA1/248 hour.
Fig. 7 is the reaction conditions schema of cDNA quantitative PCR reaction.
Embodiment
The invention will be further described below in conjunction with embodiment, but be not limited only to this.All reagent of the present invention and raw material all can be bought by market.
One, main agents
1.pLLU2G carrier is available from match industry (Guangzhou) bio tech ltd.
2.QIA glue reclaims test kit (QIAquick Gel Extraction Kit), QIAGEN, article No. 28704 fast;
3. the little extraction reagent kit of plasmid, TIANGEN, article No. DP103-02;
4.dNTP mixture, Fermentas, article No. #R0192;
5.DNA marker GeneRuler
TM100bp DNA Ladder, Fermentas, article No. #SM0241;
6. restriction endonuclease Hpa I, TAKARA, article No. D1064A;
7. restriction endonuclease Xho I, TAKARA, article No. D1094A;
8.T4DNA the Ligase ligase enzyme, TAKARA, article No. D2011A;
9.S.O.C substratum, Life technologies, article No.: 15544034;
10.5 * Annealing Buffer for DNA Oligos annealing buffer, Beyotime, article No. D0251;
11.Taq DNA Polymerase polysaccharase, Fermentas, article No. EP0404;
12.Trizol ReagentRNA extracts reagent (Ambion, 15596026);
13.DNaseΙ，RNase-free（Thermo，#EN0521）；
14.RevertAid First Strand cDNA Synthesis Kit ThermoScript II (Thermo, #K1622);
15.SYBR Green Realtime PCR Master Mix quantitative PCR reaction mixture (TOYOBO, QPK-201);
16.10 μ M primer solution, the Shanghai JaRa is biological.
17.stbl3Chemically Competent E.coli is available from match industry (Guangzhou) bio tech ltd.
18. lung cell A549, attached Center Hospital of Jinan City centralab of Shandong University provides.
Two, key instrument
1.PCR instrument, U.S. BIO-RAD, model PTC-220/ALS-1296G/ALD1244G;
2. electrophoresis apparatus, Beijing Liuyi Instrument Factory, model DYY-12;
3. Horizontal electrophoresis tank, Beijing Liuyi Instrument Factory, model DYCP-31DN;
4.UV transilluminator, U.S. UVP, model M-26;
5. compact centrifuge, U.S. Eppendorf, model 5418;
6. microwave oven, middle Guomei, model MW721AAU-PW;
7. air-heating type Constant Temp. Oven, east, Guangzhou electrothermal drying instrument factory, model east-B;
8. thermostat water bath, HENGAO, model HWT-6B;
9. full warm air shaking table, Shanghai Fuma Experiment Equipment Co., Ltd., model QYC-200;
10. real-time fluorescence quantitative PCR instrument, U.S. Applied Biosystems, model AB7500;
11. the small-sized high speed centrifugal machine, U.S. Eppendorf, model 5418;
12. microcentrifuge, eastern KingMax is new, model EW-6000;
13. ultramicrospectrophotometer, U.S. Thermo, model NANO DROP2000.
Three, the preparation method of plasmid and identification of its biological activity thereof
1.RNA the design of the selection of interference target sequence and insertion template is with synthetic
1.1 two sections sequences of selection target sequence selection CHRNA5 gene coding region are 5'-GTCTTCTATCTTCCTTCAAAT-3 ' 1., originates in 1101; 2. 5'-GCAGGTGTTTAATGCCATTTA-3 ' originates in 3472.
1.2 the oligonucleotide of (25-27nt) take TTCAAGAGA as hairpin loop sequence interval, makes oligonucleotide form hairpin structure, the core sequence reverse complemental of every pair of oligonucleotide with forward and reverse combination in each forward single stranded oligonucleotide of design oligonucleotides; The every pair of oligonucleotide two ends are respectively with cutting mutually complementary Xho I and Hpa I restriction enzyme site on the carrier pLLU2G with enzyme, and it is necessary that this is that ligase enzyme is cut carrier.By the above, the oligonucleotide sequence after two target sequences design as previously mentioned.
According to the above, the oligonucleotide sequence after two target sequences design is as follows:
1. the shCHRNA5 oligonucleotide sequence 1:
Positive-sense strand:
5'-TGTCTTCTATCTTCCTTCAAATCTCGAGATTTGAAGGAAGATAGAAGACTTTTTC-3'
Antisense strand:
5'-TCGAGAAAAAGTCTTCTATCTTCCTTCAAATCTCGAGATTTGAAGGAAGATAGAAGACA-3'
2. the shCHRNA5 oligonucleotide sequence 2:
Positive-sense strand:
5'-TGCAGGTGTTTAATGCCATTTACTCGAGTAAATGGCATTAAACACCTGCTTTTTC-3’
Antisense strand:
5'-TCGAGAAAAAGCAGGTGTTTAATGCCATTTACTCGAGTAAATGGCATTAAACACCTGCA-3'
2. make up pLLU2G CHRNA5 and disturb carrier for expression of eukaryon
2.1 the annealing of oligodeoxynucleotide (Oligo DNA)
1) water of oligo DNA to be annealed being processed with diethylpyrocarbonate (DEPC) is configured to 50 μ M, dissolving Annealing Buffer for DNA Oligos (5 *), and mixing is for subsequent use.
2) it is as follows reaction system to be set:
3) add successively all ingredients, mixing according to above-mentioned reaction system.95 ℃ of water-baths 2 minutes naturally cooled to room temperature reaction 20 minutes.
2.2 enzyme is cut, is connected: the product C of will annealing HRNA5 dual oligonucleotide 1/2 respectively with pLLU2G carrier (collection of illustrative plates is seen Fig. 1), connect with the T4DNA ligase enzyme.16 ° of C night incubation.
The enzyme system of cutting arranges as follows:
37 ℃ of enzymes were cut 3 hours, termination reaction, and the sepharose with 1% carries out electrophoresis and cuts glue and reclaim.The ligation system is as follows:
2.3 transform
1) 10 μ L ligation reactions is joined among the 100 μ L stbl3Chemically Competent E.coli, hatched on ice 30 minutes; 42 ℃ of thermal shock cells 30 seconds;
2) transfer to immediately and hatch 2 minutes on ice;
3) add 250 μ L S.O.C substratum, in 37 ℃, the shaking table of 225rpm, hatched 1 hour;
S.O.C substratum: 2% Tryptones, 0.5% yeast extract, 10mMNaCl, 2.5mM KCl, 10mM MgCl
2, 10mM MgSO
4And contain the mixture of 20mM sucrose.
4) 100 μ L conversion products are coated onto on the LB flat board that contains 100 μ g/mL penbritins (Amp) 37 ℃ of overnight incubation.
2.4PCR screening positive recombinant.
The PCR primers designed:
pLLU2G-flank-f：AGGCTTAATGTGCGATAAAAGAC
pLLU2G-flank-r：GAGCTTATCGATACCGTCGAC
The PCR reaction system:
The pcr amplification program:
94℃ 3min
94 ℃, 30S; 60 ℃, 30S; 72 ℃, 1min(2kb/min); 29 circulations
72℃ 1min
2.5 picking positive colony plasmid.
2.6 delivering the positive colony order-checking identifies.
Sequencing primer PLLU2G-F:TGATAGGCTTGGATTTCT
3. the detection of plasmid DNA
3.1 agargel electrophoresis analysis: prepare 0.8% sepharose (containing 0.5 μ g/ml ethidium bromide), get 1 μ l plasmid DNA and carry out electrophoresis, the plasmid DNA of Detection and Extraction.
Carry out the PCR evaluation 3.2 use primer pLLU2G-flank-f and pLLU2G-flank-r
The reaction system of PCR is as follows:
The reaction system of table 3.PCR
| Composition | Add volume |
| SYBR Green quantitative PCR mixed solution | 10μl |
| Forward Primer forward primer | 0.4μl |
| Reverse Primer reverse primer | 0.4μl |
[0170]
| Template Solution template DNA | 2.0μl |
| dH 2O | 7.2μl |
| Cumulative volume | 20μl |
Reaction conditions is 95 ℃, 60s denaturation, 95 ℃, 15s, 60 ℃, 1min40 circulation.
3.3 ultraviolet spectrophotometer analysis: get 1 μ l plasmid DNA and dilute with 69 μ l ultrapure waters, under automatic ultraviolet spectrophotometer, detect the light absorption value at A260nm and A280nm place, to measure concentration and the purity of plasmid DNA.
4. the transfection of lung carcinoma cell cultivation and plasmid
The lung cell A549 cell cultures places 37 ℃, 5%CO in the RPMI-1640 that contains 10% new-born calf serum
2In the incubator.Front 24 hours of transfection is seeded in tumour cell A549 on 6 well culture plates, and about 5 * 105 cells in every hole reach more than 90% every porocyte saturation ratio before transfection, do not use during bed board to contain antibiotic nutrient solution.Behind kind of the plate 24 hours, get plasmid 5 μ l and add 250 μ l opti-MEM, mixing is pressed Lipofectamine gently
TM2000 transfection reagents (Invitrogen) specification sheets method is carried out transient transfection.Dosage ratio is selected design in its suggested range, divide 3 groups according to liposome and plasmid proportioning, be respectively the blank group, 8 μ l:4 μ g group, 10 μ l:4 μ g group, prepare respectively and add 500 μ l transfection composites in liposome/plasmid transfection mixture 6 orifice plates, the culture plate that moves around makes transfection composite fully contact with cell.Behind 37 ℃ of cultivation 6h, add the fresh DMEM that contains 10% new-born calf serum, continue to hatch.48h detects the expression of green fluorescent protein in fluorescent microscope after transfection.
5. the quantitative RT-PCR of the synthetic and RNA interference effect of the extraction of total RNA, cDNA detects
5.1 extract the lung cell A549 after total RNA gets transfection, with PBS rinsing 2 times, by 10
6-10
7Individual cell adds 1ml Trizol (Invitrogen) lysing cell, lysate goes to the Ep pipe of 1.5ml size RNase-free, adds 200 μ l chloroforms, thermal agitation 30 seconds, 12000 rev/mins 4 ℃ centrifugal 5 minutes, carefully get the Ep pipe that supernatant moves to 1.5ml size RNase-free, add and the isopyknic Virahol of supernatant, room temperature place after 5 minutes 12000 rev/mins 4 ℃ centrifugal 5 minutes, carefully abandon supernatant, 70% ethanol (preparation of DEPC water) washing precipitation 2 times is dried under the room temperature naturally, uses ddH
2O (containing 1%DEPC) dissolving, lower continuous reaction.
5.2cDNA synthetic and quantitative PCR reaction use the RT-PCR test kit of Takara company, hatched 60 minutes by 42 ℃ first, 70 ℃ of steps synthetic cDNA respectively of hatching 5 minutes, reaction totally is 20 μ l, comprises the RNA solution 11 μ L behind the DNA; Oligo (dT) 18primer1 μ L; Hatch after 5 minutes for 65 ℃ and be placed on immediately on ice; Add successively again: 5 * Reaction Buffer4 μ L; RiboLock RNase Inhibitor (20U/ μ L) 1 μ L; 10mM dNTP Mix2 μ L; RevertAid M-MuLV Reverse Transcriptase (200U/ μ L) 1 μ L; Get 2ul cDNA and carry out quantitative PCR reaction (as follows).
Goal gene PCR primer sequence
CHRNA5-F：ATGATGTCCGTGAGGTTGTTGA
CHRNA5-R：CCTTGGGAGGCTTCACTTATTT
Real-time PCR
1) reaction system:
| Composition | Add volume |
| SYBR Green quantitative PCR mixed solution | 10μl |
| Forward Primer forward primer | 0.4μl |
| Reverse Primer reverse primer | 0.4μl |
| Template Solution template DNA | 2.0μl |
| dH 2O | 7.2μl |
| Cumulative volume | 20μl |
2) reaction conditions: shown in Fig. 7 schema.
6. the variation of protein level checking CHRNA5 protein expression
6.1 culturing cell protein extraction step: take out culturing cell, discard old nutrient solution, ice precooling PBS washes 1 time.Add 1 * SDS Loading buffer lysing cell, with the cell sleaker cell is scraped off, and be transferred in the Ep pipe, remain on ice.Shear DNA10-15s, reduce the sample viscosity.95～100 ℃ of heating 10min, cooled on ice, 4 ℃ of centrifugal 11000 * 4min.Draw supernatant to the 0.5mlEp pipe ,-80 ℃ of preservations.
6.2 protein sample electrophoresis step: pour into first the separation gel of about 10ml, solidify about 30min; Then pour into the concentrated glue of about 4ml, solidify about 20min.Offset plate is put into electrophoresis chamber, fill it up with electrophoresis liquid.Protein sample is joined in the hole 4 ℃ of 90v voltage electrophoresis 1.5～2h.
6.3 transferring film step: pvdf membrane is processed: methyl alcohol soaks 10s, and deionized water soaks 5min, and 1 * transfering buffering liquid soaks 15min.(wear gloves when cutting film, prevent the protein contamination film of being infected with on hand)., put well according to the order of three metafiltration paper, gel, pvdf membrane, three metafiltration paper to anodal by negative pole.(size of the size 〉=filter paper of film〉size of glue; Bubble can not appear between each layer), 4 ℃ of current stabilization 50mA shift 12～14h.
6.4 antibody incubation step: wash film with 25ml TBS after the transferring film, room temperature 5min.Room temperature is hatched on the film 1h(shaking table with the sealing damping fluid and is shaken).25ml TBST washes film 3 times * 5min/ time.The primary antibodie diluent is hatched 4 ℃ of the slight vibrations of film and is spent the night.TBST washes film 3 times * 5min/ time.Two anti-diluent (diluting with confining liquid) incubated at room film 1h of HRP-mark.TBST washes film 3 times * 5min/ time.Filter membrane is placed in bottle ware, adds the DAB substrate solution of an amount of fresh configuration, can develop the color in 5-15 minute, water flushing termination reaction is also taken a picture.
Four, result
1. UV spectrophotometer measuring result each plasmid concentration as shown in the table is as follows; The A260/A280 ratio of each plasmid all about 1.83, in conjunction with the agarose gel electrophoresis result, confirms that institute's upgrading grain purity is higher, can be used for follow-up test.
Concentration and the purity of plasmid DNA that UV spectrophotometer measuring is carried
| Sample | Concentration (ng/ μ L) | OD 260/OD 280 |
| A549/shcontrol | 592.9 | 1.86 |
| A549/sh CHRNA5-1 | 621.2 | 1.85 |
| A549/sh CHRNA5-2 | 1030.8 | 1.86 |
2.PCR qualification result is used primer pLLU2G-flank-f and pLLU2G-flank-r carries out PCR evaluation (seeing Fig. 2).
3. sequencing result has verified that by order-checking (Fig. 3) oligonucleotide sequence that insertion sequence and we synthesize meets fully, illustrates that we have successfully made up CHRNA5-miRNA1/2.
4. transfection efficiency calculation result 48h after transfection detects the expression of green fluorescent protein in flow cytometer.The result shows take liposome/plasmid vector as 8 μ l:4 μ g transfection effects best (transfection efficiency is as 86% as shown in Figure 4), and liposome is less to the toxicity of cell, is the proper ratio of plasmid and transfection agents.When the shRNA final concentration strengthened, transfection efficiency was without remarkable increase.
5. after the as a result transfection of quantitative PCR 48 hours, the real-time fluorescence quantitative PCR result showed (Fig. 5), A549/sh CHRNA5-1 relative expression quantity blank group A549/shcontrol:0.22 ± 0.04, A549/sh CHRNA5-3:0.79 ± 0.04.Wherein more obvious with CHRNA5-shRNA1, inhibiting rate is 78%, shows that the efficient of this plasmid inhibition CHRNA5 is higher.
6.Western bloting detects the CHRNA5-shRNA interference plasmid to affect after the transfection 48 hours of CHRNA5 expression level, extract each experimental group total protein of cell, Western bloting detects, the target protein expression has appearred in about 53kD position, the gray level ratio of CHRNA5 and GAPDH shows, the CHRNA5 brightness of CHRNA5-shRNA1 and CHRNA5-shRNA2 all weakens to some extent, wherein more obvious with CHRNA5-shRNA1, inhibiting rate is 65%, illustrates that the efficient of this plasmid inhibition CHRNA5 is higher.(see figure 6).
Claims (2)
1. the shRNAs expression vector of target CHRNA5 gene, it is characterized in that, take pLLU2G as carrier, for two sections sequences of people's Nicotine acetylcholine receptor alpha 5 genes (CHRNA5) upstream and downstream, coding region, performance RNA interference effect in than the lung cancer cell line A549 of high expression level CHRNA5; The CHRNA5 specific RNA interferes target sequence to be respectively: 1. 5'-GTCTTCTATCTTCCTTCAAAT-3 ' originates in 1101; 2. 5'-GCAGGTGTTTAATGCCATTTA-3 ' originates in 3472, is made by following methods:
(1) design of the selection of RNA interference target sequence and insertion sequence is with synthetic
Two sections sequences selecting the CHRNA5 gene coding region are 5'-GTCTTCTATCTTCCTTCAAAT-3 ', 2. 5'-GCAGGTGTTTAATGCCATTTA-3 ' 1., the oligonucleotide sequence of design, synthetic two pairs of complementations, and sequence is as follows:
1. the shCHRNA5 oligonucleotide sequence 1:
Positive-sense strand:
5'-TGTCTTCTATCTTCCTTCAAATCTCGAGATTTGAAGGAAGATAGAAGACTTTTTC-3'
Antisense strand:
5'-TCGAGAAAAAGTCTTCTATCTTCCTTCAAATCTCGAGATTTGAAGGAAGATAGAAGACA-3’
2. the shCHRNA5 oligonucleotide sequence 2:
Positive-sense strand:
5'-TGCAGGTGTTTAATGCCATTTACTCGAGTAAATGGCATTAAACACCTGCTTTTTC-3'
Antisense strand:
5'-TCGAGAAAAAGCAGGTGTTTAATGCCATTTACTCGAGTAAATGGCATTAAACACCTGCA-3’，
(2) synthetic oligonucleotide be connected with linear carrier pLLU2G respectively, the extraction of conversion, amplification and plasmid
The a pair of shCHRNA5 oligonucleotide equivalent mixing of the sequence 1 that step (1) is synthetic, 95 ℃ of effects slowly were cooled to room temperature after 2 minutes, obtained the double chain oligonucleotide shCHRNA5-1 of combination;
The a pair of shCHRNA5 oligonucleotide equivalent mixing of the sequence 2 that step (1) is synthetic, 95 ℃ of effects slowly were cooled to room temperature after 2 minutes, obtained the double chain oligonucleotide shCHRNA5-2 of combination;
Then above-mentioned double chain oligonucleotide shCHRNA5-1, shCHRNA5-2 are connected with the pLLU2G plasmid vector respectively and obtain pLLU2G-shCHRNA5-1 or pLLU2G-shCHRNA5-2, be transformed into respectively at last the stb13 bacterium;
(3) evaluation of plasmid
Plasmid DNA agarose gel electrophoresis with step (2) extraction, use primer order-checking forward primer and carry out the PCR evaluation with the order-checking reverse primer, concentration and the purity of plasmid DNA is measured in the ultraviolet spectrophotometer analysis, and insert the segment order-checking, whether correctly change in the pLLU2G plasmid to determine synthetic oligonucleotide.
2. the application of the shRNAs expression vector of the target CHRNA5 gene of claim 1 in the genomic medicine of the lung cancer of preparation treatment expression CHRNA5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310285339.6A CN103361379B (en) | 2013-07-08 | 2013-07-08 | Construction, screening and application of shRNAs expression vector of lung cancer targeted CHRNA5 gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310285339.6A CN103361379B (en) | 2013-07-08 | 2013-07-08 | Construction, screening and application of shRNAs expression vector of lung cancer targeted CHRNA5 gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103361379A true CN103361379A (en) | 2013-10-23 |
| CN103361379B CN103361379B (en) | 2015-04-08 |
Family
ID=49363636
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310285339.6A Active CN103361379B (en) | 2013-07-08 | 2013-07-08 | Construction, screening and application of shRNAs expression vector of lung cancer targeted CHRNA5 gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103361379B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102051362A (en) * | 2010-11-02 | 2011-05-11 | 中国人民解放军军事医学科学院生物工程研究所 | Interference RNA (Ribonucleic Acid) of targeted HPIP (hematopoietic PBX-interacting protein) gene, medical composition containing same and application thereof |
| CN103131782A (en) * | 2013-03-04 | 2013-06-05 | 北京沁蓝生物科技有限公司 | Kit for detecting early stage non-small-cell lung cancer multi-site association genes |
-
2013
- 2013-07-08 CN CN201310285339.6A patent/CN103361379B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102051362A (en) * | 2010-11-02 | 2011-05-11 | 中国人民解放军军事医学科学院生物工程研究所 | Interference RNA (Ribonucleic Acid) of targeted HPIP (hematopoietic PBX-interacting protein) gene, medical composition containing same and application thereof |
| CN103131782A (en) * | 2013-03-04 | 2013-06-05 | 北京沁蓝生物科技有限公司 | Kit for detecting early stage non-small-cell lung cancer multi-site association genes |
Non-Patent Citations (3)
| Title |
|---|
| WILK,J.B ET AL: "Homo sapiens cholinergic receptor, nicotinic, alpha 5 (neuronal) (CHRNA5), mRNA", 《GENBANK》 * |
| 姜 丹 等: "沉默干扰HMGA2 对胃癌细胞Wnt/beta-Catenin信号转导通路的影响", 《世界华人消化杂志》 * |
| 赵云 等: "siRNA干扰CHRNA5基因的表达抑制尼古丁对人肺癌细胞的促增殖作用", 《中国肿瘤生物治疗杂志》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103361379B (en) | 2015-04-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Yang et al. | MicroRNA-218 functions as a tumor suppressor in lung cancer by targeting IL-6/STAT3 and negatively correlates with poor prognosis | |
| Jiang et al. | MiR-125b promotes proliferation and migration of type II endometrial carcinoma cells through targeting TP53INP1 tumor suppressor in vitro and in vivo | |
| Wu et al. | MiR-19a/b modulate the metastasis of gastric cancer cells by targeting the tumour suppressor MXD1 | |
| Chen et al. | miR-598 inhibits metastasis in colorectal cancer by suppressing JAG1/Notch2 pathway stimulating EMT | |
| Qian et al. | Pivotal role of reduced let-7g expression in breast cancer invasion and metastasis | |
| Fuziwara et al. | MicroRNAs in thyroid development, function and tumorigenesis | |
| Fang et al. | MiR-744 functions as a proto-oncogene in nasopharyngeal carcinoma progression and metastasis via transcriptional control of ARHGAP5 | |
| Liu et al. | miR-22 functions as a micro-oncogene in transformed human bronchial epithelial cells induced by anti-benzo [a] pyrene-7, 8-diol-9, 10-epoxide | |
| Wang et al. | Human cancer cells suppress behaviors of endothelial progenitor cells through miR-21 targeting IL6R | |
| US9107934B2 (en) | MicroRNA as a cancer progression predictor and its use for treating cancer | |
| Solé et al. | miRNAs in B-cell lymphoma: Molecular mechanisms and biomarker potential | |
| Tian et al. | Klf4 inhibits tumor growth and metastasis by targeting microRNA-31 in human hepatocellular carcinoma | |
| Zhang et al. | Down-regulation of miR-106b suppresses the growth of human glioma cells | |
| CN110804613A (en) | Application of siRNA for targeted inhibition of lncRNA-00861 gene expression in liver cancer treatment | |
| Shi et al. | Targeting miRNAs for pancreatic cancer therapy | |
| Wang et al. | MicroRNA‑133b targets TGFβ receptor I to inhibit TGF‑β‑induced epithelial‑to‑mesenchymal transition and metastasis by suppressing the TGF‑β/SMAD pathway in breast cancer Corrigendum in/10.3892/ijo. 2023.5531 | |
| Huang et al. | N6-Methyladenosine associated silencing of miR-193b promotes cervical cancer aggressiveness by targeting CCND1 | |
| Cao et al. | CircRNA circ_POLA2 promotes cervical squamous cell carcinoma progression via regulating miR-326/GNB1 | |
| Li et al. | Roles of a TMPO-AS1/microRNA-200c/TMEFF2 ceRNA network in the malignant behaviors and 5-FU resistance of ovarian cancer cells | |
| Boudouresque et al. | Ribonuclease MCPiP1 contributes to the loss of micro-RNA-200 family members in pancreatic cancer cells | |
| CN102304538A (en) | Construction and screening as well as applications for siRNAs expression carrier of stomach cancer target STAT3 gene | |
| Guo et al. | Downregulation of TNFRSF19 and RAB43 by a novel miRNA, miR-HCC3, promotes proliferation and epithelial–mesenchymal transition in hepatocellular carcinoma cells | |
| CN102191246B (en) | Multi-target interfering nucleic acid molecule and application thereof | |
| Li et al. | Methylation-induced downregulation and tumor suppressive role of microRNA-29b in gastric cancer through targeting LASP1 | |
| Chen et al. | MYCN‑amplified neuroblastoma cell‑derived exosomal miR‑17‑5p promotes proliferation and migration of non‑MYCN amplified cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| ASS | Succession or assignment of patent right |
Owner name: MA XIAOLI Effective date: 20150304 |
|
| C41 | Transfer of patent application or patent right or utility model | ||
| TA01 | Transfer of patent application right |
Effective date of registration: 20150304 Address after: 250013 No. 105, central laboratory, Lixia District, Shandong City, Ji'nan Province, Jiefang Road Applicant after: Wang Yunshan Applicant after: Ma Xiaoli Address before: 250013 No. 105, central laboratory, Lixia District, Shandong City, Ji'nan Province, Jiefang Road Applicant before: Wang Yunshan |
|
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |