CN103333871A - Heat-resisting alkali-resisting and salt stable inulase exonuclease, and coding gene and application thereof - Google Patents
Heat-resisting alkali-resisting and salt stable inulase exonuclease, and coding gene and application thereof Download PDFInfo
- Publication number
- CN103333871A CN103333871A CN2013102756339A CN201310275633A CN103333871A CN 103333871 A CN103333871 A CN 103333871A CN 2013102756339 A CN2013102756339 A CN 2013102756339A CN 201310275633 A CN201310275633 A CN 201310275633A CN 103333871 A CN103333871 A CN 103333871A
- Authority
- CN
- China
- Prior art keywords
- enzyme
- inulinase
- inulase
- resisting
- circumscribed inulinase
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
Landscapes
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses an amino acid sequence and a nucleotide sequence of a heat-resisting alkali-resisting and salt stable inulase exonuclease, and construction and application of an inulase exonuclease recombinant expression vector. Results of enzymatic property research show that the optimum reaction conditions of the inulase exonuclease are as below: pH 7.0, 50 DEG C and 10% NaCl. The enzyme can catalyze the hydrolysis of inulase, levan, sucrose, raffinose, kestose, nystose and Kestopentaose. In a catalysis process using inulase as a substrate, only generation of fructose is detected rather than oligosaccharide or other carbohydrates. The inulase exonuclease provided by the invention can be applied to the field of food industry and biological energy source as a novel biocatalyst for fructose production.
Description
Technical field
The invention belongs to biological technical field, in particular to structure and the application thereof of the aminoacid sequence of the stable circumscribed inulinase of a kind of alkali-resistant and salt and nucleotide sequence, circumscribed inulinase recombinant expression vector.
Background technology
Inulin (Inulin) is called synanthrin again, because being the earliest separates to gain the name from feverfew.Liliaceae in 11 sections such as the composite family in the occurring in nature dicotyledons, Gentianaceae, radix platycodi section and the monocotyledons, Gramineae etc. all contain inulin.Inulin is present in the plants such as jerusalem artichoke, witloof, taraxacum, burdock and Garden Dahlia in a large number, and these plants are extensively planted in China.Inulin be by the D-fructofuranose through β-2, the polyfructosan that 1-glycosidic link dehydration is polymerized.The reducing end of inulin is linear chain structure with the glucosyl residue of α-(1,2)-glycosidic link connection a part.The physiological function of inulin has caused that the whole world pays close attention to widely.Studies show that inulin belongs to a kind of soluble dietary fibre, is bifidus bacillus and milk-acid bacteria enhancement factor in the body, has the important physical function.Inulin can improve the microenvironment of enteron aisle, promotes the absorption, the particularly absorption of skeletonization such as calcium, magnesium element of mineral element.Inulin can not be resolved into the carbohydrate that can directly absorb by human consumption, thereby can not influence the level of blood sugar, and inulin has certain effect to regulating blood sugar.Inulin can also be by reducing the content of blood cholesterol and triglyceride, and the level of regulating blood fat reduces the harm of cardiovascular disorder.Inulin is the food fibre of solubility, can not be by digestibility and utilization, and can obesity prevention.Inulin has potential antitumous effect in addition, and inulin is produced the lipid acid, particularly butyric acid of short chain behind some fermentation using bacteria in enteron aisle, have antitumous effect.Inulin can hydrolysis generate fructose and fructo-oligosaccharide under the effect of inulinase.Fructose sugariness height, raciness, calorific value is low, is difficult for causing carious tooth, and the diabetic subject also can utilize.Sweet, tasty and refreshing because of high fructose syrup flavor again, the osmotic pressure height, preservation is effective, so oneself becomes the main sweeting agents of a lot of countries in the world.Oligofructose can suppress Salmonella and colibacillary growth in the intestines, promotes functions of intestines and stomach, reduces corrupt substance in the intestines, prevents constipation, increases the synthetic of VITAMIN, improves the animal immune function; Promote the propagation of bifidus bacillus in the body, set up the dominant population of bifidus bacillus; Promote absorbing of trace elements iron, calcium; The liver that watches for animals promotes nutrition to transform, and is a kind of functional feedstuff additive, the plasmosin that is otherwise known as (PPE).
According to the difference of effect substrate mode, the different inulinases of cutting Polylevulosan chain mode according to the inulinase enzyme can be divided into endoinulase (EC3.2.1.7) and circumscribed inulinase (EC3.2.1.80) in other words.The source of inulinase is very wide, comprises the many microorganisms in plant, soil, water and the animal digestive tract of occurring in nature, can secrete inulinase.Microbe-derived inulinase kind is many, and Heat stability is good is suitable for fermentative production.
In the research of inulinase with the main difficulty that runs in using: one, produce the cost height of enzyme, cause the cost height of using.Show that mainly the yield of enzyme that produces the inulinase bacterial strain is low, thereby improved application cost, restricted oligofructose in foodstuffs industry, fodder industry and bioenergy Application for Field.Two, the suitableeest enzyme reaction pH of the inulinase of industrial production use at present is sour environment (pH5.5-6.5), and under neutral pH or alkaline pH envrionment conditions, the activity of enzyme and the stability of enzyme thereof reduce greatly.This has limited the application of inulinase in alkaline environment to a certain extent.
Summary of the invention
The purpose of this invention is to provide the stable circumscribed inulinase of a kind of alkali-resistant and salt, particularly, one aspect of the present invention relates to circumscribed inulinase, and the aminoacid sequence of this excision enzyme is SEQ ID NO.1.
The present invention also relates to the corresponding gene of aminoacid sequence of this circumscribed inulinase on the other hand, and the nucleotides sequence of described gene is classified SEQ ID NO.2 or its complementary sequence as.
On the other hand, the invention still further relates to the recombinant vectors pET28a-InuB that contains above-mentioned nucleotide sequence, the building process of recombinant expression vector is seen Fig. 1.
On the other hand, the invention still further relates to the preparation method of above-mentioned circumscribed inulinase, it is characterized in that comprising the steps:
With transfering loop with Bacillus licheniformis XJ-2 inoculation in the triangular flask that contains 50ml LB liquid nutrient medium, cultivation 24h under 37 ℃ of conditions, in the constant temperature vibration shaking table (180 rev/mins), culture is transferred in the 50ml centrifuge tube, at 4 ℃, 8000 rev/mins centrifugal 10min, abandoning supernatant fully suspends bacterium mud with the 8ml aqua sterilisa.Use the total DNA extraction test kit to extract total DNA of Bacillus licheniformis XJ-2 bacterial strain, the concrete operations step is undertaken by the specification sheets of test kit.Be masterplate (Chinese common micro-organisms DSMZ patent deposit number: CGMCC7546) with the Bacillus licheniformis XJ-2 bacterial strain that extracts, use primer Orf-F:TAACATATGAACAGAATTCAGCAGGCAGAAG and Orf-R:CAGGATCCTCATTTGGCTTCATCACCTTTCC to increase, collect dna fragmentation, use the dna fragmentation of Nde I and BamHI double digestion pcr amplification, enzyme is cut product and is connected to pET28a (+) skeleton carrier of crossing with NdeI and BamHI double digestion, structure obtains prokaryotic expression carrier pET28a-InuB (Fig. 1), change in the e. coli bl21 (DE3), induce through IPTG and to carry out heterogenous expression, the centrifugal supernatant of abandoning, the ultrasonic disruption cell, broken liquid produces NTA-Ni chromatography column purifying through Novagen company, and the collection molecular weight is the protein (Fig. 2) about 58kDa.The mensuration of inulinase protein content is write in " molecular cloning " (second edition) the Brandford method with reference to people such as Sa nurse Brookers and is carried out, and uses bovine serum albumin in contrast.
On the other hand, the invention still further relates to the application of above-mentioned circumscribed inulinase, it is characterized in that for hydrolytic inulin, levan, sucrose, raffinose, kestose, GF3 and GF4.
In a preferred embodiment of the present invention, described hydrolysis is at pH4.0-11.0, carries out under 20 ℃-70 ℃ and the 0-20%NaCl condition.
Zymologic property research is the result show: the optimum reaction conditions of this enzyme is: pH7.0,50 ℃ and 10%NaCl.The experimental result of the enzyme activity influence of different pH shows, enzyme is that relative enzyme activity under the 7.0-9.0 environment is greater than 66% at pH.Differing temps shows that to the experimental result of enzyme activity influence the optimal reactive temperature of enzyme is 50 ℃, and under 55 ℃ of reaction conditionss, enzyme activity still is 58% of maximum enzyme vigor.Different salt concn show the result of enzyme stability influence, in containing the solution of 20%NaCl, place 2h for 37 ℃, and the residual enzyme vigor of inulinase is still up to 70%.In addition, the thin-layer chromatography result shows: the enzyme solution hydrolytic inulin can generate fructose, and hydrolytic process does not detect the generation of oligosaccharide, shows that this enzyme is circumscribed inulinase.In sum, determine that this inulinase is the stable circumscribed inulinase of alkali-resistant and salt.Circumscribed inulinase of the present invention can be applicable in foodstuffs industry and the bioenergy field, is used for the production of fructose and fructo-oligosaccharide as a kind of new biological catalyst.
Microbial preservation information
Bacillus licheniformis (Bacillus licheniformis) XJ-2 bacterial strain, be preserved in China Committee for Culture Collection of Microorganisms common micro-organisms center, deposit number: CGMCC N0.7546, preservation address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City, Institute of Microorganism, Academia Sinica, preservation date is on May 02nd, 2013.
Description of drawings
Fig. 1. the structure of the circumscribed inulinase gene prokaryotic of Bacillus licheniformis XJ-2 bacterial strain carrier (pET28a-inuB)
Fig. 2 .SDS-PAGE detects Bacillus coli cells and expresses the circumscribed inulinase protein electrophoresis of Bacillus licheniformis XJ-2 bacterial strain figure: M wherein: albumen Marker (phosphatase-1 b, 97.2KDa; Bovine serum albumin, 66.4kDa; Ovalbumin, 44.2KDa; The carbon neuraminidase, 29KDa; Trypsin inhibitor, 20.1KDa; N,O-Diacetylmuramidase, 14.3KDa); Swimming lane 1 (control sample): e. coli bl21 (DE3) ultrasonic disruption liquid; Swimming lane 2 (laboratory sample): the e. coli bl21 after IPTG induces (DE3) (containing the pET28a-InuB plasmid) ultrasonic disruption liquid; Swimming lane 3: with the protein sample of swimming lane 2 by the elutriant behind the NTA-Ni post.
Fig. 3. different pH values are to the influence of inulinase enzyme activity
Fig. 4. the differential responses temperature is to the influence of inulinase enzyme activity
Fig. 5. different N aCl concentration is to the influence of inulinase enzyme activity
Fig. 6. inulinase is the enzyme stability under the different N aCl concentration (acting on 2h under 37 ℃ of conditions)
Fig. 7. thin-layer chromatography (TLC) detects the hydrolysate behind the different substrates of circumscribed inulinase hydrolysis
From left to right: swimming lane 1, sucrose; Swimming lane 2, glucose, swimming lane 3, kestose; Swimming lane 4, GF3; Swimming lane 5, GF4; Swimming lane 6, the hydrolysis of inulin thing; Swimming lane 7, the levan hydrolyzate; Swimming lane 8, cane sugar hydrolysate; Swimming lane 9, the kestose hydrolyzate; Swimming lane 10, the GF3 hydrolyzate; Swimming lane 11, the GF4 hydrolyzate.
Fig. 8. thin-layer chromatography (TLC) detects the hydrolysate of different time Bacillus licheniformis XJ-2 inulinase hydrolytic inulin: from left to right: swimming lane 1, glucose; Swimming lane 2, fructose; Swimming lane 3, the hydrolyzate of hydrolysis 0.5h; Swimming lane 4, the hydrolyzate of hydrolysis 1h; Swimming lane 5, the hydrolyzate of hydrolysis 2h; Swimming lane 6, the hydrolyzate of hydrolysis 4h; Swimming lane 7, the hydrolyzate of hydrolysis 8h
Embodiment
Embodiment 1:
Material and reagent
Jiaozhou Bay's seawater shines the bed mud in saltworks's concentraing pond.
Bacillus coli DH 5 alpha, e. coli bl21 (DE3); Cloning vector: pMD18-T vector (available from Dalian TaKaRa company), pET28a (+) (available from Novagen company).
Test medium:
LB liquid nutrient medium: write " molecular cloning " (second edition) with reference to people such as Sa nurse Brookers; LB solid medium: write " molecular cloning " (second edition) with reference to people such as Sa nurse Brookers]
Total DNA extraction test kit: give birth to worker Bioisystech Co., Ltd (Sangon) available from Shanghai.
DNA reclaims test kit: give birth to worker Bioisystech Co., Ltd (Sangon) available from Shanghai
Protein and DNA marker: give birth to worker Bioisystech Co., Ltd (Sangon) available from Shanghai
Taq polysaccharase, various restriction enzyme are available from the precious biotech firm of Dalian TaKaRa.
Instrument
PCR instrument, nucleic acid-protein detector, gel imaging system, Ultralow Temperature Freezer, low temperature ultracentrifuge, electrophoresis apparatus, ice-making machine, constant-temperature shaking culture case, constant incubator, Bechtop, automatic high pressure steam sterilizing pot, thermostat water bath, micropipet, ultrapure water instrument
The preparation of solution commonly used: with reference to " molecular cloning " (second edition)
Make up expression vector and the heterogenous expression of prokaryotic cell prokaryocyte
The molecular biology routine operation, as: restriction enzyme digestion, connection, plasmid transform (CaC12 method), and concrete steps are write " molecular cloning " (second edition) with reference to people such as Sa nurse Brookers and carried out.
With Bacillus licheniformis XJ-2 bacterial strain (Chinese common micro-organisms DSMZ, deposit number: CGMCC7546) total DNA is masterplate, use primer Orf-F and Orf-R (Orf-F:TAACATATGAACAGAATTCAGCAGGCAGAAG and Orf-R:CAGGATCCTCATTTGGCTTCATCACCTTTCC), it is the dna fragmentation (SEQ ID NO.2) of 1479bp that pcr amplification obtains the expection size, use the dna fragmentation of NdeI and BamHI double digestion pcr amplification, enzyme is cut product and is connected to pET28a (+) skeleton carrier of crossing with the same enzyme double digestion, structure obtains prokaryotic expression carrier pET28a-inuB (Fig. 1), adopts CaCl
2Method changes prokaryotic expression carrier pET28a-inuB in e. coli bl21 (DE3) competent cell over to, induce through IPTG and to carry out heterogenous expression, the centrifugal supernatant of abandoning, the ultrasonic disruption cell, the NTA-Ni chromatography column purifying that broken liquid produces through Novogen company, sample behind the SDS-PAGE electrophoresis detection purifying, the result shows that size is about the single protein band (Fig. 2) of 58kDa, the aminoacid sequence of protein band is SEQ ID NO.1.
The zymologic property of expressing protein is identified
The measuring method of inulinase enzyme activity: it is 2% substrate that the 50mM phosphate buffered saline buffer (pH7.0) that contains 10%NaCl at 0.9ml adds final concentration, 50 ℃ of water-bath preheating 10min, the purifying inulinase solution that adds 0.1ml afterwards, reaction is 30 minutes under 50 ℃ of conditions, 3,5-dinitrosalicylic acid colorimetry (DNS method) is measured the growing amount of reducing sugar.Enzyme unit alive (U) is defined as the per minute hydrolysis substrate and generates the required enzyme amount of 1 micromole's reducing sugar.
Optimal reaction pH determines
Use 50mM citric acid-Na respectively
2HPO
4Damping fluid (pH3.0-6.0), 50mM phosphate buffered saline buffer (pH6.0-7.0), 50mM Tris-HCl damping fluid (pH7.0-8.0), 50mM glycine-NaOH damping fluid (9.0-11.0) preparation 2% substrate solution, the enzyme-substrate reactions system is at 50 ℃ of reaction 30min, the relative enzyme that uses the DNS method to measure under the condition of different pH is lived, and the optimal pH of determining enzyme reaction is 7.0 (Fig. 3).
Determining of optimal reactive temperature
Place the water bath with thermostatic control of 30 ℃, 40 ℃, 50 ℃, 60 ℃ and 70 ℃ to react 30min respectively the enzyme-substrate reactions system, the relative enzyme that uses the DNS method to measure is at each temperature lived, and the optimum temperuture of determining enzyme reaction is 50 ℃ (Fig. 4).
Determining of optimal reaction salinity
The NaCl that in 50mM phosphate buffered saline buffer (pH7.0), adds different concns, final concentration is respectively 0%, 1%, 3%, 5%, 8%, 10% and 15%, prepare 2% substrate solution, the enzyme-substrate reactions system is at 50 ℃ of reaction 30min, the relative enzyme that uses the DNS method to measure under the different N aCl condition is lived, and the optimal salinity of determining enzyme reaction is 10% (w/v) * (Fig. 5).
The salt-stable test of enzyme
Add the NaCl crystal in inulinase solution, make the final concentration of NaCl be respectively 0%, 1%, 3%, 5%, 8%, 10%, 15% and 20% (w/v) * places 2h down in 37 ℃, takes out enzyme liquid afterwards, uses the DNS method to measure its residual enzyme vigor.Be made as 100% with the inulinase enzyme activity that contains 3%NaCl.Determine that inulinase is in reaction system NaCl concentration at 20% o'clock, place 2h down for 37 ℃, the residual enzyme vigor is still up to being 70% (Fig. 6).Show that enzyme has good salt-stable.
The substrate specificity test
In order to detect the substrate specificity of purifying enzyme, at 50mM phosphate buffered saline buffer (pH7.0, contain 10%NaC1) in to add final concentration respectively be 2% sucrose, inulin, levan, melizitose, raffinose, kestose, GF3, GF4, maltose, lactose and semi-lactosi, under the reaction conditions of 50 ℃, pH7.0 and 5%NaCl, act on 30min, use the DNS method to measure the growing amount of reducing sugar.Test-results shows, purifying enzyme can sucrose hydrolysis, inulin, levan, raffinose, kestose, GF3 and GF4, can not the hydrolysis melizitose, maltose, lactose and semi-lactosi.Inulinase the results are shown in Table 1 to the enzyme activity determination of different substrates, and experimental result shows that this enzyme is inulinase.
The circumscribed inulinase of table 1. Bacillus licheniformis XJ-2 bacterial strain (r-1nuB) is to the enzyme activity determination result of different substrates
*: the final concentration of substrate is 3% (w/v).
The detection of hydrolysate
Adding final concentration respectively at the 50mM of 0.9ml phosphate buffered saline buffer (pH7.0) is 2% different substrates (sucrose, inulin, levan, raffinose, kestose, GF3 and GF4), 50 ℃ of water-bath preheating 10min, the purifying inulinase solution that adds 0.3U afterwards, reaction is 30 minutes under 50 ℃ of conditions, and 100 ℃ are boiled 10 minutes to stop enzyme reaction.Get each time period hydrolysate 40 μ l, use thin-layer chromatography (TLC) to detect the hydrolysate of purifying enzyme sucrose hydrolysis, inulin, levan, raffinose, kestose, GF3 and GF4, the developing agent that thin layer chromatography analysis uses is propyl carbinol: Virahol: Glacial acetic acid: water=7:5:4:2. developer is aniline, 2ml; Pentanoic, 2g are dissolved in 100ml methyl alcohol, add the 15ml strong phosphoric acid again.Color condition is 85 ℃ of baking 10-15min down.The result shows that the resultant after the hydrolysis is fructose, wherein also detects exist (Fig. 7) of a small amount of glucose in the hydrolysate of kestose, GF3 and GF4.
Inulin is in the detection of different time hydrolysis resultant
Add the inulin that final concentration is 0.5% (w/v) respectively at the 50mM of 0.9ml phosphate buffered saline buffer (pH7.0), 50 ℃ of water-bath preheating 10min, the purifying inulinase solution that adds 0.3U afterwards, react 8h under 50 ℃ of conditions, be that 0h, 0.5h, 1h, 2h, 4h and 8h get 40 μ l from reaction mixture in the reaction times respectively, 100 ℃ are boiled 10 minutes to stop enzyme reaction.Use thin-layer chromatography (TLC) to detect the hydrolysate of different time sections behind the inulinase hydrolytic inulin, the developing agent of thin-layer chromatography is propyl carbinol: Virahol: Glacial acetic acid: water=7:5:4:2. developer is aniline, 2ml; Pentanoic, 2g are dissolved in 100ml methyl alcohol, add the 15ml strong phosphoric acid again.Color condition is 85 ℃ of baking 10-15min down.The thin-layer chromatography experiment detects in whole hydrolytic process only has fructose to generate, and does not have oligosaccharide or other glucides to generate (Fig. 8), shows that this inulinase is circumscribed inulinase.
* annotate: w/v representative: the ratio of quality (g)/volume (ml); The h representative: hour; The min representative: minute
The above only is the specific embodiment of the present invention, but protection scope of the present invention is not limited thereto, and any variation or replacement of expecting without creative work all should be encompassed within protection scope of the present invention.Therefore, protection scope of the present invention should be as the criterion with the protection domain that claims were limited.
Claims (6)
1. circumscribed inulinase, the aminoacid sequence of this circumscribed inulinase is SEQ ID NO.1.
2. circumscribed inulinase gene, the nucleotides sequence of this gene is classified the corresponding nucleotide sequence SEQ of aminoacid sequence ID NO.2 or its complementary sequence of the described circumscribed inulinase of claim 1 as.
3. the carrier that contains the described circumscribed inulinase gene of claim 2, preferred, described carrier as shown in Figure 1.
4. the preparation method of the described circumscribed inulinase of claim 1 is characterized in that comprising the steps:
Be that (this bacterial strain deposit number is masterplate: CGMCC No.7546) with Bacillus licheniformis XJ-2 bacterial strain, use degenerated primer Orf-F (TAACATATGAACAGAATTCAGCAGGCAGAAG) and Orf-R (CAGGATCCTCATTTGGCTTCATCACCTTTCC) to increase, collect dna fragmentation, use the dna fragmentation of Nde I and BamHI double digestion amplification, enzyme is cut product and is connected to pET28a (+) skeleton carrier of cutting with the same enzyme enzyme, structure obtains prokaryotic expression carrier pET28a-inuB, change in the e. coli bl21 (DE3), induce through IPTG and to carry out heterogenous expression, the centrifugal supernatant of abandoning, the ultrasonic disruption cell, broken liquid is through NTA-Ni chromatography column purifying, and the collection molecular weight is the protein about 58kDa.
5. the application of the described circumscribed inulinase of claim 1 is characterized in that for hydrolytic inulin, sucrose, levan, raffinose, kestose, GF3 and GF4.
6. application according to claim 5, described hydrolysis is at pH4.0-11.0, carries out under 20-70 ℃ and the 0-20%NaCl condition.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310275633.9A CN103333871B (en) | 2013-07-03 | 2013-07-03 | Alkali-resistant and the stable exoinulinase of salt and encoding gene thereof and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310275633.9A CN103333871B (en) | 2013-07-03 | 2013-07-03 | Alkali-resistant and the stable exoinulinase of salt and encoding gene thereof and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103333871A true CN103333871A (en) | 2013-10-02 |
| CN103333871B CN103333871B (en) | 2016-06-01 |
Family
ID=49242074
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310275633.9A Expired - Fee Related CN103333871B (en) | 2013-07-03 | 2013-07-03 | Alkali-resistant and the stable exoinulinase of salt and encoding gene thereof and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103333871B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109207456A (en) * | 2018-10-19 | 2019-01-15 | 中国科学院天津工业生物技术研究所 | A kind of exoinulinase, preparation method and application |
| CN112725306A (en) * | 2021-01-13 | 2021-04-30 | 云南师范大学 | Inulase mutant MutY119T with changed thermal salinity and application thereof |
| CN112813050A (en) * | 2021-01-13 | 2021-05-18 | 云南师范大学 | Exo-inulinase mutant MutP126Q with reduced thermostability |
| CN112813053A (en) * | 2021-01-13 | 2021-05-18 | 云南师范大学 | Inulase mutant MutY119H and preparation method thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102559637A (en) * | 2012-03-12 | 2012-07-11 | 云南师范大学 | Exoinulinase Z2-5 with low-temperature activity and gene of exoinulinase Z2-5 |
-
2013
- 2013-07-03 CN CN201310275633.9A patent/CN103333871B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102559637A (en) * | 2012-03-12 | 2012-07-11 | 云南师范大学 | Exoinulinase Z2-5 with low-temperature activity and gene of exoinulinase Z2-5 |
Non-Patent Citations (1)
| Title |
|---|
| KUMIKO KATO，ET AL: "Purification and Properties of a Thermostable inulinase (β-D-Fructan Fructohydrolase) from Bacillus stearothermophilus KP1289", 《STARCH》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109207456A (en) * | 2018-10-19 | 2019-01-15 | 中国科学院天津工业生物技术研究所 | A kind of exoinulinase, preparation method and application |
| CN112725306A (en) * | 2021-01-13 | 2021-04-30 | 云南师范大学 | Inulase mutant MutY119T with changed thermal salinity and application thereof |
| CN112813050A (en) * | 2021-01-13 | 2021-05-18 | 云南师范大学 | Exo-inulinase mutant MutP126Q with reduced thermostability |
| CN112813053A (en) * | 2021-01-13 | 2021-05-18 | 云南师范大学 | Inulase mutant MutY119H and preparation method thereof |
| CN112813053B (en) * | 2021-01-13 | 2022-06-24 | 云南师范大学 | Inulase mutant MutY119H and preparation method thereof |
| CN112813050B (en) * | 2021-01-13 | 2022-08-30 | 云南师范大学 | Exo-inulinase mutant MutP126Q with reduced thermostability |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103333871B (en) | 2016-06-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Kango | Production of inulinase using tap roots of dandelion (Taraxacum officinale) by Aspergillus niger | |
| Guimarães et al. | Characterization of α-galactosidases from germinating soybean seed and their use for hydrolysis of oligosaccharides | |
| Manoochehri et al. | A review on invertase: Its potentials and applications | |
| Wang et al. | Conversion and degradation of shellfish wastes by Serratia sp. TKU016 fermentation for the production of enzymes and bioactive materials | |
| Wu et al. | Purification and characteristics of fucoidanase obtained from Dendryphiella arenaria TM94 | |
| Kitaoka et al. | Characterization of a bacterial laminaribiose phosphorylase | |
| Nihira et al. | Discovery of cellobionic acid phosphorylase in cellulolytic bacteria and fungi | |
| CN110452845B (en) | Escherichia coli for producing sucrose phosphorylase | |
| Pessoni et al. | Purification and properties of exo-inulinases from Penicillium janczewskii growing on distinct carbon sources | |
| CN103333871B (en) | Alkali-resistant and the stable exoinulinase of salt and encoding gene thereof and application | |
| Ojwach et al. | Purification and biochemical characterization of an extracellular fructosyltransferase enzyme from Aspergillus niger sp. XOBP48: implication in fructooligosaccharide production | |
| CN102154239B (en) | New gene of beta-galactosidase with high glycosyl transfer efficiency and application thereof | |
| Sutrisno et al. | A chitinase with high activity toward partially N-acetylated chitosan from a new, moderately thermophilic, chitin-degrading bacterium, Ralstonia sp. A-471 | |
| Goulas et al. | Expression of four β-galactosidases from Bifidobacterium bifidum NCIMB41171 and their contribution on the hydrolysis and synthesis of galactooligosaccharides | |
| CN102154190B (en) | Engineering escherichia coli capable of efficiently producing hyaluronic acid and preparation method thereof | |
| Peng et al. | Efficient hydrolysis of raw microalgae starch by an α-amylase (AmyP) of glycoside hydrolase subfamily GH13_37 | |
| CN102690795B (en) | Trehalose synthase of streptomyces griseochromogenes and coding gene and application of trehalose synthase | |
| Kawaguti et al. | Characterization of a glucosyltransferase from Erwinia sp. D12 and the conversion of sucrose into isomaltulose by immobilized cells | |
| Kovaleva et al. | Characteristics of inulinases: methods for regulation and stabilization of their activity | |
| Kim et al. | Characterization of novel thermostable dextranase from Thermotoga lettingae TMO | |
| Reddy et al. | Wheat straw hemicelluloses: Composition and fermentation by human colon Bacteroides | |
| Katapodis et al. | Production of β-fructofuranosidase from Sporotrichum thermophile and its application in the synthesis of fructooligosaccharides | |
| Anggraeni et al. | Characterization and Modeling of Thermostable GH50 Agarases from Microbulbifer elongatus PORT2 | |
| Zhang et al. | Characterization of a processive inulosucrase from Lactobacillus mulieris for efficient biosynthesis of high-molecular-weight inulin | |
| Kasperowicz et al. | Fructanolytic and saccharolytic enzymes of Treponema zioleckii strain kT |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20160601 Termination date: 20170703 |