CN103342735B - Tumor specific target polypeptide and application thereof - Google Patents
Tumor specific target polypeptide and application thereof Download PDFInfo
- Publication number
- CN103342735B CN103342735B CN201310258476.0A CN201310258476A CN103342735B CN 103342735 B CN103342735 B CN 103342735B CN 201310258476 A CN201310258476 A CN 201310258476A CN 103342735 B CN103342735 B CN 103342735B
- Authority
- CN
- China
- Prior art keywords
- group
- polypeptide
- tumor
- specific target
- phage
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention relates to a tumor specific target polypeptide and an application thereof. More specifically, the amino acid sequence of the tumor specific target polypeptide provided by the invention is shown by SEQ ID No.1 or 2. After being connected with a polypeptide-amine type dendritic macromolecular nano material, the polypeptide provided by the invention can be perfectly combined with multiple tumor cells in vivo; and as a target agent, the polypeptide has broad application in terms of diagnostic imaging and targeted therapy of tumors.
Description
Technical field
The invention belongs to protein and peptide technical field, relate to polypeptide and the application thereof of phage display.Say more specifically a kind of polypeptide that can be combined with tumor cell specific and its preparation method and application.
Background technology
Tumour is one of disease the most often occurring in the world, has many advanced countries, and wherein the mortality ratio shelter of lung cancer has first of carninomatosis mortality ratio.The treatment of lung cancer at present mainly contains the means such as operation, radiation and chemotherapy.Operation and radiation treatment be all topical therapeutic mode, the transfer in uncontrollable late period, and many patients due to physique a little less than, cannot accept this type for the treatment of; And although chemotherapy has the pretty good chemotherapeutics of some curative effects, but owing to all lacking tumor cell specific, in killing tumor cell, also kill and wound a large amount of marrow and other vigorous cell that rises in value, all there is stronger side effect, and repeatedly after chemotherapy, tend to produce resistance, greatly reduce curative effect of medication.So the targeted therapy for tumour is the focus of oncotherapy at present.
Phage display (phage dispaly) technology (Scott JK, Smith GP Searching forpeptide ligands with an epitope library.Science.1990J μ l27; 249 (4967): be 386-90) that research biologically active peptides, a peptide medicament screening and antibody such as prepare at the very useful means.Screening method (phage displayinvivo) (Pasqualini R, Ruoslahti E.Organ targeting in vivo using phagedisplay peptide libraries.Nature.1996Mar28 in the phage random peptide library body that developed recently gets up; 380 (6572): 364-6), be to find and tissue, the effective means of organ specificity Binding peptide.This method can be in the situation that acceptor molecule it be unclear that, and the naturally occurring environmental organization organ of the acceptor of take is aglucon, utilizes the antigen-specific of phage small peptide, finds unknown target molecule, determines its structural domain.There is specific combination biological tissue, organ and there is in vivo good stability, specificity advantages of higher.This method can directly be screened the part of specific combination in the situation that of the unknown of target spot molecule mechanism, has shortened research cycle.And screening carries out under the same conditions with treatment, avoided testing invalid or active low shortcoming in part body that in-vitro screening obtains, at utmost guaranteed the targeting specific of the small peptide that screens.At present by triage techniques in phage body, several groups of special little peptides of being combined with mouse brain, kidney position blood vessel and tumor vessel have successfully been obtained in the world, and by after this little peptide and Zorubicin and tumor necrosis factor TNF-alpha coupling, in mouse tumor model, played good antitumor action, refer to, Scott JK, Smith GP Searching forpeptide ligands with an epitope library.Science.1990J μ l27; 249 (4967): 386-90; Pasqualini R, Ruoslahti E.Organ targeting in vivo using phagedisplay peptide libraries.Nature.1996Mar28; 380 (6572): 364-6; Zhang, L.; Hoffman, J.A.; Ruoslahti, E., Molec μ lar profiling of heart endothelialcells.Circ μ lation2005,112, (11), 1601-11.
Chinese Patent Application No. 01126429.2 discloses a kind of anti-small cell lung carcinoma polypeptide mixture one and has had three kinds of forms: SPDD polypeptide mixture, the polypeptide mixture of the polypeptide libraries of SPDD structural convergenceization combination, the polypeptide mixture that the above two mix.As antagonist, for the preparation of the polypeptide drugs of anti-small cell lung carcinoma.
Chinese Patent Application No. 03158296.6 discloses a kind of polypeptide with antitumor action, and by 1 Ala, 1 Glu, 1 Gly, 1 Leu, 2 Pro, 1 Thr, 1 octapeptide that Tyr forms, molecular weight is 846.9, can apply ND100 and treat tumour.
Chinese Patent Application No. 200710066323.0(Chinese patent?) a kind of polypeptide with tumor-targeting and preparation method thereof disclosed.Its aminoacid sequence structure is: CASPSGALRSC; Or CFPVPGHDLVC; Or CFSVPGHDIVC; Or CTPMSLSLSEC; Or CYTYPLGWHIC synthetic has the polypeptide of tumor-targeting.
Chinese Patent Application No. 02149419.3 discloses a kind of carcinomebryonic antigen specific binding peptides and has been mainly to filter out the binding peptide with carcinomebryonic antigen specific binding by phage random displayed polypeptide storehouse with the fusion rotein of TNF-α, and these binding peptides can be as the carrier of carcinoembryonic antigen positive tumor targeted therapy medicine.
Summary of the invention
The present invention is the polypeptide with cancerous lung tissue specific combination by screening in phage random polypeptide libraries body, prepares peptide class lung cancer early diagnosis and therapy reagent.After the antitumor drug Docetaxel of this polypeptide and bioabsorbable polymer material poly(lactic acid) inclusion links, the novel targeted antitumor drug of preparation.Polypeptide of the present invention is target tumor cell well, and can play actively tumor imaging and treatment it as target agent.
The beneficial effect that polypeptide of the present invention compared with prior art had is: the polypeptide that the present invention's screening obtains not only has traditional antibody molecule advantage, and molecular weight is little, penetration power by force, easily arrives tumor tissues, it is sensitiveer to have good cancer target effect, diagnosing tumour, can be used for preparing the test kit of diagnosing tumour, and the medicine for the treatment of tumour and the application of carrying the target agent aspect of tumour medicine.
The invention provides a kind of tumor specific target polypeptide, described polypeptide is selected from the polypeptide as shown in aminoacid sequence SEQ ID NO:1 or SEQ ID NO:2.
Preferably, described tumour is selected from cervical cancer cell, Non-small cell lung carcinoma cell or human glioma cell.
On the other hand, the invention provides the nucleotide sequence of coding tumor specific target polypeptide of the present invention, shown in nucleotides sequence classify the sequence shown in SEQ ID NO:3 or SEQ ID NO:4 as, or the sequence complementary with it.
Further, the invention provides the purposes of tumor specific target polypeptide according to the present invention in preparing early diagnosis of tumor and treatment reagent.
Further, the invention provides tumor specific target polypeptide according to the present invention in preparation as the purposes aspect cancer target agent medicine.
On the other hand, the invention provides according to tumor specific target polypeptide of the present invention, be connected with bioabsorbable polymer material poly(lactic acid), the purposes in preparing early diagnosis of tumor and treatment reagent.Preferably, described bioabsorbable polymer material is nano material.More preferably, described bioabsorbable polymer material poly(lactic acid) inclusion antitumor drug.More preferably, described antitumor drug is Docetaxel.
On the other hand, the invention provides a kind of novel targeted antitumor drug, it comprises as according to tumor specific target polypeptide of the present invention, bioabsorbable polymer material and antitumor drug.
Above-mentioned purpose of the present invention is to be achieved by following method:
Method: result is screened and obtained seven peptide phage polypeptides by three-wheel, after the antitumor drug Docetaxel of this polypeptide and bioabsorbable polymer material poly(lactic acid) inclusion links, the novel targeted antitumor drug of preparation.Conclusion: this polypeptide can well target and tumour cell, can play a positive role to tumor imaging and treatment it as target agent.Particularly to cervical cancer cell, Non-small cell lung carcinoma cell and human glioma cell, using it as target agent, can wide application will be had to the diagnostic imaging of tumour and targeted therapy.
Tumor specific target polypeptide disclosed by the invention, its aminoacid sequence is LPLTPLP and CVKTPAQSC.
The nucleotide sequence of coding is respectively CTGCCGTTGACTCCGCTTCCG and TGTGTGAAGACGCCGGCTCAGTCGTGC
The present invention further discloses tumor specific target polypeptide and preparing peptide class early diagnosis of tumor and the application for the treatment of aspect reagent.Particularly as the application of cancer target agent medicine aspect.
The application method of tumor specific target polypeptide of the present invention is: after the antitumor drug Docetaxel of this polypeptide and bioabsorbable polymer material poly(lactic acid) inclusion is linked, and the novel targeted antitumor drug of preparation.
Accompanying drawing explanation
Fig. 1 represents that each treatment group the weight of animals changes.CON is control group, and DTX is conventional medicine group, and NDTX is nanometer formulation group, and TNDTX is targeting peptides nanometer formulation high dose group, and TNDTX-L is targeting peptides nanometer formulation low dose group.
Fig. 2 represents each treatment group knurl body dissection.
Fig. 3 A represents that each treatment group relative tumour volume changes;
*p<0.05, with model group comparison; #p<0.05, with the comparison of conventional medicine group; Fig. 3 B represents 28 days tumor weights.CON is control group, and DTX is conventional medicine group, and NDTX is nanometer formulation group, and TNDTX is targeting peptides nanometer formulation high dose group, and TNDTX-L is targeting peptides nanometer formulation low dose group.
ap<0.05, with control group comparison;
bp<0.05; With the comparison of conventional medicine group;
cp<0.05, with the comparison of Nano medication group.
Fig. 4 represents control group (CON) and conventional medicine Docetaxel group (DTX) liver HE dyeing.The normal nude mice liver of upper diagram, middle figure is CON group, and figure below is DTX group, and right figure is the red frame indication of left figure magnification region.Left figure scale represents 500 μ m, and right figure scale represents 200 μ m.
Fig. 5 represents Nano medication group and targeted nano medicine group group liver HE dyeing.Upper figure is Nano medication group (NDTX), and middle figure is targeted nano medicine low dose group (TNDTX-L), and figure below is targeted nano medicine high dose group (TNDTX-H), and right figure is the red frame indication of left figure magnification region.Left figure scale represents 500 μ m, and right figure scale represents 200 μ m.
Fig. 6 represents respectively to organize nude mice plasma A FP content after administration.
*p<0.05 compares with CON group;
#p<0.05 compares with DTX group,
$p<0.05 compares with NDTX.
Fig. 7 represents respectively to organize nude mice Plasma glutamate-pyruvate transaminase content after administration.
*p<0.05 compares with CON group;
#p<0.05 compares with DTX group,
$p<0.05 compares with NDTX.
Fig. 8 represents respectively to organize nude mice blood plasma GOT content after administration.
*p<0.05 compares with CON group;
#p<0.05 compares with DTX group,
$p<0.05 compares with NDTX.
Embodiment
In order to explain more fully enforcement of the present invention, provide the embodiment of preparing of cyclic peptide of the present invention and linear seven peptides.These embodiments are only to explain rather than limit the scope of the invention.
Screening polypeptide in phage display body
One, the foundation of people A549 nonsmall-cell lung cancer nude mice model
(1) get the female nude mice of surrounding Balb/C in age (being purchased from Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences's Experimental Animal Center), put into SPF level Animal House and raise.
(2) cultivator nonsmall-cell lung cancer NCI A549, the lung cancer cell line in vegetative period of taking the logarithm, the conventional digestion of pancreatin, adjustment cell concn is 1x10
7individual/ml, getting 200 μ l is 2x10
6it is subcutaneous that individual cell is inoculated in the forelimb oxter of every nude mice, the postvaccinal upgrowth situation of observation of cell, and about 5-6 days visible knurl pieces afterwards, in the time of two weeks, diameter of tumor size is about 0.3～0.5cm, can do phage selection in body and test.
Two, the screening in phagedisplay peptide library Mice Body
(1) cultivation of E.coli ER2738
With aseptic technique picking one transfering loop from the frozen thing of glycerine of ER2738 intestinal bacteria (New England Ph.D.-C7CTM phage display peptide library test kit carries), method of scoring is inoculated on the LB flat board of tetracyclin resistance, cultivate 24h for 37 ℃, after the bright bacterial plaque of dull and stereotyped visible white forms, by basic culture plate as for 4 ℃ of preservations.
On flat board, the mono-colony inoculation of picking E.coli ER2738 is in 5mlLB nutrient solution, and 37 ℃ of 225 rotational oscillation swings and be cultured to logarithmic growth (OD in mid-term
600be about 0.5).(doing experimentation on animals inoculation evening before that day).
(2) screening of target phage
1) prepare the target molecule solution (being dissolved in the NaHCO3 of 0.1M pH8.6) of 100 μ g/ml.
2) every plate adds the above-mentioned solution of 1.5ml, and rotation is not until surface completely moistening (carefully making solution spill) repeatedly.
3) 4 ℃ of slight concussions in humidifier vessel, overnight incubation
4) second day, chooses ER2738 mono-clonal (plate of paving when phage titre is measured) in 10mlLB liquid nutrient medium.The phage of wash-out if increased on the same day, also can be inoculated in ER2738 20ml LB liquid nutrient medium, and 37 ℃ of concuss are cultivated.
5) outwell the coating buffer in every plate, plate is upside down on clean paper handkerchief and firmly claps and get rid of to remove residual solution.Every plate is filled it up with the liquid of blockading, and 4 ℃ act at least 1hr.
6) by method described in 5, remove the liquid of blockading.Use again TBST (TBS+0.1%[v/v] Tween-20) damping fluid to wash fast plate 6 times.Each all rotation is so that the bottom in plate or hole and edge are all washed, and the damping fluid that inclines, is upside down in clean paper handkerchief arsis and gets rid of to remove residual solution.
7) with the TBST damping fluid of 1ml, dilute 2 * 10
11phage (i.e. the original library of 10 μ l), be then added on the plate being coated with, room temperature gentleness is shaken 10-60min.
8) topple over and remove not in conjunction with phage, be inverted plate and get rid of and remove residual solution at clean paper handkerchief arsis.
9) by method described in 6, with TBST damping fluid, wash plate 10 times, change a clean paper handkerchief to avoid crossed contamination at every turn.
10) according to studied molecular interaction, with the suitable elution buffer 0.2M Glycine-HCl (pH2.2) of 1ml, 1mg/ml BSA carrys out the molecule of separated combination: gentleness is shaken >10min, and elutriant sucks in another clean Eppendorf tube.And then with 150 μ l1MTris-HCl(pH9.1) neutralize above-mentioned elutriant.
11) by the titre of a small amount of (the 1 μ l) eluate of the program determination in above-mentioned conventional M13 method.Phage titre measuring method:
1. inoculate the mono-bacterium colony of ER2738 in 5-10ml LB substratum, shaking table is cultured to mid-log phase (OD
600～0.5).
2. during Growth of Cells, microwave oven melts top-layer agar, is divided into 3ml equal portions in sterilizing test tubes, each phage extent of dilution one pipe.Be stored in 45 ℃ standby.
3. 37 ℃ of pre-temperature LB/IPTG/Xgal are dull and stereotyped, and it is standby that each phage extent of dilution is got a flat board.
4. in LB, prepare the phage of 20 times of serial dilutions.
Suggestion dilution range: the phage culture supernatant of amplification: 10
8-10
11; The elutriation eluate not increasing: 10
1-10
4.
5. when yeast culture thing reaches mid-log phase, be divided into 200 μ l equal portions in Eppendorf tube, each phage extent of dilution one pipe.
6. every pipe adds the different dilution phages of 10 μ l, and concussion mixes fast, room temperature incubation 1-5min.
7. cells infected is added in the top-layer agar culture tube of 45 ℃ of pre-temperature, each pipe, mixes fast, is poured into immediately on the LB/IPTG/Xgal flat board of 37 ℃ of pre-temperature.Suitably tilt flat plate evenly spreads out top-layer agar.
8. after dull and stereotyped cooling 5min, be inverted in 37 ℃ of overnight incubation.
9. check flat board, counting has～and 10
2spot number on the flat board of individual plaque.Then with this number, be multiplied by plaque forming unit (pfu) titre that dilution factor obtains every 10 μ l phages.
12) residue eluate should be amplified: eluate is joined in 20ml ER2738 culture to (thalline should in logarithm early stage), 37 ℃ of violent wave and culture 4.5hr.
13) culture is proceeded in a centrifuge tube, then, 4 ℃ 10, the centrifugal 10min of 000rpm.Supernatant liquor proceeds in another centrifuge tube, more centrifugal.
14) top of supernatant 80% is proceeded in a fresh tube, add the PEG/NaCl of 1/6 volume.Allow 4 ℃ of precipitations of phage spend the night.
15) 4 ℃ 10, the centrifugal PEG precipitation of 000rpm 15min.Outwell supernatant liquor, ofer short duration centrifugal, suck residual supernatant liquor.
16) throw out is resuspended in 1ml TBS, and suspension proceeds in Eppendorf tube, and 4 ℃ of centrifugal 5min make residual cells precipitation.
17) supernatant proceeds to another fresh Eppendorf tube, with the PEG/NaCl redeposition of 1/6 volume.Hatch 15-60min on ice.
4 ℃ of centrifugal 10min, abandon supernatant, ofer short duration centrifugal, with micropipet, suck remaining supernatant.
18) throw out is resuspended in 200 μ l TBS, 0.02%NaN
3in.Centrifugal 1min, precipitates the insolubles of any remnants.Supernatant proceeds in fresh tube.This is the eluate after amplification.
19) dilute respectively 10
6～10
10measure phage titre.Get 10
11pfu is as the phage of programmed screening.
Repeat above operation, carry out three-wheel screening.
(3) extraction purifying and the sequencing thereof of phage DNA
1) carry out as stated above plaque amplification, after the first step is centrifugal, 500 μ l are proceeded to a fresh centrifuge tube containing phage supernatant.
2) add 200 μ l PEG/NaCl, put upside down and mix, room temperature is placed 10min.
3) centrifugal 10min, abandons supernatant liquor.
4) of short duration centrifugal, carefully suck remaining supernatant.
5) throw out is thoroughly resuspended in 100 μ l iodide damping fluids, adds 250 μ l ethanol.Room temperature incubation 10min.The room temperature incubation of short period of time makes single stranded phage DNA precipitation and most of phage albumen remains in solution.
6) centrifugal 10min, abandons supernatant.With 70% ethanol, wash precipitation, of short duration vacuum-drying.
7) precipitation is resuspended in 30 μ l TE[10mM Tris-HCl (pH8.0), 1mM EDTA] in.
8) get the above-mentioned template solution of 5 μ l ,-96 primers that carry with test kit check order.
Sample is served Hai Shenggong and is checked order.
Three, the foundation of cyclic peptide sequence
According to above-mentioned sequencing result, determine that cyclic peptide phage sequence is: TGTGTGAAGACGCCGGCTCAGTCGTGC.The cyclic peptide protein sequence that can derive external source insertion according to DNA sequence dna is: CVKTPAQSC, disulfide bond crosslinking by two halfcystines circularizes seven peptides, the combination of ring type polypeptide is mainly by the polypeptide in annular and protein bound, for subsequent experimental is conveniently carried out isotopic labeling, end at annular polypeptide has added a tyrosine, in order can be better connected with carrier, changed the L-Ala of left distal end into arginine.Peptide sequence entrusts BeiJing ZhongKe Yaguang Biology Science Co., Ltd to synthesize, and product is carried out to HPLC purifying and Mass Spectrometric Identification, and purity is more than 98%, and molecular weight conforms to theoretical value.
Four, the foundation of linear seven peptide sequences
Similarly, applicant is according to above-mentioned identical method, established another kind ofly to go out the protein sequence that external source inserts and be: the aminoacid sequence of linear seven peptides is LPLTPLP(SEQ ID NO:1).
The anti-tumor in vivo effect that linearity seven peptides that embodiment 1, the sequence obtaining are LPLTPLP are combined with antitumor drug
This example is connected this targeting peptides and builds targeted nano preparation with medicament-carried nano preparation.
The preparation of targeted nano preparation
The medicine-carried nano particles of inclusion Docetaxel is resuspended in MES buffered soln, add coupling condensing agent, after incubated at room 15min, the targeting peptides that adds 0.1mg/ml, the sequence of described targeting peptides is LPLTPLP, Stirring reaction 2 hours, the centrifugal 10min of 15000rpm collects particle, and three postlyophilizations of resuspended washing obtain targeted nano preparation.
Anti-tumor in vivo treatment experimental study
50 of Balb/c nude mices, after conforming, in 106, right side armpit place subcutaneous injection A549 cell/only, after 2 weeks, tumour starts to form, measure major diameter and the minor axis of knurl piece and calculate knurl volume (knurl volume=0.5x major diameter x minor axis for every 3 days
2), when knurl volume reaches 150mm
3after, give respectively conventional Docetaxel 10mg/kg(conventional medicine group), Docetaxel nanometer formulation 10mg/kg(nanometer formulation group), Docetaxel targeting peptides nanometer formulation 10mg/kg(targeting peptides nanometer formulation high dose group), Docetaxel targeting peptides nanometer formulation 5mg/kg(target receives peptide metric system agent low dose group) and physiological saline (model group).Knurl volume during with administration is for the first time denoted as V
0, be administered once weekly, record weekly body weight and the knurl volume situation of twice animal, note knurl volume is V
t, calculate relative tumour volume (V
t/ V
0) the affect situation of expression medicine on tumor growth.
The weight of animals monitoring curve shows, reduces after using dosage, and the tolerance of animal is better, and body weight has certain rising (Fig. 1) with comparing before.Administration rises on the 20th day, compares with control group, and the relative tumour volume of targeting peptides nanometer formulation group has had significantly and reduces (p<0.05).And conventional medicine and non-targeted peptide nanometer formulation just demonstrated certain antitumor action in the time of the 24th day.In the time of the 28th day, compare with control group, the relative tumour volume of each administration group has all had significantly and has reduced, and compares with conventional Docetaxel group, the antitumous effect of targeted nano preparation further improves (p<0.05) (Fig. 2, Fig. 3 A and 3B).In body result, show, the treatment plan of long-term low dose has obtained and the similar result of high-dose therapy scheme in early stage, targeted nano preparation low dose group, although its dosage only has conventional medicine group half, but still show the anti-tumor capacity suitable with high dose medicament, show that our nano target preparation has obvious treatment advantage.
In order further to verify the targeting of nanometer formulation, we have carried out drug distribution observation.Result shows, after Docetaxel administration, be distributed in rapidly each tissue in body, in liver, spleen, lung, nephridial tissue, targeting preparation group at the drug level of each time point all lower than conventional formulation group, and in tumor tissues and heart, the drug level of targeting preparation group is higher than conventional formulation group (table 1).Highly enriched in tumour of medicine, shows that nanometer formulation has good targeting, has improved the selectivity of medicine to tumor tissues.And in heart, because heart is the organ that is rich in blood vessel, in the enrichment of heart tissue, also reflected that the Plasma Concentration of targeting preparation has obtained certain raising in side, and the transformation period is longer.
Table 1 Docetaxel conventional formulation and targeted nano preparation distribute in the body of tumor animal
In sum, external and show that in body experiment we design and the targeting preparation prepared has improved the targeting of tumor tissues and the specific killing ability to tumor tissues, the using dosage that reduces antitumor drug has also improved chemotherapeutic index.
The anti-tumor in vivo effect that the cyclic peptide that embodiment 2, the sequence obtaining are NH2-CVKTPAQSC-COOH is combined with antitumor drug
Originally research and analyse institute's calling sequence as shown in SEQ ID NO:2, for: NH2-CVKTPAQSC-COOH, wherein C and C are that two halfcystines have formed cyclic peptide with disulfide linkage.
Table 2 is listed after administration not hepatic metastasis situation on the same group.Serious with NDTX group hepatic metastases situation, its liver surface mean transferred tubercle number is 274, and TNDTX-H group liver surface mean transferred tubercle number less be 67.
Table 2, respectively organize liver surface Nodules cartogram
Each organizes the horizontal pathological change situation analysis of liver histological, sees Fig. 4,5.
As seen from Figure 4, compare with normal nude mice liver (Normal), the visible hepatocellular degeneration necrosis of control group (CON) nude mice liver is comparatively serious, and necrotic zone is extensive; Visible liver cell regeneration, proliferation of fibrous tissue, tumor cell invasion is little bulk, nodositas.Conventional medicine group (DTX) hepatic disease limitation, necrotic area is little compared with control group, has proliferation of fibrous tissue, and tumor-infiltrated limited speed has liver cell regeneration and nuclear fission phenomenon.
As seen from Figure 5, the visible liver sinusoid of Nano medication group (NDTX) is obviously congested, there are a plurality of congested tube chambers, tumour cell replaces liver cell completely, the a large amount of hyperplasia of fibrous tissue, hepatic tissue is subject to havoc, has the remaining and swelling of liver cell of a small amount of liver cell, visible part region cancer cell infiltration, tumour cell is bulk, streak being present in fibrous tissue.The visible liver of targeted nano medicine low dose group (TNDTX-L) forms little focal necrosis, and necrosis region is Chang Kejian tumour cell around, and capillary vessel, proliferation of fibrous tissue are light compared with control group hepar damnification.The visible special mess of targeted nano medicine high dose group (TNDTX-H) necrotic area, proliferation of fibrous tissue in district, cell infiltration, and forms obvious wall around; In liver cell, occur necrotic area not of uniform size, there is hemosiderosis necrotic area around, with around liver cell boundary line is obvious, and blood capillary proliferation in district, edge's visible cell fragment is light compared with control group lesion degree.
Visible CONZu liver tissue lesions is comparatively serious, has large stretch of necrotic zone.In treatment group, except the liver injury of NDTX group is still serious, other groups all have liver injury in various degree to improve, and with TNDTX-L group liver injury significance, reduce, and are little focal necrosis; The also less and pathology limitation of TNDTX-H group hepar damnification, but liver injury degree is serious compared with TNDTX-L group; DTX group liver injury region is less than CON group, is greater than TNDTX-H group and TNDTX-L group.
Plasma hepatic damage index of correlation detected result
AFP level
Each organizes nude mice plasma A FP content results as Fig. 6.Visible TNDTX-L group AFP level is low compared with CON group, and has significant difference, shows that treatment has effectively alleviated liver injury; And NDTX group AFP value raises on the contrary, show that this medicine, to liver injury effect not obvious, may lack target ability due to it, in the pharmaceutically-active while, probably increased the weight of liver injury; DTX group AFP level is also high compared with CON group, and because it also lacks target ability, this group also has the possibility that increases the weight of liver injury; TNDTX-H group and CON group there was no significant difference, but its AFP level is low compared with CON group, has played the effect that alleviates liver injury.Two dosage groups of targeted nano medicine and Nano medication group all have significant difference, and low compared with control group A FP level, and visible Nano medication connects after targeting peptides, has significantly improved the target-seeking ability of medicine, and has improved result for the treatment of.
GPT level
Nude mice Plasma glutamate-pyruvate transaminase content results is as Fig. 7.Visible Plasma glutamate-pyruvate transaminase level raises with NDTX group significance, and other administration groups all have reduction in various degree than control group, show that each administration group has the effect of alleviating in various degree liver injury, and TNDTX-L group GPT level reduces compared with control group, but no difference of science of statistics.TNDTX-L group and TNDTX-H organize all has significant difference with NDTX group, has significantly improved drug targeting ability after showing to connect targeting peptides.
GOT level
Nude mice blood plasma GOT content results is as Fig. 8.Visible NDTX group GOT level is higher than CON group, and other treatment group GOT level is all low compared with CON group, shows that each treatment group alleviates liver injury effect in various degree.TNDTX-L group GOT content and CON group have significant difference, show that this target-oriented drug is good, and anti-liver metastasis is remarkable; Compare with DTX group, TNDTX-L group GOT content significantly reduces, and shows that the prepared anti-liver metastasis of targeted nano medicine is better than conventional medicine, can significantly reduce liver injury.TNDTX-L group is compared GOT content with NDTX group significant difference, shows that targeted nano medicine ratio nano medicine has better target ability.
Claims (6)
1. the tumor specific target polypeptide as shown in SEQ ID NO:1 is being prepared early diagnosis of tumor and is treating the purposes in reagent, and wherein said tumour is derived from Non-small cell lung carcinoma.
2. purposes according to claim 1, wherein said tumor specific target polypeptide is prepared into cancer target agent.
3. purposes according to claim 1, wherein said tumor specific target polypeptide is connected with bioabsorbable polymer material poly(lactic acid).
4. purposes according to claim 3, wherein said bioabsorbable polymer material is nano material.
5. purposes according to claim 3, wherein said bioabsorbable polymer material poly(lactic acid) inclusion antitumor drug.
6. purposes according to claim 5, wherein said antitumor drug is Docetaxel.
Priority Applications (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310258476.0A CN103342735B (en) | 2013-06-26 | 2013-06-26 | Tumor specific target polypeptide and application thereof |
| CN201410246052.7A CN104017049B (en) | 2013-06-26 | 2013-06-26 | A kind of tumor specific target polypeptide and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310258476.0A CN103342735B (en) | 2013-06-26 | 2013-06-26 | Tumor specific target polypeptide and application thereof |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201410246052.7A Division CN104017049B (en) | 2013-06-26 | 2013-06-26 | A kind of tumor specific target polypeptide and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103342735A CN103342735A (en) | 2013-10-09 |
| CN103342735B true CN103342735B (en) | 2014-10-08 |
Family
ID=49277570
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310258476.0A Active CN103342735B (en) | 2013-06-26 | 2013-06-26 | Tumor specific target polypeptide and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103342735B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3964520A4 (en) * | 2019-05-02 | 2023-05-10 | L-Base Co.,Ltd. | Novel oligopeptide, and pharmaceutical composition for preventing or treating cancer, comprising same as active ingredient |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104800858B (en) * | 2015-04-27 | 2017-11-21 | 中国医学科学院基础医学研究所 | HSP90 suppresses peptide conjugate and its application in oncotherapy |
| CN107936084A (en) * | 2017-11-01 | 2018-04-20 | 十堰市太和医院 | A kind of production method for the CAP23145 polypeptides based on targeting FMRP for treating glioma |
| CN108285479B (en) * | 2018-02-02 | 2020-07-03 | 南华大学 | Heptapeptide and application thereof in preparation of product for treating and/or diagnosing cervical cancer |
| CN108285480B (en) * | 2018-02-02 | 2021-02-05 | 南华大学 | Dodecapeptide and application thereof in preparation of products for treating and/or diagnosing cervical cancer |
| CN108794581B (en) * | 2018-06-26 | 2021-09-10 | 江苏大学 | Specific D-type polypeptide combined with lymphoma cell line in targeted mode and application thereof |
| CN112439074B (en) * | 2020-12-03 | 2022-09-13 | 浙江大学 | Conjugate capable of rapidly improving functional polypeptide affinity and preparation method and application thereof |
| CN113480603B (en) * | 2021-07-13 | 2022-03-01 | 四川大学 | Specific short peptide targeting glioma cells, coding gene and application thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6399575B1 (en) * | 1998-11-10 | 2002-06-04 | Auburn University | Methods and compositions for targeting compounds to the central nervous system |
| CN101768210A (en) * | 2007-10-29 | 2010-07-07 | 昆明医学院第一附属医院 | Tumor targeting polypeptide and preparation method thereof |
| CN102060909A (en) * | 2009-11-11 | 2011-05-18 | 中国医学科学院放射医学研究所 | Tumor specific target polypeptide and application thereof |
-
2013
- 2013-06-26 CN CN201310258476.0A patent/CN103342735B/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6399575B1 (en) * | 1998-11-10 | 2002-06-04 | Auburn University | Methods and compositions for targeting compounds to the central nervous system |
| CN101768210A (en) * | 2007-10-29 | 2010-07-07 | 昆明医学院第一附属医院 | Tumor targeting polypeptide and preparation method thereof |
| CN102060909A (en) * | 2009-11-11 | 2011-05-18 | 中国医学科学院放射医学研究所 | Tumor specific target polypeptide and application thereof |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3964520A4 (en) * | 2019-05-02 | 2023-05-10 | L-Base Co.,Ltd. | Novel oligopeptide, and pharmaceutical composition for preventing or treating cancer, comprising same as active ingredient |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103342735A (en) | 2013-10-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103342735B (en) | Tumor specific target polypeptide and application thereof | |
| CN104017049B (en) | A kind of tumor specific target polypeptide and application thereof | |
| CN108473541A (en) | Pass through the peptide compounds and peptide conjugate of receptor-mediated regimen chemotherapy cancer | |
| CN105198964A (en) | Tumor targeted polypeptide, and preparation method and application thereof | |
| CN111253472B (en) | Novel polypeptide targeting multiple tumor cells and application thereof | |
| CN103012562A (en) | Dual-targeting D-configuration polypeptides and drug delivery system thereof | |
| CN102060909B (en) | Tumor specific target polypeptide and application thereof | |
| CN105983097A (en) | Antitumor preparation and preparation method for same | |
| CN110330551A (en) | A kind of cancer of pancreas specific bond peptide and preparation method thereof and purposes | |
| CN111393507B (en) | Novel polypeptide specifically bound with multiple tumor cells and application thereof | |
| CN107365361A (en) | Duplicate domain anchorin combined with PD L1 and application thereof | |
| CN108218961A (en) | A kind of Antigenic Peptide chain group for treating tumour and its application in drug | |
| CN115260290B (en) | Polypeptide targeting melanoma and application thereof | |
| CN101503473A (en) | Targeted polypeptide for diagnosing and treating lung cancer in vivo and in vitro and use thereof | |
| CN111518171B (en) | Polypeptide targeting human hepatoma cells and application thereof | |
| CN101870726A (en) | Peptide - cisplatin conjugate and preparation method and application thereof | |
| CN101255190B (en) | Use of human midkine protein blocking peptide in preparation of antitumor medicament | |
| CN107353325A (en) | Folacin receptor alpha specific WHWTNWGKTSPA and its application | |
| CN113527429B (en) | Human liver cancer cell specific binding polypeptide and its use | |
| CN113583095A (en) | Antitumor polypeptide and application thereof | |
| CN105713070A (en) | Polypeptide specifically bound with human breast cancer cell and application thereof | |
| CN112661812A (en) | KK-LC-1 antigen targeted binding peptide, derivative, probe and application thereof | |
| CN1328289C (en) | Endothelium chalone capable of improving antitumor activity with changed structure and its use | |
| CN107412725A (en) | Sustained release preparation | |
| CN102532268B (en) | Oligopeptide with breast cancer resistant activity and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |