CN103320432A - Probe for recovering and identifying Smad3 target gene-correlative miRNA, kit and method - Google Patents
Probe for recovering and identifying Smad3 target gene-correlative miRNA, kit and method Download PDFInfo
- Publication number
- CN103320432A CN103320432A CN2013102025973A CN201310202597A CN103320432A CN 103320432 A CN103320432 A CN 103320432A CN 2013102025973 A CN2013102025973 A CN 2013102025973A CN 201310202597 A CN201310202597 A CN 201310202597A CN 103320432 A CN103320432 A CN 103320432A
- Authority
- CN
- China
- Prior art keywords
- mirna
- target gene
- cell
- probe
- mrna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for recovering and identifying target gene-correlative miRNA, a kit and a method, concretely nucleic acid probe for recovering and identifying miRNA of target Smad3 gene mRNA, which has a nucleotide sequence of SEQ ID NO:26. The invention provides an action principle for recovering and indentifying the miRNA. The invention discloses application and an implementation strategy of the novel recovery and identification method, particularly recovery and identification of miRNA of specific gene RNA locus applied in a cell. The invention confirms that the locus recovery technology can specifically recover miRNA combined to mRNA of a Smad3 gene, and conforms that the miRNA can regulate and control Smad3 gene expression, and the method can effectively recovering and indentifying miRNA of the target specific gene mRNA.
Description
Technical field
The invention belongs to biotechnology and medical field.Particularly, the present invention relates to implementation method and application, the especially application in animal cell line of the relevant miRNA recovery of target gene, authenticate technology, for example the implementation method in human tumor cell line and purposes.
Background technology
MicroRNA (miRNA) is about 20～24nt, noncoding Microrna, they by suppress the mRNA translation or promote the mRNA degraded to target gene carry out post-transcriptional level regulation and control (Bartel, D.P., Cell.2004,116:281-297).MiRNA is a kind of regulating cell function little RNA of non-coding very widely, is almost controlling each biological procedures, comprises differentiation, growth, propagation and the apoptosis of cell.In addition, studies show that now the imbalance of miRNA expression level and a lot of diseases comprise disease closely related (Hobert, Trends Biochem.Sci.2004,29:462 such as tumour, autoimmune disorder, diabetes, heart trouble; Lu, J. etc., Nature.2005,435:834-838; Li, Q.J. etc., Cell.2007,129:147-161; Cheng, H.Y. etc., Neuron.2007,54:813-829; Chang, T.C. etc., Mol Cell.2007,26:745-752; He, L. etc., Nature.2005,435:828-833; Care, A. etc., Nat Med.2007,13:613-618).
The biological function of MiRNA is the problem that people pay special attention to, and determining of miRNA target gene is the key of research miRNA biological function, present main computer information biology software prediction and the biological experimental method (Daniel of leaning on that determine about the miRNA target gene, W.T. etc., Nucleic Acids Res.2011,39:6845-53;
U.A. etc., Gene.2009,451:1-5).
At present, Chang Yong computer information biology forecasting software has miRanda, PicTar, TargetScan, PITA and RNA22.Bioinformatics method mainly is to utilize certain algorithm the target gene sample is marked and to screen, because people find that in research process the effect between miRNA and target gene has certain regularity.Therefore, though present Forecasting Methodology has nothing in common with each other, mainly follow following principle commonly used (Krek, A. etc., Nat Genet.2005,37:495-500; Lall, S. etc., Curr Biol.2006,16:460-71; Lewis, B.P. etc., Cell.2005,120:15-20; Kiriakidou, M. etc., Genes Dev.2004,18:1165-78; Kertesz, M. etc., Nat Genet.2007,39:1278-84; Miranda, K.C. etc., Cell.2006,126:1203-17):
(1) complementarity of miRNA and its target site;
(2) conservative property of miRNA target site between different plant species;
(3) thermostability between the miRNA-mRNA two strands;
(4) the miRNA target site place complicated secondary structure that do not have;
(5) 5' of miRNA end is better than the 3' end with the binding ability of target gene.
Yet, using that the miRNA target gene is a very difficult thing in the computer forecast animal, this mainly is because miRNA and its target gene are taked the pattern of non-complete complementation in the zooblast.At present known miRNA target gene and definite target spot thereof and few do not have enough known sample can reference in the algorithm compiling procedure, even constantly increase and improve restricted condition, are difficult to acquisition yet and have high specific and highly sensitive algorithm simultaneously.And, present also none high-throughput authentication method fast of the target gene that computer forecast is come out, this has also influenced the assessment to the algorithm accuracy to a great extent, thereby can't be optimized it.
Because there is certain limitation in computer simulation when prediction miRNA target gene, a lot of scholars wish to utilize biological experimental method directly to seek the miRNA target gene.Biological experimental method is sought the miRNA target gene and is mainly contained following several mode:
(1) from the mRNA level seek the miRNA target gene (Lim, L.P. etc., Nature.2005,433:769-773), the stability that influences mRNA by miRNA is sought the target gene of miRNA.But this method exists can not distinguish direct target gene or the shortcoming of indirect target gene.Simultaneously, this method has difficulties when having sought the inhibiting miRNA target gene of translation;
(2) from the complex body of the miRNA combination searching target gene of starting with.Because miRNA is by working with form and the target gene mRNA combination of protein formation complex body, so this mode by mark miRNA or mark conjugated protein, uses the mode of co-precipitation to seek target gene (Beitzinger, the M. etc. of miRNA, RNA Biol.2007,4:76-84; Ulf Andersson Orom etc., Cell.2008,30:460-471; Hafner, M. etc., Cell.2010,141:129-141; Chi, S.W. etc., Nature.2009,460:479-86).This mode can obtain the target sequence of specific miRNA or whole miRNA, but that often obtain is the result of truth in a kind of non-body, this is express the mode that miRNA enters cell and carry out because experiment is often adopted to cross, and non-specific result is very many, has influenced determining true target gene;
(3) seek the miRNA target gene from protein level.Studies show that miRNA mainly plays regulating and controlling effect in translation skill to target gene, so target gene (Selbach, M. etc., Nature.2008, the 455:58-63 of miRNA are sought in the change of a lot of scholar's research protein levels; Baek, D. etc., Nature.2008,455:64-71).This mode is the same with above-mentioned mode (1), can not distinguish direct result or indirect consequence, so can not effectively determine the target gene of miRNA.
In sum, in miRNA research, the searching of target gene remains a global difficult problem, particularly the searching to the true target gene of miRNA in the animal body does not also have a kind of (Daniel of mode effectively accurately from the present, W.T. etc., Nucleic Acids Res.2011,39:6845-53;
U.A. etc., Gene.2009,451:1-5).Research fund and manpower that whole world every year drops in this field are a lot, owing to there not being a kind of effective target gene finding method, though cause expended great amount of manpower every year and financial resources still produce little effect.
Therefore, press in this area and develop effective miRNA target gene authentication method or the relevant miRNA authentication method of reverse target gene.
Summary of the invention
One of purpose of the present invention has just provided a kind of novel relevant miRNA authenticate technology of target gene, and the new purposes in relevant miRNA research.Another object of the present invention provides the action principle of the relevant miRNA authenticate technology of this novel target gene.Another purpose of the present invention has provided purposes and the implementation strategy of this new technique in miRNA research, particularly is applied to the hit evaluation of gene-correlation miRNA of zooblast.New technology provided by the invention can specificity reclaim the miRNA that combines with target gene mRNA, and confirms that these miRNA can regulate and control target gene expression, and this method can effectively reclaim, identify the miRNA of target specific gene mRNA.Of the present invention also have a purpose to provide probe for this technology, particularly the specific dna probe that reclaims at the miRNA of Smad3 gene.
In one aspect of the invention, provide a kind of nucleic acid probe, its nucleotide sequence is SEQ ID NO:26.
In another aspect of the present invention, provide comprise above-mentioned nucleic acid probe for separating of and/or identify test kit or the cover box of miRNA, wherein said miRNA can specific target gene mRNA specificity be combined in cell, described target gene is the Smad3 gene, also comprises in described test kit or the cover box:
(i) cell cross-linking reagent;
(ii) RNA extracts reagent;
(iii) separate linking agent;
(iv) the nucleic acid probe conjugate reclaims reagent;
(v) miRNA separates and/or indentifying substance.
Recovery and/or evaluation miRNA from cell are provided in another aspect of the present invention, be used for the method for the detection of target gene mRNA, described target gene is the Smad3 gene mRNA, and wherein said miRNA can be combined with the mRNA of target gene described in cell specificity, it is characterized in that described method comprises:
(a) make above-mentioned nucleic acid probe enter cell and be combined with described target gene mRNA;
(b) described cell is carried out crosslinked, keep bonding state so that be connected with the miRNA of the described target gene mRNA of described nucleic acid probe and specificity combination with it;
(c) from described cell, reclaim nucleic acid probe-target gene mRNA binding substances, nucleic acid probe-target gene mRNA-miRNA binding substances;
(d) separate crosslinked to the recovery product of step (c);
(e) separation and/or the evaluation miRNA of being combined with described target gene mRNA specificity.
In a preference aspect this, nucleic acid probe enters cell and realizes by electricity irritation, chemical process or mechanical means, preferred chemical stimulation method, liposome mediated-method, electric shocking method, electroporation, laser pore or the mediation of DEAE one dextran, more preferably liposome mediated-method.
Also having in the preference aspect this, described crosslinked mode is selected from: ultraviolet-crosslinkable, Paraformaldehyde 96 is crosslinked or their combination, and preferred Paraformaldehyde 96 is crosslinked.
In a preferred implementation aspect this, also comprise smudge cells in step (b) with (c).
In a preferred implementation aspect this, smudge cells is to be undertaken by the mode that is selected from down group: with cell pyrolysis liquid cracking, ultrasonic disruption, grinding fragmentation, and preferred ultrasonic disruption mode.
In another preference aspect this, the described recovery in the step (c) is undertaken by affine absorption or affinity chromatography, and used carrier is selected from: cross-linked agarose gel, crosslinked magnetic bead, preferred crosslinked magnetic bead.
Separating crosslinked in another preference aspect this is to be undertaken by being selected from one or more modes of organizing down: with Proteinase K processing, 30～90 ℃ of processing or their combination, preferred 65 ℃ of processing.
Adopt one or more modes that are selected from organizing down to carry out in the separation that also has miRNA in the preference aspect this and/or evaluation: miRNA chip detection, miRNA quantitative PCR detection, miRNA quantitative PCR chip detection or miRNA large scale sequencing, preferred miRNA quantitative PCR chip detection.
In certain embodiments, described RNA extraction reagent comprises the reagent that smudge cells is used.
In further embodiments, described test kit or cover box also comprise one or more materials that are selected from down in the group: the reagent that container, thinner, buffer reagent, smudge cells are used, specification sheets.
In another aspect of the present invention, put down in writing in the specification sheets and adopted probe of the present invention, test kit of the present invention or cover box, use method of the present invention to reclaim and/or evaluation miRNA.
Provide the action principle of the relevant miRNA authenticate technology of this novel target gene in still another aspect of the invention in the content.The probe of target gene complementation can specificity reclaim the miRNA of target gene and combination thereof, thereby provides new technical means for the relevant miRNA of research specific gene studies.
Provide the relevant miRNA authenticate technology of this novel target gene zoologizeing purposes and the implementation strategy of the relevant miRNA of specific gene in the cell in still another aspect of the invention in the content, particularly be applied to prevention and the treatment of the miRNA that specific gene is relevant in the mammalian cell strain.
Other side of the present invention is because the disclosure of this paper is apparent to those skilled in the art.
Description of drawings
The invention will be further described below in conjunction with accompanying drawing, and wherein the following drawings only shows in order to illustrate embodiment of the present invention, rather than in order to limit to scope of the present invention.
Fig. 1: the example technique route map of the miRNA authentication method that target gene of the present invention is relevant;
Fig. 2: adopt the relevant miRNA authenticate technology specificity of target gene of the present invention to reclaim target gene mRNA:
The mode chart of A:p21 gene mRNA and the binding site of probe, PCR detection site;
B: with the detected result of p21 probe special recovery p21 gene mRNA in HepG2 and PC-3 cell and contrast probe recovery result's detection case;
The mode chart of C:STAT3 gene mRNA and the binding site of probe, PCR detection site;
The detection case that the detected result of D:STAT3 probe special recovery STAT3 gene mRNA in the HepG2 cell and contrast probe reclaim the result;
The mode chart of E:Smad3 gene mRNA and the binding site of probe, PCR detection site;
The detection case that the detected result of F:Smad3 probe special recovery Smad3 gene mRNA in the HepG2 cell and contrast probe reclaim the result;
Fig. 3: adopt the relevant miRNA authenticate technology specificity of target gene of the present invention to reclaim the miRNA relevant with the p21 gene mRNA:
A: the quantitative PCR chip detection result who reclaims the miRNA relevant with the p21 gene mRNA with the relevant miRNA authenticate technology specificity of target gene;
B: the PCR detected result of the miRNA relevant with the p21 gene mRNA;
Fig. 4: with the functional analysis of the detected miRNA relevant with the p21 gene mRNA of the relevant miRNA authenticate technology of target gene:
A: the fluorescence report gene test result that the p21 genetic expression of the miRNA relevant with the p21 gene mRNA that is recovered to the relevant miRNA authenticate technology specificity of target gene influences;
B: rna level and protein level detected result that the p21 genetic expression of the miRNA relevant with the p21 gene mRNA that is recovered to the relevant miRNA authenticate technology specificity of target gene influences;
C: the detected result that the p21 gene function of the miRNA relevant with the p21 gene mRNA (cell proliferation) that is recovered to the relevant miRNA authenticate technology specificity of target gene influences;
The result is shown as mean+SD, n=3; *, P＜0.05; *, P＜0.01; * *, P＜0.001.
Embodiment
The inventor has successfully set up the relevant miRNA authenticate technology of target gene through long-term and deep research.The contriver also is applied to the zooblast strain with the miRNA authenticate technology that target gene is correlated with, successfully identify the miRNA of being combined with the Smad3 gene mRNA, and confirm that these miRNA can regulate and control the Smad3 expression of gene, the contriver has set up a kind of brand-new miRNA target investigative technique thus, thereby has finished the present invention on this basis.
As used herein, have comprised " containing ", " having " or " comprising " " comprising ", " mainly by ... constitute ", " basically by ... constitute " and " by ... constitute "; " mainly by ... constitute ", " basically by ... constitute " and " by ... formation " belong to the subordinate concept of " containing ", " having " or " comprising ".
The feature that the present invention mentions, or the feature that embodiment mentions can arbitrary combination.All features that this case specification sheets discloses can with any composition forms and usefulness, each feature that discloses in the specification sheets can anyly provide the alternative characteristics of identical, impartial or similar purpose to replace.Therefore except special instruction is arranged, the feature that discloses only is the general example of equalization or similar features.
Particularly, the research of the target-seeking of miRNA is focus and the difficult point of molecular biology and RESEARCH ON CELL-BIOLOGY, seeks and identifies the miRNA target gene or identify that the effective technology of the miRNA that target gene is relevant has application prospect extensively at functional genome research.
The contriver is by discovering: the mode specificity that DNA probe labeled with biotin can be by hybridization in conjunction with the mRNA of probe complementation, can specificity reclaim mRNA fragment with the probe complementation by the plain crosslinked magnetic bead of affinity.Design shows that at the probe experiment of gene Smad3 the Smad3 probe can specificity reclaim Smad3 gene mRNA fragment in hepatoma cell strain HepG2, and can not reclaim other gene fragment, and the contrast probe can not reclaim any gene mRNA fragment.Design has obtained similar result at the probe of other gene such as p21, STAT3.Comprehensive above experiment, the inventor confirmed biotinylated probe can specificity in conjunction with and reclaim mRNA fragment with the probe complementation, the material (for example miRNA) that this mode is combined with the mRNA fragment for research has extensive and high using value.
Among the appended Fig. 1 of the present invention a kind of preferred implementation of the present invention has been described, but those of ordinary skills can be based on the purpose of the ordinary method in this area and concrete operations, wherein used mode, reagent, step etc. are carried out corresponding change or improvement, and do not break away from spirit of the present invention.For example, the biotin labeling thing on the probe can be replaced with other marker; This method not only can act on the miRNP shown in the figure, also can act on the mRNA-miRNA binding substances of unbinding protein still; Etc..
Specificity is in conjunction with recovery and the authentication method of the miRNA of target gene mRNA
The invention provides a kind of recovery and identify that specificity is in conjunction with the method for the miRNA of target gene mRNA, described method by with specificity at combining in the probe transfered cell of target gene mRNA and with this target gene mRNA, make this probe indirectly with the miRNA that is incorporated into this target gene mRNA or miRNP (namely be combined miRNA ribonucleoprotein complex) combination, by being carried out crosslinking Treatment, cell can stablize this combination, from cell, separate the binding substances that comprises probe then, by separating crosslinked this binding substances, reclaim RNA wherein, be tested and appraised and distinguish the miRNA that obtains.
Adopt method of the present invention can obtain under the physiological status, the miRNA of being combined with target gene mRNA specificity, and can obtain the multiple miRNA of being combined with same target gene mRNA simultaneously, thereby provide strong tool and approach for the research and development of miRNA, research and the application of mRNA regulation and control.Adopt the method for computer forecast or the method for artificial interference to predict or study miRNA in the research in the past mostly, the result often produces very high false positive rate, and adopt mode of the present invention directly to obtain the truth that mRNA is combined with miRNA in the cell, have higher confidence level and accuracy.
A. specificity is at the nucleic acid probe of target gene mRNA
Can adopt the oligonucleotide probe of genome DNA probe, cDNA probe, rna probe and synthetic etc. in the method for the invention, preferred dna probe.
In the method for the invention, the preferred employing has the marker that can be used for target gene mRNA detection and/or separate, and described marker can be radioactively labelled substance or non-radioactive marker, preferred non-radioactive marker's (as fluorescent marker).The radioactively labelled substance that can be used in the inventive method can be radio isotope commonly used in this area, for example includes but not limited to: isotropic substance
32P,
3H,
35S etc., preferred
32P uses the most general.Non-the penetrating property marker that can be used in the inventive method includes but not limited to that for example: vitamin H (biotin) and digoxin (digoxigenin), the two all is haptens.Vitamin H is a kind of micromolecular water soluble vitamin, and to the affine avidity that have uniqueness, both can form stable compound, detect by the substance that show color (as enzyme, fluorescein etc.) that is connected on avidin or the avidin.Digoxin is a kind of steroid hapten molecule, can utilize its antibody to carry out immunodetection, and principle is similar to the detection of vitamin H.
In order to separate the binding substances (for example probe-target gene mRNA-miRNA) that comprises probe-target gene mRNA, preferably have biological to a member among the member, so that this binding substances is carried out the separation of modes such as affinity chromatography at probe.The biology that can be used for probe mark of the present invention can be selected from a member of following biological centering to the member: a member of receptor-ligand, Ag-Ab, enzyme-substrate centering, a kind of member in biological example element-Streptavidin, biotin-avidin, vitamin H-neutral avidin, lectin-carbohydrate, staphylococcal protein A,SPA-IgG, Ag-Ab, positively charged ion-negatively charged ion or hormone VITAMIN and lipid and the acceptor; Preferably Gaoxin, vitamin H, enzyme (as alkaline phosphatase, horseradish peroxidase), more preferably vitamin H.
In some embodiments of the present invention, can comprise in the used nucleic acid probe lock nucleic acid (locked nucleic acid, LNA).LNA is a kind of class oligonucleotide derivative, and the 2'-O of β in the structure-D-ribofuranose, 4'-C position form the structure of rigidity by the shrink effect.LNA Nucleotide comprises A, C, G, T, six kinds of bases of Μ, mC, generally is found in A-DNA or RNA.This class nucleic acid can increase the melting temperature(Tm) (T of primer or probe (probe)
mValue), strengthens these Stability of Substance, can be applicable in the real-time polymerase chain reaction technology such as (real-time PCR).
Those of ordinary skills can be according to the probe of probe design principle design at the particular target gene mRNA, or determine whether to adopt lock nucleic acid and position thereof etc., or can be designed, provide described probe (for example Premier company, health become biotech firm etc.) by the commercial company of specialty.
Can adopt method conventional in this area, in described probe molecule transfered cell.These methods include but not limited to: electricity irritation, chemical process or mechanical means, preferred chemical stimulation method, liposome mediated-method, electric shocking method, electroporation, laser pore or the mediation of DEAE one dextran, more preferably liposome mediated-method.
B. cell is crosslinked
As used herein, term " cell is crosslinked " or " cell is carried out crosslinking Treatment " refer to: make nucleic acid-protein or protein-protein generation covalent attachment in the cell by physics or chemical process (such as ultraviolet-crosslinkable, Paraformaldehyde 96 is crosslinked or their combination).
In the method for the invention, treat that probe enters in the cell and after target gene mRNA is combined, and carries out crosslinking Treatment to cell.The purpose of this processing is: reinforce the combination of miRNA mixture and target gene mRNA, make it more stable at recovery stage.
Can adopt in this area conventional method that cell is carried out crosslinking Treatment, these methods include but not limited to: ultraviolet-crosslinkable, Paraformaldehyde 96 is crosslinked or their combination, and preferred Paraformaldehyde 96 is crosslinked.
C. comprise the recovery of the binding substances of probe-target gene mRNA
By probe in cell in conjunction with target gene mRNA, can produce the binding substances that comprises probe-target gene mRNA, for example probe-target gene mRNA-miRNA, probe-target gene mRNA-miRNP, probe-target gene mRNA-mRNA are in conjunction with albumen etc.
Can adopt in this area ordinary method to reclaim intracellular these and comprise the binding substances of probe-target gene mRNA.For example, but smudge cells (as adopting modes such as cell pyrolysis liquid cracking, ultrasonic disruption, grinding fragmentation), and the marker on the dependence probe carries out affine separation (as at the biotin labeling thing on the probe, carrying out the separation and combination thing with the magnetic bead of avidin mark) to binding substances.
D. separation and the evaluation of the crosslinked and miRNA of the solution of binding substances
As used herein, method and the process that the miRNA that makes in the binding substances that comprises probe-target gene mRNA discharges " separated " to refer to crosslinked in term from binding substances.The binding substances that comprises probe-target gene mRNA that can adopt ordinary method in this area or currently known methods that recovery is obtained is separated crosslinked, therefrom to discharge miRNA.For example can adopt: separate crosslinked with methods such as lysate and Proteinase K processing, high temperature.
By reclaiming the RNA that separates in the cross-linking products, can obtain to comprise the target gene RNA of unbound state and the mixture of miRNA.Can adopt in this area to separate and with the ordinary method of separating miRNA the miRNA in the mixture be separated and identify.
The miRNA separation and/or the evaluation mode that can be used in the inventive method include but not limited to: (1) miRNA chip detection; (2) miRNA quantitative PCR detection; (3) miRNA quantitative PCR chip detection; (4) miRNA large scale sequencing etc.
By method of the present invention can obtain simultaneously under physiological status can in conjunction with and act on the multiple miRNA of same target gene mRNA.Those of ordinary skills can be as required, and the ordinary method in employing this area is is further researched and developed the miRNA of gained.
Advantage of the present invention
Advantage of the present invention mainly is:
(a) the present invention has disclosed a kind of technology and application thereof of novel research miRNA target gene, especially zoologizes the application of miRNA target gene in the cell;
(b) the present invention can study the truth of the miRNA of target gene combination in the body, can study the multiple miRNA of same target gene combination by this technology;
(c) the present invention can obtain target gene that forecasting software do not detect usually in advance in conjunction with miRNA, for the brand-new gate of a fan has been opened in miRNA research.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used for explanation the present invention and be not used in and limit the scope of the invention.Those skilled in the art can make suitable modification, change to the present invention, and these modifications and change are all within the scope of the present invention.
The experimental technique of unreceipted actual conditions in the following example, can adopt the ordinary method in this area, for example with reference to " molecular cloning experiment guide " (third edition, New York, press of cold spring harbor laboratory, New York:Cold Spring Harbor Laboratory Press, 1989) or the condition of advising according to supplier.The sequence measurement of DNA is the method for this area routine, also can provide test by commercial company.
Unless otherwise indicated, otherwise per-cent and umber calculate by weight.Unless otherwise defined, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any method similar or impartial to described content and material all can be applicable in the inventive method.The usefulness that preferable implementation method described in the literary composition and material only present a demonstration.
Embodiment 1: the probe specificity with mark reclaims complementary gene mRNA
Hepatoma cell strain HepG2, prostate cancer cell strain PC-3 are available from China typical culture collection center (CCTCC).
With 1 * 10
3-1 * 10
8(preferred 5 * 10
6So use in this test) individual HepG2 cell is spread into containing 20ml perfect medium (RPMI1640 substratum+10% foetal calf serum, all available from PAA company) the 10cm plate in and overnight incubation, adopt the transfection of transfection reagent INTERFERin (Polyplus company) difference next day with biotin labeled p21 probe and contrast probe, probe sequence is as follows: the P21 probe:
Vitamin H-5'-AGAGAGGAAAAGGAGAACACGGGATGAGGAGGCTTTAAA TAGTATTTCAT-3'(SEQ ID NO:1)
The contrast probe:
Vitamin H-5'-GCTATGAAGAGATACATTAAGGCTATGAAGAGATACAT TAAGGCTATGAA-3'(SEQ ID NO:2)
With 1 * 10
3-1 * 10
8(preferred 5 * 10
6So use in this test) individual PC-3 cell is spread into containing 20ml perfect medium (RPMI1640 substratum+10% foetal calf serum, all available from PAA company) the 10cm plate in overnight incubation, adopt transfection reagent INTERFERin (Polyplus company) the biotin labeled p21 probe of transfection and contrast probe respectively next day, probe sequence is as follows:
The P21 probe:
Vitamin H-5'-AGAGAGGAAAAGGAGAACACGGGATGAGGAGGCTTTAAA TAGTATTTCAT-3'(SEQ ID NO:1)
The contrast probe:
Vitamin H-5'-GCTATGAAGAGATACATTAAGGCTATGAAGAGATACATTA AGGCTATGAA-3'(SEQ ID NO:2)
With 1 * 10
3-1 * 10
8(preferred 5 * 10
6So use in this test) individual HepG2 cell is spread into containing 20ml perfect medium (RPMI1640 substratum+10% foetal calf serum, all available from PAA company) the 10cm plate in overnight incubation, adopt transfection reagent INTERFERin (Polyplus company) the biotin labeled STAT3 probe of transfection and contrast probe respectively next day, probe sequence is as follows:
The STAT3 probe:
Vitamin H-5'-AATGCAGGTAGGCGCCTCAGTCGTATCTTTCTGCAGCTT CCGTTCTCAGC-3'(SEQ ID NO:3)
The contrast probe:
Vitamin H-5'-GCTATGAAGAGATACATTAAGGCTATGAAGAGATACATTA AGGCTATGAA-3'(SEQ ID NO:2)
With 1 * 10
3-1 * 10
8 Preferred 5 * 10
6So use a HepG2 cell to spread into containing 20ml perfect medium (RPMI1640 substratum+10% foetal calf serum in this test, all available from PAA company) the 10cm plate in overnight incubation, adopt transfection reagent INTERFERin (Polyplus company) the biotin labeled Smad3 probe of transfection and contrast probe respectively next day, probe sequence is as follows:
The Smad3 probe:
Vitamin H-5'-ATGCAACTGACTACATAAACCAATATAGCCGTATGCATCA GAATCTGGAG-3'(SEQ ID NO:27)
The contrast probe:
Vitamin H-5'-GCTATGAAGAGATACATTAAGGCTATGAAGAGATACATTA AGGCTATGAA-3'(SEQ ID NO:2)
Transfection is collecting cell after 24 hours, reclaims RNA as follows:
(1) with 0.1-10% (preferred 0.5-5%, in this experiment 1%) Paraformaldehyde 96 (formaldehyde) room temperature fixed cell 1-60 (preferred 5-30 minute, during this is tested 10 minutes);
(2) with glycine (glycine) balance 5 minutes at room temperature;
(3) the 10ml PBS with precooling gives a baby a bath on the third day after its birth inferior;
(4) add 0.5-5ml (preferred 1ml is as this experiment) lysate A (1-100mM, preferred 10-50mM, this test 20mM) Tris, pH7.0～9.0,1-5000mM (preferred 100-1000mM, this test 500mM) NaCl, 1-100mM (preferred 1-10mM, this test 2.5mM) MgCl
2, 0.1-10% (preferred 0.5-5%, this test 1%) SDS, Superase-In (Ambion company), proteinase inhibitor (Roche company) scrapes cell, and room temperature was placed 1 minute;
(5) by following pattern ultrasonication cell (VCX130, SONICS﹠amp; MATERIALS company): 1-60 second (preferably as this test 30 seconds) gap; 1-60 second (preferably as this test 30 seconds) is ultrasonic; 1-100% (preferably as this test 50%) total power; Ultrasonic time 1-60 minute altogether (preferably as this test 10 minutes);
(6) with 10000g at room temperature centrifugal 10 minutes, get supernatant, get 50 μ l supernatants as input (Input) contrast;
(7) add the crosslinked magnetic bead M-280 (Invitogen company) of Streptavidin, 4-75 ℃ (preferably as 30 ℃ of this tests) rolled in conjunction with 2 hours;
(8) remove supernatant, with cleaning buffer solution B (1-100mM (preferred 5-50mM, as the 10mM in this test) Tris, pH7.0～9.0,1-5000mM (preferred 100-2000mM, as the 1000mM in this test) NaCl, 1-1000mM (preferred 10-500mM is as the 40mM in this test) EDTA, Superase-In (Ambion company), proteinase inhibitor (Roche company) washes twice, each 0.5-10ml (the preferably 2ml in this test);
(9) with cleaning buffer solution C (1-100mM (preferred 5-50mM, as the 10mM in this test) Tris, pH7.0～9.0,1-5000mM (preferred 10-1000mM, as the 150mM in this test) NaCl, 1-1000mM (preferred 10-500mM is as the 40mM in this test) EDTA, 0.1-10% (preferred 0.5-5%, as 1% in this test) SDS, Superase-In (Ambion company), proteinase inhibitor (Roche company) washes twice, each 0.5-10ml (the preferably 2ml in this test);
(10) remove supernatant, add 200 μ l in preferred this test of 10-5000 μ l() lysate A, add 1-1000 μ l (preferably 10 μ l in this test) Proteinase K (20mg/ml) again, input contrast supernatant adds 150 μ l in preferred this test of 10-5000 μ l() lysate A, add 1-1000 μ l (preferably 10 μ l in this test) Proteinase K (20mg/ml) again, 10-90 ℃ (preferably 65 ℃ in this test) separate crosslinked 0.1-10 hour (preferably 1 hour in this test);
(11) add 10-1000 μ l (preferably 300 μ l in this test) TRIzol (Invitrogen company), extract RNA;
(12) handled 30 minutes with DNase I (TaKaRa company) down at 37 ℃, add 500 μ l TRIzol (Invitrogen company), extract the RNA that is further purified.
Adopt reverse transcription PCR (RT-PCR) method to detect reclaiming the result: RT-PCR uses SYBRRT-PCR test kit (Takara company) and finishes at LightCycler (Roche company) quantitative PCR instrument.
The PCR primer of P21 gene mRNA:
5'-AAA CTA GGC GGT TGA ATG AG-3'(upstream, SEQ ID NO:4); With
5'-AAA GGA GAA CAC GGG ATG AG-3'(downstream, SEQ ID NO:5).
The PCR primer of STAT3 gene mRNA is:
5'-CAT GGA GTT GAC CTC GGA GTG-3'(upstream, SEQ ID NO:6); With
5'-TGG CAG AAT GCA GGT AGG C-3'(downstream, SEQ ID NO:7).
The PCR primer of Smad3 gene mRNA is:
5'-CGT GGG ATG GCA TTT GGT C-3'(upstream, SEQ ID NO:27); With
5'-GCA TCA GAA TCT GGA GCA A-3'(downstream, SEQ ID NO:28).
The PCR primer of confidential reference items beta-actin:
5'-CAG CAA GCA GGA GTA TGA CG-3'(upstream, SEQ ID NO:8); With
5'-GAA AGG GTG TAA CGC AAC TAA-3'(downstream, SEQ ID NO:9).
The PCR condition is: 95 ℃ 2 minutes; 95 ℃ of 5 second, 60 ℃ of 10 second, 72 ℃ of 15 second, 76 ℃ of fluoroscopic examinations, 40 circulations.
PCR result adopts 4% agarose gel electrophoresis to identify, the recovering state of p21 probe and contrast probe is shown in Fig. 2 B in HepG2 and the PC-3 cell.The mode chart of p21 gene mRNA and the binding site of probe, PCR detection site are shown in Fig. 2 A.The mode chart of STAT3 gene mRNA and the binding site of probe, PCR detection site are shown in Fig. 2 C, and the recovering state of STAT3 probe and contrast probe is shown in Fig. 2 D in the HepG2 cell.The mode chart of Smad3 gene mRNA and the binding site of probe, PCR detection site are shown in Fig. 2 E, and the recovering state of Smad3 probe and contrast probe is shown in Fig. 2 F in the HepG2 cell.
The result shows: the p21 probe can specificity reclaim the p21 gene mRNA from HepG2, PC-3 cell, and can not reclaim the beta-actin gene mRNA, and contrast probe then both can not reclaim.In the HepG2 cell, the STAT3 probe can special recoverys STAT3 gene mRNA and can not reclaim the beta-actin gene mRNA, contrast probe then the both can not reclaim.In the HepG2 cell, the Smad3 probe can special recoverys Smad3 gene mRNA and can not reclaim the beta-actin gene mRNA, contrast probe then the both can not reclaim.
Embodiment 2: adopt the p21 probe specificity to reclaim the miRNA of being combined with the p21 gene mRNA
Adopt miRNA quantitative PCR detection chip (Exiqon company) that the RNA that probe reclaims is detected:
To serve the Haikang with the sample that reclaims with the contrast probe with the sample that the P21 probe reclaims and become biotechnology company limited to carry out miRNA quantitative PCR chip detection, and use the subsidiary software of PCR instrument to carry out the preliminary data analysis, obtain original Ct value.
The Δ Ct that calculates the relevant miRNA gene of each path in each treatment group adopts following formula:
The average Ct of the average Ct-external source of Δ Ct=confidential reference items;
Calculate the formula of the Δ Δ Ct of each gene in 2 treatment group pcr chips:
Δ Δ Ct=Δ Ct (p21)-Δ Ct (contrast).
The result shows: with respect to the contrast probe, the p21 probe specificity has reclaimed 20 kinds of miRNA (10 times to the contrast probe), 3 kinds of miRNA:miR-92a, miR-92b, miR-296-5p multiple are wherein arranged greater than 100 times, be called as the miRNA (Fig. 3 A) that combines closely most.
Adopt reverse transcription PCR (RT-PCR) method that the miRNA that combines closely is most detected: RT-PCR uses All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia company), and finishes at LightCycler (Roche company) quantitative PCR instrument.
The PCR primer of the miRNA that combines closely most is:
miR-92a：
5'-TAT TGC ACT TGT CCC GGC CTG T-3'(upstream, SEQ ID NO:10); With
General downstream primer (test kit carries);
miR-92b:
5'-TAT TGC ACT CGT CCC GGC CTC C-3'(upstream, SEQ ID NO:11); With
General downstream primer (test kit carries);
miR-296-5p:
5'-AGG GCC CCC CCT CAA TCC TGT-3'(upstream, SEQ ID NO:12); With
General downstream primer (test kit carries).
The PCR primer of confidential reference items U6 small nuclear rna:
5'-GTG CTC GCT TCG GCA GCA CAT ATA C-3'(upstream, SEQ ID NO:13); With
5'-AAA AAT ATG GAA CGC TCA CGA ATT TG-3'(downstream, SEQ ID NO:14).
The condition of PCR is: 95 ℃ 10 minutes; 95 ℃ of 5 second, 58 ℃ of 10 second, 72 ℃ of 15 second, 76 ℃ of fluoroscopic examinations, 40 circulations.
PCR result adopts 4% agarose gel electrophoresis, detects p21 probe and the recovering state (referring to Fig. 3 B) of contrast probe to miRNA in the HepG2 cell.
The result shows: the p21 probe can special recoverys HepG2 cell in the p21 gene mRNA miRNA that combines closely most, and can not reclaim the U6 gene mRNA, contrast probe then the both can not reclaim.
Embodiment 3: the miRNA that reclaims with the p21 probe specificity regulates and control the p21 expression of gene
The miRNA that combines closely most (miR-92a, miR-92b, the miR-296-5p) high expression level that adopts following sequence (synthetic by Shanghai Ji Ma company) in the HepG2 cell, to make respectively to obtain among the embodiment 2 or suppress to express:
MiR-92a stand-in: UAUUGCACUUGUCCCGGCCUGU (SEQ ID NO:15);
MiR-92b stand-in: UAUUGCACUCGUCCCGGCCUCC (SEQ ID NO:16);
MiR-296-5p stand-in: AGGGCCCCCCCUCAAUCCUGU (SEQ ID NO:17);
Little RNA contrast: UUCUCCGAACGUGUCACGUTT (SEQ ID NO:18, it is modifying method commonly used during little RNA sequence is synthesized that the 3' end adds TT outstanding, to the not influence of its function, mainly is the effect [Wilda that plays the stable nucleus thuja acid, M. etc., Oncogene.2002; 21:5176-5124]);
MiR-92a inhibition: 2'-O-Me-ACAGGCCGGGACAAGUGCAAUA (SEQ ID NO:19);
MiR-92b inhibition: 2'-O-Me-GGAGGCCGGGACGAGUGCAAUA (SEQ ID NO:20);
MiR-296-5p inhibition: 2'-O-Me-ACAGGAUUGAGGGGGGGCCCU (SEQ ID NO:21); And
Inhibition contrast: 2'-O-Me-CAGUACUUUUGUGUAGUACAA (SEQ ID NO:22).
According to bibliographical information, adopt little RNA to the HepG2 cell of INTERFERin transfection reagent (Polyplus company) transfection [Hou, J. etc., J Immunol.2009; 183:2150-2158], make that the final concentration of miRNA stand-in transfection is 50nM, the final concentration of miRNA inhibition transfection is 200nM.
Adopt the fluorescence report gene approach detect gained among the embodiment 2 the p21 gene of the miRNA 3' non-coding region of combining closely most (3'-Untranslated Region, 3'UTR) in conjunction with situation:
A. comprise the preparation of the fluorescence report carrier in p21 gene 3'UTR district
The fluorescence report carrier that comprises p21 gene 3'UTR district prepares (used restriction enzyme, PrimerSTAR HS archaeal dna polymerase are all available from Takara company) specific as follows:
Contain p21 gene 3'UTR district and react the back acquisition with the fragment (primer) of following two chemosynthesis through PCR:
Fragment 1 (SEQ ID NO:23, upstream primer):
5'-
GAACTAGTAATCCGCCCACAGG-3'；
Fragment 2 (SEQ ID NO:24, downstream primer):
5'-
TGAAGCTTCTGAGGTAGAACTAGGG-3'
Underscore mark place is restriction enzyme site and protection base.
Gained p21 gene 3'UTR district is 953bp altogether, and (SEQ ID NO:25) is as follows for its sequence:
AATCCGCCCACAGGAAGCCTGCAGTCCTGGAAGCGCGAGGGCCTCAAAG?GCCCGCTCTACATCTTCTGCCTTAGTCTCAGTTTGTGTGTCTTAATTATTAT?TTGTGTTTTAATTTAAACACCTCCTCATGTACATACCCTGGCCGCCCCCTG?CCCCCCAGCCTCTGGCATTAGAATTATTTAAACAAAAACTAGGCGGTTGA?ATGAGAGGTTCCTAAGAGTGCTGGGCATTTTTATTTTATGAAATACTATTT?AAAGCCTCCTCATCCCGTGTTCTCCTTTTCCTCTCTCCCGGAGGTTGGGTG?GGCCGGCTTCATGCCAGCTACTTCCTCCTCCCCACTTGTCCGCTGGGTGGT?ACCCTCTGGAGGGGTGTGGCTCCTTCCCATCGCTGTCACAGGCGGTTATG?AAATTCACCCCCTTTCCTGGACACTCAGACCTGAATTCTTTTTCATTTGAG?AAGTAAACAGATGGCACTTTGAAGGGGCCTCACCGAGTGGGGGCATCAT?CAAAAACTTTGGAGTCCCCTCACCTCCTCTAAGGTTGGGCAGGGTGACCC?TGAAGTGAGCACAGCCTAGGGCTGAGCTGGGGACCTGGTACCCTCCTGGC?TCTTGATACCCCCCTCTGTCTTGTGAAGGCAGGGGGAAGGTGGGGTCCTG?GAGCAGACCACCCCGCCTGCCCTCATGGCCCCTCTGACCTGCACTGGGGA?GCCCGTCTCAGTGTTGAGCCTTTTCCCTCTTTGGCTCCCCTGTACCTTTTGA?GGAGCCCCAGCTACCCTTTTTCTCCAGCTGGGCTCTGCAATTCCCCTCTGC?TGCTGTCCCTCCCCCTTGTCCTTTCCCTTCAGTACCCTCTCAGCTCCAGGT?GGCTCTGAGGTGCCTGTCCCACCCCCACCCCCAGCTCAATGGACTGGAAG?GGGAAGGGACACACAAGAAGAAGGGCACCCTAGTTCTACCTCAG
Reaction system is: PCR reaction system cumulative volume is 25 μ l, 5 * PrimerSTAR damping fluid, 5 μ l wherein, dNTP mixture 2 μ l; Template cDNA0.2 μ g, PrimerSTAR HS archaeal dna polymerase 0.25 μ l, each 0.5 μ l of upstream and downstream primer, ddH
2O polishing to 25 μ l.
Reaction parameter is: 98 ℃ of 10s, and 58 ℃ of 10s, 72 ℃ of 3min, 40 circulations are extended 10min for back 72 ℃.The upstream and downstream primer is introduced BamH I and position, Not I enzyme point of contact respectively.Glue reclaim above PCR product, with BamH I and Not I double digestion and be connected among the fluorescence report carrier pMIR-Report (Ambion company) through same double digestion.
B. fluorescence report detects
With 5 * 10
4Individual HepG2 cell is spread into containing 0.5ml perfect medium (RPMI1640 substratum+10% foetal calf serum, all available from PAA company) 24 orifice plates in overnight incubation, adopt next day miRNA stand-in, the 25ng of transfection reagent JetPRIME (Polyplus company) cotransfection 100nM final concentration to contain fluorescence report carrier and the 6ng confidential reference items fluorescent expression vector pRL-TK (Promega company) in p21 gene 3'UTR district;
With 2 * 10
4Individual HepG2 cell is spread into containing 0.5ml perfect medium (RPMI1640 substratum+10% foetal calf serum, all available from PAA company) 24 orifice plates in overnight incubation, adopt the miRNA inhibition of transfection reagent JetPRIME (Polyplus company) transfection 200nM final concentration next day, contain fluorescence report carrier and the 6ng confidential reference items fluorescent expression vector pRL-TK (Promega company) in p21 gene 3'UTR district after 24 hours with transfection reagent JetPRIME (Polyplus company) cotransfection 25ng;
Adopt two fluorescence report gene detection systems (Dual-Luciferase Reporter Assay System (Promega company)) to detect after 36 hours.
The result is shown in Fig. 4 A.This result shows: the miRNA that combines closely most with the p21 gene mRNA can suppress to contain the fluorescence report expression of gene in p21 gene 3'UTR district very significantly, accordingly the miRNA inhibition then can be significantly or the utmost point strengthen the fluorescence report expression of gene that contains p21 gene 3'UTR district significantly.
This result shows: adopt miRNA that method of the present invention identifies, that combine closely most with the p21 gene mRNA can with p21 gene 3'UTR district in conjunction with and performance expression regulating effect.
Embodiment 4: detect the influence of p21 genetic expression in the HepG2 cell of miRNA of combining closely most among the embodiment 2
A. to the detection of the influence of mRNA level
With 2 * 10
5Individual HepG2 cell is spread into containing 2ml perfect medium (RPMI1640 substratum+10% foetal calf serum, all available from PAA company) 6 orifice plates in overnight incubation, renew bright substratum next day, adopt INTERFERin transfection reagent (Polyplus company) the miRNA stand-in of transfection 50nM final concentration respectively, the miRNA inhibition of 200nM final concentration, difference collecting cell after 48 hours, use TRIzol (Invitrogen company) extracting total tissue RNA, carry out qRT-PCR (using SYBR RT-PCR test kit (Takara company) to finish at LightCycler (Roche company) real-time quantitative PCR instrument).
The PCR primer of P21 gene mRNA is:
5'-AAA CTA GGC GGT TGA ATG AG-3'(upstream, SEQ ID NO:4); With
5'-AAA GGA GAA CAC GGG ATG AG-3'(downstream, SEQ ID NO:5).
The PCR primer of confidential reference items beta-actin is:
5'-CAG CAA GCA GGA GTA TGA CG-3'(upstream, SEQ ID NO:8); With
5'-GAA AGG GTG TAA CGC AAC TAA-3'(downstream, SEQ ID NO:9).
The PCR condition: 95 ℃ 2 minutes; 95 ℃ of 5 second, 60 ℃ of 10 second, 72 ℃ of 15 second, 76 ℃ of fluoroscopic examinations, 40 circulations.
PCR result adopts 4% agarose gel electrophoresis check, the miRNA high expression level of combining closely most with p21 in the HepG2 cell or suppressed influence to p21 gene mRNA level shown in Fig. 4 B figure below.
B. to the detection of the influence of protein level
With 2 * 10
5Individual HepG2 cell is spread into containing 2ml perfect medium (RPMI1640 substratum+10% foetal calf serum, all available from PAA company) 6 orifice plates in overnight incubation, renew bright substratum next day, adopt INTERFERin transfection reagent (Polyplus company) the miRNA stand-in of transfection 50nM final concentration respectively, the miRNA inhibition of 200nM final concentration, difference collecting cell after 48 hours, adopt Western blotting (Western blot, with reference to [Wu, S. etc., Oncogene.2010; 29:2302-2308]) detect p21 protein level wherein, and be confidential reference items with beta-actin, the result is shown in the last figure of Fig. 4 B.
Above result shows: p21 gene mRNA level affects is little in the HepG2 cell of miRNA of combining closely most with the p21 gene mRNA, and mainly influencing the translation skill of protein: high expression level miRNA causes the reduction of p21 gene protein level, and opposite miRNA inhibition causes the rising of p21 gene protein level.
With 2 * 10
3Individual HepG2 cell is spread into containing 0.2ml perfect medium (RPMI1640 substratum+10% foetal calf serum, all available from PAA company) 96 orifice plates in overnight incubation, adopt the miRNA stand-in of INTERFERin transfection reagent (Polyplus company) difference transfection 50nM final concentration or the miRNA inhibition of 200nM final concentration next day, respectively transfection one day after, adopted CCK-8 assay kit (Dojindo company) to carry out cell proliferation in two days, three days to detect, the result is shown in Fig. 4 C.
The result shows: the miRNA high expression level of combining closely most with the p21 gene mRNA can promote the propagation of cell, and the miRNA inhibition can suppress the propagation of cell.
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Claims (10)
1. a nucleic acid probe is characterized in that, its nucleotide sequence is SEQ ID NO:26.
One kind comprise the described nucleic acid probe of claim 1 for separating of and/or identify test kit or the cover box of miRNA, wherein said miRNA can specific target gene mRNA specificity be combined in cell, described target gene is the Smad3 gene, also comprises in described test kit or the cover box:
(i) cell cross-linking reagent;
(ii) RNA extracts reagent;
(iii) separate linking agent;
(iv) the nucleic acid probe conjugate reclaims reagent;
(v) miRNA separates and/or indentifying substance.
3. one kind is reclaimed and/or identifies miRNA from cell, is used for the method for the detection of target gene mRNA, and described target gene is the Smad3 gene mRNA, and wherein said miRNA can be combined with the mRNA of target gene described in cell specificity, it is characterized in that described method comprises:
(a) make the described nucleic acid probe of claim 1 enter cell and be combined with described target gene mRNA;
(b) described cell is carried out crosslinked, keep bonding state so that be connected with the miRNA of the described target gene mRNA of described nucleic acid probe and specificity combination with it;
(c) from described cell, reclaim nucleic acid probe-target gene mRNA binding substances, nucleic acid probe-target gene mRNA-miRNA binding substances;
(d) separate crosslinked to the recovery product of step (c);
(e) separation and/or the evaluation miRNA of being combined with described target gene mRNA specificity.
4. method as claimed in claim 3, it is characterized in that, described nucleic acid probe enters cell and realizes by electricity irritation, chemical process or mechanical means, preferred chemical stimulation method, liposome mediated-method, electric shocking method, electroporation, laser pore or the mediation of DEAE one dextran, more preferably liposome mediated-method.
5. method as claimed in claim 3 is characterized in that, described crosslinked mode is selected from: ultraviolet-crosslinkable, Paraformaldehyde 96 is crosslinked or their combination, and preferred Paraformaldehyde 96 is crosslinked.
6. method as claimed in claim 3 also comprises smudge cells in step (b) with (c).
7. method as claimed in claim 6 is characterized in that, described smudge cells is to be undertaken by the mode that is selected from down group: with cell pyrolysis liquid cracking, ultrasonic disruption, grinding fragmentation, and preferred ultrasonic disruption mode.
8. method as claimed in claim 3 is characterized in that, the described recovery in the step (c) is undertaken by affine absorption or affinity chromatography, and used carrier is selected from: cross-linked agarose gel, crosslinked magnetic bead, preferred crosslinked magnetic bead.
9. method as claimed in claim 3 is characterized in that, described solution is crosslinked to be to be undertaken by one or more modes that are selected from down group: with Proteinase K processing, 30～90 ℃ of processing or their combination, preferred 65 ℃ of processing.
10. method as claimed in claim 3, it is characterized in that, the separation of described miRNA and/or evaluation adopt one or more modes that are selected from down in the group to carry out: miRNA chip detection, miRNA quantitative PCR detection, miRNA quantitative PCR chip detection or miRNA large scale sequencing, preferred miRNA quantitative PCR chip detection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310202597.3A CN103320432B (en) | 2013-05-27 | 2013-05-27 | To be correlated with the probe of the recovery of miRNA and qualification, test kit and method for Smad3 target gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310202597.3A CN103320432B (en) | 2013-05-27 | 2013-05-27 | To be correlated with the probe of the recovery of miRNA and qualification, test kit and method for Smad3 target gene |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103320432A true CN103320432A (en) | 2013-09-25 |
| CN103320432B CN103320432B (en) | 2015-11-25 |
Family
ID=49189476
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310202597.3A Active CN103320432B (en) | 2013-05-27 | 2013-05-27 | To be correlated with the probe of the recovery of miRNA and qualification, test kit and method for Smad3 target gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103320432B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103558395A (en) * | 2013-10-28 | 2014-02-05 | 深圳市第二人民医院 | Application of SMAD3 gene in detection of upper tract urothelial carcinomas |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101078025A (en) * | 2006-12-19 | 2007-11-28 | 四川大学华西医院 | PCR kit of SNP for detecting COPD |
| EP2581447A1 (en) * | 2011-10-12 | 2013-04-17 | Royal College of Surgeons in Ireland | Selective isolation of a messenger RNA molecule having its cognate micro RNA molecules bound thereto |
-
2013
- 2013-05-27 CN CN201310202597.3A patent/CN103320432B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101078025A (en) * | 2006-12-19 | 2007-11-28 | 四川大学华西医院 | PCR kit of SNP for detecting COPD |
| EP2581447A1 (en) * | 2011-10-12 | 2013-04-17 | Royal College of Surgeons in Ireland | Selective isolation of a messenger RNA molecule having its cognate micro RNA molecules bound thereto |
Non-Patent Citations (1)
| Title |
|---|
| TIDI HASSAN等: "Isolation and identification of cell-specific microRNAs targeting a messenger RNA using a biotinylated anti-sense oligonucleotide capture affinity technique", 《NUCLEIC ACIDS RESEARCH》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103558395A (en) * | 2013-10-28 | 2014-02-05 | 深圳市第二人民医院 | Application of SMAD3 gene in detection of upper tract urothelial carcinomas |
| CN103558395B (en) * | 2013-10-28 | 2015-08-26 | 深圳市第二人民医院 | The application of SMAD3 gene on detecting in bladder transitional cell carcinoma |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103320432B (en) | 2015-11-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11390923B2 (en) | ncRNA and uses thereof | |
| Rask et al. | High expression of miR‐21 in tumor stroma correlates with increased cancer cell proliferation in human breast cancer | |
| Gao et al. | MiR-15a, miR-16-1 and miR-17-92 cluster expression are linked to poor prognosis in multiple myeloma | |
| Nakayama et al. | Clinicopathological significance of the CRTC3–MAML2 fusion transcript in mucoepidermoid carcinoma | |
| Tahiri et al. | Deregulation of cancer-related miRNAs is a common event in both benign and malignant human breast tumors | |
| Jentzsch et al. | A phenotypic screen to identify hypertrophy-modulating microRNAs in primary cardiomyocytes | |
| Yang et al. | Progress risk assessment of oral premalignant lesions with saliva miRNA analysis | |
| Morokoff et al. | Molecular subtypes, stem cells and heterogeneity: Implications for personalised therapy in glioma | |
| Lae et al. | Global gene expression profiling of PAX‐FKHR fusion‐positive alveolar and PAX‐FKHR fusion‐negative embryonal rhabdomyosarcomas | |
| Heinzelmann et al. | MicroRNAs with prognostic potential for metastasis in clear cell renal cell carcinoma: a comparison of primary tumors and distant metastases | |
| Egloff et al. | The 7SK snRNP associates with the little elongation complex to promote snRNA gene expression | |
| Zhou et al. | miR-223 is repressed and correlates with inferior clinical features in mantle cell lymphoma through targeting SOX11 | |
| Cleaver et al. | Gene-based outcome prediction in multiple cohorts of pediatric T-cell acute lymphoblastic leukemia: a Children's Oncology Group study | |
| WO2013006195A1 (en) | Methods of detecting gene fusions | |
| US20170314080A1 (en) | Serum-based mirna microarray and its use in diagnosis and treatment of barrett's esophagus (be) and esophageal adenocarcinoma (eac) | |
| WO2020102513A1 (en) | Systems and methods for characterizing and treating cancer | |
| AU2018364987A1 (en) | Non-coding RNA for detection of cancer | |
| Hu et al. | Long noncoding RNA LINC00460 aggravates invasion and metastasis by targeting miR-30a-3p/Rap1A in nasopharyngeal carcinoma | |
| Huang et al. | Inhibition of ZEB1 by miR-200 characterizes Helicobacter pylori-positive gastric diffuse large B-cell lymphoma with a less aggressive behavior | |
| Park et al. | Identification and clinical implications of circulating microRNAs for estrogen receptor-positive breast cancer | |
| Shi et al. | RNA methylation-mediated LINC01559 suppresses colorectal cancer progression by regulating the miR-106b-5p/PTEN axis | |
| Naakka et al. | miR-22 and miR-205 Drive tumor aggressiveness of mucoepidermoid carcinomas of salivary glands | |
| CN103320509A (en) | Method and kit for recovering and identifying target gene-correlative miRNA | |
| Du et al. | LncRNA landscape analysis identified LncRNA LEF-AS1 as an oncogene that upregulates LEF1 and promotes survival in chronic lymphocytic leukemia | |
| Zhai et al. | Over-expression of miR-675 in formalin-fixed paraffin-embedded (FFPE) tissues of breast cancer patients |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |