CN103333812B - Recombinant pichia pastoris for expressing sturgeon oocyte maturity associated protein - Google Patents
Recombinant pichia pastoris for expressing sturgeon oocyte maturity associated protein Download PDFInfo
- Publication number
- CN103333812B CN103333812B CN201310231647.0A CN201310231647A CN103333812B CN 103333812 B CN103333812 B CN 103333812B CN 201310231647 A CN201310231647 A CN 201310231647A CN 103333812 B CN103333812 B CN 103333812B
- Authority
- CN
- China
- Prior art keywords
- pichia pastoris
- gthii
- protein
- sturgeon
- oocyte maturation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses recombinant pichia pastoris for expressing sturgeon oocyte maturity associated protein. The recombinant pichia pastoris is pichia pastoris GtHII beta alpha A1 with a registered number in General Microorganism Center of China Committee for Culture Collection of Microorganisms as CGMCC No.7394. The pichia pastoris is pichia pastoris GtHII beta alpha A1 disclosed by the invention is fermented for 96 hours in a BMGY culture medium; 1 liter of BMGY culture medium can produce 0.5g of GtHII beta alpha pure product.
Description
Technical field
The present invention relates to express the Recombinant Pichia pastoris of sturgeon oocyte maturation associated protein.
Background technology
Gadiformes fish are the ancient Chondrosteis of a class, have the title of living fossil, on fish evolutionary history, have critical role.Also there is important economic worth simultaneously, all in Critical Condition in various degree, be all listed in < < animals and plants kind in imminent danger international trade pact > > appendix II species in the world.
In order to save sturgeon resource and commercial purpose, propagate sturgeon all over the world artificially and constantly rise.But there is many difficulties in the artificial propagation of sturgeon: main because sturgeon sexual maturity evening time, the breeding cycle is long, breeds and is generally 2-3 interval time; In addition under natural and breeding environment, all find that there is the asynchrony phenomenon of raun gonad development, because cultivating condition and natural surroundings differ larger, the sexual gland of many sturgeon breedings can not normal development.
In the artificial propagation practice of sturgeon breeding, often need to inject some odinagogues and impel Gunther parent fish spawning.At present, in fish farming, widely used odinagogue has three kinds: pituitary gland, chorionic-gonadotropin hormone and luteinizing hormone-releasing hormone analogue (LRH-α).But all there is weak point separately in these odinagogues, although for example pituitary gland has significant dematuration, obtain difficulty, of a high price; And the effect of other two kinds of odinagogues is sometimes unsatisfactory.Easily preparation of exploitation, the Novel parturition inducing agent that cost is low will promote propagating artificially of sturgeon.
Summary of the invention
Technical problem to be solved by this invention is to provide a kind of Recombinant Pichia pastoris and construction process thereof of expressing sturgeon oocyte maturation associated protein.
The construction process of the Recombinant Pichia pastoris of expression provided by the present invention sturgeon oocyte maturation associated protein, comprises the step that sturgeon oocyte maturation related protein gene is imported to the Recombinant Pichia pastoris that obtains expressing sturgeon oocyte maturation associated protein in the pichia pastoris phaff of Host Strains;
The name of described sturgeon oocyte maturation associated protein is called GtHII β α, be following a) or b) or protein c):
A) protein of aminoacid sequence as shown in SEQ ID No.2 1-221 position;
B) protein of aminoacid sequence as shown in SEQ ID No.2;
C) by a) or b) through replacement and/or disappearance and/or add that one or several amino-acid residue obtains relevant to sturgeon oocyte maturation by a) derivative protein.
Wherein, SEQ ID No.2 is comprised of 227 amino-acid residues, 222-227 position be 6 histidine-tagged.
In order to make above-mentioned albumen in a) be convenient to purifying, can connect upper label as shown in table 1 at above-mentioned N-terminal or C-terminal a).
The sequence of table 1 label
| Label | Residue | Sequence |
| Poly-Arg | 5-6(is generally 5) | RRRRR |
| Poly-His | 2-10(is generally 6) | HHHHHH |
| FLAG | 8 | DYKDDDDK |
| Strep-tag?II | 8 | WSHPQFEK |
| c-myc | 10 | EQKLISEEDL |
Above-mentioned c) protein in can first synthesize its encoding gene, then carries out biological expression and obtain.
In above-mentioned construction process, described sturgeon oocyte maturation related protein gene can be following 1)-6) in arbitrary described DNA molecular:
1) protein DNA molecule described in coding claim 1;
2) its encoding sequence is the DNA molecular of the 11-694 position Nucleotide of SEQ ID No.1;
3) its encoding sequence is the DNA molecular of the 11-673 position Nucleotide of SEQ ID No.1;
4) nucleotide sequence is the DNA molecular of SEQ ID No.1;
5) under stringent condition with 2), 3) or 4) DNA molecule hybridize limiting and the DNA molecular of coding GtHII β α;
6) with 2), 3) or 4) DNA molecular that limits has more than 90% homology and the DNA molecular of coding GtHII β α.
Above-mentioned stringent condition can be with 6 * SSC, the solution of 0.5%SDS, and at 65 ℃, hybridization, then uses 2 * SSC, 0.1%SDS and 1 * SSC, 0.1%SDS respectively washes film once.
Wherein, SEQ ID No.1 is comprised of 709 Nucleotide, and 674-691 position is 6 histidine-tagged encoding genes.
In above-mentioned construction process, described Host Strains can be pichia pastoris phaff (Pichia pastoris) X-33.
In above-mentioned construction process, described sturgeon oocyte maturation related protein gene imports in described Host Strains by recombinant expression vector, and described recombinant expression vector specifically can be the described sturgeon oocyte maturation of the expression associated protein recombinant expression vector with fragment obtains between the Xho I of described sturgeon oocyte maturation related protein gene replacement pPICZ α A and Not I.
In above-mentioned construction process, described Recombinant Pichia pastoris specifically can be pichia pastoris phaff (Pichia pastoris) GtHII β α A1, and registering on the books of Qi China Committee for Culture Collection of Microorganisms common micro-organisms center is numbered CGMCC No.7394.
The Recombinant Pichia pastoris of the expression sturgeon oocyte maturation associated protein that above-mentioned construction process obtains all belongs to protection scope of the present invention.
Experimental results show that, the GtHII β α that Recombinant Pichia pastoris of the present invention is expressed can induce the germinal vesicle of sturgeon ovocyte to break, can induce ovum finally ripe, wherein, the germinal vesicle rupture rate of the 0.8 μ g/mlGtHII β α solution induction ovocyte of 22 hours is higher than the progesterone solution of 1 μ g/ml.Illustrate that GtHII β α has the last ripe biological activity of induction sturgeon ovocyte.Pichia pastoris phaff of the present invention (Pichia pastoris) GtHII β α A1 ferments 96 hours in BMGY substratum, and 1 liter of BMGY substratum can output 0.5g GtHII β α sterling.
biomaterial information
Classification And Nomenclature: pichia pastoris phaff (Pichia pastoris)
Strain number: GtHII β α A1
Preservation mechanism: China Committee for Culture Collection of Microorganisms's common micro-organisms center
Preservation mechanism is called for short: CGMCC
Address: No. 3, Yard 1, BeiChen xi Road, Chaoyang District, Beijing City
Preservation date: on 04 01st, 2013
The preservation center numbering of registering on the books: CGMCC No.7394
Below in conjunction with specific embodiment, describe the present invention in detail, these embodiment are for understanding rather than restriction the present invention.
Accompanying drawing explanation
Fig. 1 is the structure schema of recombinant plasmid pPICZ alpha A-GtHII β α-A and pPICZ α A-GtHII β α-B.
Fig. 2 is the pcr amplification electrophorogram of DH5 α/pPICZ α A-GtHII β α-A and DH5 α/pPICZ α A-GtHII β α-B.
The pcr amplification product of 1-5:DH5 α/pPICZ α A-GtHII β α-A;
The pcr amplification product of 6-8:DH5 α/pPICZ α A-GtHII β α-B;
The PCR product of GtHII β α-A shown in 9:SEQ ID No.1 is as positive control;
10: bacillus coli DH 5 alpha is as negative control;
11: using the GtHII β α-B shown in SEQ ID No.3 PCR product as positive control;
M:DNA marker, unit is bp.
Fig. 3 is that Xylene Brilliant Cyanine G SDS-PAGE detects pichia pastoris phaff (Pichia pastoris) GtHII β α A1 expression product collection of illustrative plates.
1: pichia pastoris phaff (Pichia pastoris) GtHII β α A1 expression product;
M: albumen marker.
Fig. 4 is that Western Blot detects pichia pastoris phaff (Pichia pastoris) GtHII β α A1 expression product.
1: pichia pastoris phaff (Pichia pastoris) GtHII β α A1 expression product;
M: albumen marker.
Embodiment
Experimental technique in following embodiment, if no special instructions, is ordinary method.
In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.
The preparation of embodiment 1, GtHII β α and encoding gene thereof
1, GtHII β α expression vector builds
The present embodiment synthetic the GtHII β α DNA moleculars shown in two kinds of coding SEQ ID No.2, title is respectively GtHII β α-A and GtHII β α-B.The nucleotide sequence of GtHII β α-A is SEQ ID No.1, and its encoding sequence is the 11-694 position of SEQ ID No.1, and 5-10 position is Xho I recognition site (CTCGAG), and 698-705 position is NotI recognition site (GCGGCCGC).The nucleotide sequence of GtHII β α-B is SEQ ID No.3, and its encoding sequence is the 11-694 position of SEQ ID No.3, and 5-10 position is Xho I recognition site (CTCGAG), and 698-705 position is NotI recognition site (GCGGCCGC).
The PCR product of GtHII β α-A shown in SEQ ID No.1 is carried out to enzyme with Xho I and Not I to be cut, cut the yeast expression vector pPICZ α A(Invitrogen of processing with same enzyme) be connected, connect product and transform bacillus coli DH 5 alpha competent cell (Takara), through microbiotic Zeocin screening, obtain positive strain.The bacterium liquid of positive strain of take is template, with BIIA-F(5 ' CGGC
cTCGAGcTTAGATTGTGTGAACCAGTC3 ') and BIIA-R(5 ' GACG
gCGGCCGCtTATCAGTGATGGTGATGGTGATGGGTTTTATGGTAGTAACAGGT3 ') for primer carries out pcr amplification, amplification condition is: 94 ℃ of 45sec, and 58 ℃ of 45sec, 72 ℃ of 45sec, 30 circulations, last 72 ℃ are extended 10min.PCR product detects through 1% agarose gel electrophoresis, size and consistent (Fig. 2) of expecting.Get PCR and detect positive bacterium liquid and carry out sequence verification, by the PCR positive strain called after DH5 α/pPICZ α A-GtHII β α-A that contains the GtHII β α-A shown in SEQ ID No.1.According to the requirement of Omega plasmid extraction kit, from DH5 α/pPICZ α A-GtHII β α-A, extract plasmid, obtain recombinant expression vector
pPICZαA-GtHIIβα-A。PPICZ α A-GtHII β α-A is the recombinant expression vector with the GtHII β α shown in the expression SEQ ID No.2 that between the Xho I of the GtHII β α shown in SEQ ID No.1-A replacement pPICZ α A and Not I, fragment obtains.
According to identical method, by the GtHII β α-B shown in SEQ ID No.3 PCR product with Xho I and Not I, carry out enzyme and cut, cut the yeast expression vector pPICZ α A(Invitrogen of processing with same enzyme) be connected, connect product and transform bacillus coli DH 5 alpha competent cell (Takara), through microbiotic Zeocin screening, obtain positive strain.The bacterium liquid of positive strain of take is template, take BIIB-F(5 ' cggcctcgagctgcgcttgtgtgagccggtg3 ') and BIIB-R(5 ' GACGGCGGCCGCTTATCAGTGATGGTGATGGTGATGGGTTTTATGGTAGTAGCAGG T3 ') carry out pcr amplification as primer, amplification condition is: 94 ℃ of 45sec, 58 ℃ of 45sec, 72 ℃ of 45sec, 30 circulations, last 72 ℃ are extended 10min.PCR product detects through 1% agarose gel electrophoresis, size and consistent (Fig. 2) of expecting.Get PCR and detect positive bacterium liquid and carry out sequence verification, by the PCR positive strain called after DH5 α/pPICZ α A-GtHII β α-B that contains the GtHII β α-B shown in SEQ ID No.3.According to the requirement of Omega plasmid extraction kit, from DH5 α/pPICZ α A-GtHII β α-B, extract plasmid, obtain recombinant expression vector pPICZ α A-GtHII β α-B.PPICZ α A-GtHII β α-B is the recombinant expression vector with the GtHII β α shown in the expression SEQ ID No.2 that between the Xho I of the GtHII β α shown in SEQ ID No.3-B replacement pPICZ α A and Not I, fragment obtains.
As shown in Figure 1, GtHII β α wherein represents GtHII β α-A or GtHII β α-B to the structure flow process of pPICZ α A-GtHII β α-A and pPICZ α A-GtHII β α-B.
2, the structure of recombination yeast engineering bacteria and evaluation
With pPICZ α A-GtHII β α-A and pPICZ α A-GtHII β α-B, transform pichia pastoris phaff X-33 respectively, build GtHII β α recombination yeast engineering bacteria.Specific experiment method is as follows: get recombinant plasmid pPICZ alpha A-GtHII β α-A or pPICZ α A-GtHII β α-B20 μ g, by Sac I, at 37 ℃ of enzymes, cut 12hr, reclaim linearization plasmid, be dissolved in 15 μ L aqua sterilisas, obtain linearization plasmid.
Get 80 μ L pichia pastoris phaff (Pichia pastoris) X-33 competent cells (Invitrogen), add the 0.2cm sterilizing electricity of precooling to swash cup, then add the 10 μ l DNA of linearization for enzyme restriction, mix.Electricity is swashed to cup and be placed in 5min on ice, at Eppendorf electric exciter power on sharp (2000V, 25 μ Ω).After swash finishing, electricity adds rapidly 1ml1M sorbyl alcohol, as for 5min on ice.Electricity is swashed to liquid and proceed in the 10ml culture tube of a sterilizing, 28 ℃ of standing 2hr.The cell of conversion is coated on to 100 μ g/ml Zeocin YPDS(1% yeast extracts, 2% peptone, 2% glucose, 2% agar, containing 100 μ g/ml Zeocin) on.Cultivate 2-4 days, until grow bacterium colony clearly, be positive recombinant for 30 ℃.Longer mono-clonal on 100 μ g/ml Zeocin YPDS flat boards is inoculated into 500 μ g/ml Zeocin YPD dull and stereotyped (the Zeocin concentration in 100 μ g/ml Zeocin YPDS is adjusted into 500 μ g/ml), 1000 μ g/ml Zeocin YPD dull and stereotyped (the Zeocin concentration in 100 μ g/ml Zeocin YPDS is adjusted into 1000 μ g/ml) successively, each mono-clonal is numbered, filter out the mono-clonal of anti-1000 μ g/ml Zeocin, it is generally acknowledged that the mono-clonal with high resistance has high copy goal gene.The mono-clonal of the anti-1000 μ g/ml Zeocin that pPICZ α A-GtHII β α-A conversion pichia pastoris phaff X-33 is filtered out carries out PCR evaluation with above-mentioned BIIA-F and BIIA-R as primer, the recombinant bacterial strain of the PCR positive, extract plasmid, carry out enzyme and cut evaluation, and order-checking, obtain altogether the bacterial strain of the Recombinant Pichia pastoris (Pichia pastoris) that 4 strains contain the GtHII β α-A shown in SEQ ID No.1, difference called after pichia pastoris phaff (Pichia pastoris) GtHII β α A1, pichia pastoris phaff (Pichia pastoris) GtHII β α A2, pichia pastoris phaff (Pichia pastoris) GtHII β α A3 and pichia pastoris phaff (Pichiapastoris) GtHII β α A4.
The mono-clonal of the anti-1000 μ g/mlZeocin that pPICZ α A-GtHII β α-B conversion pichia pastoris phaff X-33 is filtered out carries out PCR evaluation with above-mentioned BIIB-F and BIIB-R as primer, the recombinant bacterial strain of the PCR positive, extract plasmid, carry out enzyme and cut evaluation, and order-checking, obtain altogether the bacterial strain of the Recombinant Pichia pastoris (Pichia pastoris) that 3 strains contain the GtHII β α-B shown in SEQ ID No.3, difference called after pichia pastoris phaff (Pichia pastoris) GtHII β α B1, pichia pastoris phaff (Pichia pastoris) GtHII β α B2 and pichia pastoris phaff (Pichia pastoris) GtHII β α B3.
By above-mentioned pichia pastoris phaff (Pichia pastoris) GtHII β α A1, pichia pastoris phaff (Pichia pastoris) GtHII β α A2, pichia pastoris phaff (Pichia pastoris) GtHII β α A3, pichia pastoris phaff (Pichia pastoris) GtHII β α A4, pichia pastoris phaff (Pichia pastoris) GtHII β α B1, pichia pastoris phaff (Pichia pastoris) GtHII β α B2 and this 7 strain bacterium of pichia pastoris phaff (Pichia pastoris) GtHII β α B3 are seeded to respectively in the 250mL triangular flask of content 25ml BMGY substratum, 28-30 ℃, 250-300rpm(rotation radius 13mm), shake to OD600=2-6.The centrifugal 5min of room temperature 1500g, collect thalline, remove supernatant, with the resuspended thalline of BMMY to OD600=1.0, according to 10%(volumn concentration) inoculum size access 1L triangular flask (in-built 200ml BMGY substratum) in, adding methyl alcohol to final concentration is 0.5%(volumn concentration), 28-30 ℃, 250-300rpm carries out abduction delivering.Every 24 hours, adding methyl alcohol to final concentration was 0.5%(volumn concentration) to continue abduction delivering.In induction fermenting process, respectively 24,48,72,96 and 120h collect supernatant after getting the centrifugal 5min of fermented product room temperature 1500g, obtain protein crude extract administration, by BCA method, detect protein concentration.To protein crude extract administration, with coomassie brilliant blue staining, to carry out gel strength (total mass concentration of monomer acrylamide and linking agent methylene diacrylamide in gelating soln) be 18% SDS-PAGE and as primary antibodie, carry out Western Blot evaluation by anti-6 histidine-tagged monoclonal antibodies (Novagen).Result shows pichia pastoris phaff (Pichia pastoris) GtHII β α A1, pichia pastoris phaff (Pichia pastoris) GtHII β α A2, pichia pastoris phaff (Pichia pastoris) GtHII β α A3, pichia pastoris phaff (Pichia pastoris) GtHII β α A4 has all obtained the protein band of size at 22-40kDa, in the protein crude extract administration that this four strains bacterium abduction delivering 96h obtains, protein concentration is the highest, in the protein crude extract administration that pichia pastoris phaff (Pichia pastoris) GtHII β α A1 abduction delivering 96h obtains, protein concentration is the highest, respectively 1.2 times of pichia pastoris phaff (Pichia pastoris) GtHII β α A2, 1.35 times of pichia pastoris phaff (Pichia pastoris) GtHII β α A3, 1.51 times of pichia pastoris phaff (Pichia pastoris) GtHII β α A4.Pichia pastoris phaff (Pichia pastoris) GtHII β α A1 was preserved in to China Committee for Culture Collection of Microorganisms's common micro-organisms center on 04 01st, 2013, the preservation center numbering of registering on the books: CGMCC No.7394.
Pichia pastoris phaff (Pichia pastoris) GtHII β α B1, pichia pastoris phaff (Pichia pastoris) GtHII β α B2 and pichia pastoris phaff (Pichia pastoris) GtHII β α B3 all do not detect protein band in SDS-PAGE and Western Blot evaluation.
Pour the protein crude extract administration of pichia pastoris phaff (Pichia pastoris) GtHII β α A1 fermentation 96h into handle well the His label affinitive layer purification post (U.S., Merck), add successively binding buffer(0.5M NaCl, 20mM Tris-HCl, 5mM imidazoles (imidazole), pH=7.9), wash buffer(0.5M NaCl, 60mM Tris-HCl, 20mM imidazole, pH=7.9) and elute buffer(0.5M NaCl, 1M Tris-HCl, 20mM imidazole, pH=7.9), collect the liquid finally obtaining.The liquid that collection is obtained respectively-80 ℃ freezing, after freezing, put into freeze drier and carry out lyophilize 24 hours, collect powder, obtain the GtHII β α sterling that pichia pastoris phaff (Pichia pastoris) GtHII β α A1 expresses.
After testing, under above-mentioned fermentation condition, pichia pastoris phaff (Pichia pastoris) GtHII β α A1 abduction delivering 96 hours, 1 liter of BMGY substratum output 0.5g GtHII β α sterling.
Embodiment 2, promotion sturgeon oocyte maturation
1, experiment material
1.1 ovocyte nutrient solutions
1.1.1RMS(Ringer ' s solution modified for sturgeons): NaCl6.5g, KCl0.25g, CaCl
20.3g, NaHCO
32g, water constant volume is to 1L.
1.1.2 progesterone solution: make progesterone final concentration be respectively 1 μ g/ml with the progesterone mother liquor of RMS dilution 1mg/ml, 0.5 μ g/ml, 0.25 μ g/ml, obtains 1 μ g/ml progesterone solution (P1 solution), 0.5 μ g/ml progesterone solution (P2 solution) and 0.25 μ g/ml progesterone solution (P3 solution).
Wherein, progesterone mother liquor is prepared as follows; Progesterone (progesterone, P) (Sigma, P0130) is dissolved in and in ethanol, obtains the progesterone mother liquor that Concentration of Progesterone is 1mg/ml.
1.1.3GtHII β α solution: make GtHII β α final concentration be respectively 0.8 μ g/ml and 0.4 μ g/ml with the GtHII β α mother liquor of RMS dilution 0.04mg/ml, obtain 0.8 μ g/ml GtHII β α solution (G1 solution) and 0.4 μ g/ml GtHII β α solution (G2 solution).
Wherein, GtHII β α mother liquor is prepared as follows: the GtHII β α sterling that the pichia pastoris phaff that embodiment 1 is obtained (Pichia pastoris) GtHII β α A1 expresses is dissolved in the 50mM Tris-HCl buffered soln of pH7.0, obtains the GtHII β α mother liquor that GtHII β α concentration is 0.04mg/ml.
2, experimental technique
Choose the female sterlet of sexual maturity (Beijing North wawter bloom logical sturgeon breed limited liability company) and induce final ripe test, the checking recombinant protein biological activity of hatching of ovocyte in vitro.When every sterlet is got IV, 300 of the ovocytes of phase are divided into 6 groups at random: blank group, P1 group, P2 group, P3 group, G1 group and G2 group, every group of 50 ovocytes.Carry out following experiment: in each culture dish, put 50 ovocytes simultaneously, add corresponding nutrient solution 15-16 ℃ cultivation, timing (changing liquid once in 10-12 hour), gets ovocyte detection for 0 hour, 12 hours, 14 hours, 18 hours and 22 hours respectively at adding nutrient solution; Get 10 ovocytes for each every group, be put into and in flask, boil 5min; Under stereoscope, along pole axis, cut ovum, observe and record the germinal vesicle rupture rate (germinal vesicle breakdown, GVBD) of ovocyte.Wherein, the corresponding nutrient solution adding in blank group is RMS, the corresponding nutrient solution that P1 group adds is P1 solution (1 μ g/ml progesterone solution), the corresponding nutrient solution that P2 group adds is P2 solution (0.5 μ g/ml progesterone solution), the corresponding nutrient solution that P3 group adds is P3 solution (0.25 μ g/ml progesterone solution), the corresponding nutrient solution that G1 group adds is G1 solution (0.8 μ g/ml GtHII β α solution), and the corresponding nutrient solution that G2 group adds is G2 solution (0.4 μ g/ml GtHII β α solution).Wherein, the germinal vesicle rupture rate of ovocyte is the germinal vesicle ovocyte number breaking and the oocyte number object ratio of cultivating.The nuclear membrane of ovocyte of take breaks, kernel disappears breaks as germinal vesicle.
Article 6, sterlet during totally 1800 IV the ovocyte of phase to cultivate the germinal vesicle rupture rate of ovocyte of different time as shown in table 2, result shows: 0.8 μ g/ml GtHII β α solution and 0.4 μ g/ml GtHII β α solution can both induce the germinal vesicle of sterlet ovocyte to break, can induce ovum finally ripe, wherein, 0.8 μ g/ml GtHII β α solution in the germinal vesicle rupture rate of the ovocyte of 22 hours the progesterone solution higher than 1 μ g/ml.Illustrate that GtHII β α has the last ripe biological activity of induction sturgeon ovocyte.
Table 2. sterlet ovocyte is cultivated the germinal vesicle rupture rate (%) of different time under different nutrient solutions
Claims (6)
1. express the construction process of the Recombinant Pichia pastoris of sturgeon oocyte maturation associated protein, comprise the step that sturgeon oocyte maturation related protein gene is imported to the Recombinant Pichia pastoris that obtains expressing sturgeon oocyte maturation associated protein in the pichia pastoris phaff of Host Strains;
Described sturgeon oocyte maturation associated protein be following a) or b) protein:
A) protein of aminoacid sequence as shown in SEQ ID No.2 1-221 position;
B) protein of aminoacid sequence as shown in SEQ ID No.2.
2. method according to claim 1, is characterized in that: described sturgeon oocyte maturation related protein gene is following 1)-4) in arbitrary described DNA molecular:
1) protein DNA molecule described in coding claim 1;
2) its encoding sequence is the DNA molecular of the 11-694 position Nucleotide of SEQ ID No.1;
3) its encoding sequence is the DNA molecular of the 11-673 position Nucleotide of SEQ ID No.1;
4) nucleotide sequence is the DNA molecular of SEQ ID No.1.
3. method according to claim 1 and 2, is characterized in that: described Host Strains is pichia pastoris phaff (Pichia pastoris) X-33.
4. method according to claim 3, it is characterized in that: described sturgeon oocyte maturation related protein gene imports in described Host Strains by recombinant expression vector, described recombinant expression vector is the described sturgeon oocyte maturation of the expression associated protein recombinant expression vector with fragment obtains between the Xho I of described sturgeon oocyte maturation related protein gene replacement pPICZ α A and Not I.
5. method according to claim 4, it is characterized in that: described Recombinant Pichia pastoris is pichia pastoris phaff (Pichia pastoris) GtHII β α A1, and registering on the books of Qi China Committee for Culture Collection of Microorganisms common micro-organisms center is numbered CGMCC No.7394.
6. the Recombinant Pichia pastoris of the expression sturgeon oocyte maturation associated protein that arbitrary described method builds in claim 1-4.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310231647.0A CN103333812B (en) | 2013-06-09 | 2013-06-09 | Recombinant pichia pastoris for expressing sturgeon oocyte maturity associated protein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310231647.0A CN103333812B (en) | 2013-06-09 | 2013-06-09 | Recombinant pichia pastoris for expressing sturgeon oocyte maturity associated protein |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103333812A CN103333812A (en) | 2013-10-02 |
| CN103333812B true CN103333812B (en) | 2014-09-10 |
Family
ID=49242017
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310231647.0A Expired - Fee Related CN103333812B (en) | 2013-06-09 | 2013-06-09 | Recombinant pichia pastoris for expressing sturgeon oocyte maturity associated protein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103333812B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113150104B (en) * | 2021-04-29 | 2022-05-17 | 湖南师范大学 | Protein for specific targeted fish egg cell transportation and preparation method and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102080095A (en) * | 2010-12-03 | 2011-06-01 | 中山大学 | Eukaryotic expression vector containing mature peptide gene of epinephelus coioids gonadotropin hormone I, recombinant strain, recombinant protein and application thereof |
-
2013
- 2013-06-09 CN CN201310231647.0A patent/CN103333812B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102080095A (en) * | 2010-12-03 | 2011-06-01 | 中山大学 | Eukaryotic expression vector containing mature peptide gene of epinephelus coioids gonadotropin hormone I, recombinant strain, recombinant protein and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| 毛黎敏，等.花鳗鲡重组促黄体生成素在毕赤酵母中的表达.《中山大学学报(自然科学版)》.2012,第51卷(第2期),86-90. * |
| 牛艳东.鳙鱼(Hypophthalmichthys Nobilis)促性腺激素基因的克隆、表达和序列分析.《 中国优秀硕士学位论文全文数据库》.2009,1-58. * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103333812A (en) | 2013-10-02 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103898153A (en) | Multi-copy metallothionein recombinant expression vector and method thereof for high-efficiency expression of metallothionein | |
| CN102199556A (en) | Saccharomyces cerevisiae genetic engineering bacteria with high ester yield and construction method thereof | |
| CN104694559A (en) | DNA segment for efficient expression of egg white lysozyme by employing recombinant pichia pastoris and expression method thereof | |
| CN101914565A (en) | Method for effectively expressing cationic antibacterial peptides in pichia pastoris | |
| CN103555756A (en) | Method for secretory expression of antibacterial peptide LfcinB by use of saccharomyces cerevisiae | |
| CN102676561B (en) | Recombinant bacterium for expressing keratinase and fermentation method thereof | |
| CN106978407A (en) | A kind of β glucuronidases and its gene and application | |
| CN103333910B (en) | Method for preparing mother cell maturation associated protein of sturgeon roe | |
| CN103342742B (en) | Sturgeon oocyte maturation associated proteins and correlation biomaterials thereof | |
| CN104263709A (en) | Egg-white lysozyme and preparation method thereof | |
| CN103333812B (en) | Recombinant pichia pastoris for expressing sturgeon oocyte maturity associated protein | |
| CN102010867A (en) | Yeast expression method for recombining major protein AccMRJP1 of apis cerana royal jelly and product application | |
| CN102618517A (en) | Zearalenone (ZEN) toxin degrading enzyme for acinetobacter and coding gene and applications of ZEN toxin degrading enzyme | |
| CN105039310A (en) | Kit for extracting agrobacterium tumefaciens plasmid DNA | |
| CN102994476A (en) | Saccharifying enzyme | |
| CN102061303B (en) | Fusion expression product of antimicrobial peptide genes of two marine animals and preparation method of fusion expression product | |
| CN103305426A (en) | Mutant strains for producing cellulose, mutant strains capable of performing high-efficiency expression on target proteins and construction methods and application of mutant strains | |
| CN104560833B (en) | A kind of basophilic micrococcus luteus and its alkalescent xylanase and the application of generation | |
| CN102898512B (en) | Recombinant plectasin as well as preparation method and application of recombinant plectasin | |
| CN109134627A (en) | Functional protein TP06128 and its encoding gene and application | |
| CN103966110A (en) | Penicillium oxalicum host strain for enhancing expression of filamentous fungi protein | |
| CN107904248A (en) | Application of the Chlamydomonas reinhardtii VMPL1 genes in Chlamydomonas reinhardtii cadmium tolerance is regulated and controled | |
| CN103045629A (en) | Lactase glucose depression knockout vector pMD19/HPT | |
| CN101643744A (en) | New method for fast selecting engineering bacteria of leaven of efficient expression antimicrobial peptides | |
| CN105755030A (en) | Preparation method of Pinctada fucata meat antioxidant peptides |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140910 Termination date: 20200609 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |