CN103320430A - Probe for recovering and identifying p21 target gene-correlative miRNA, kit and method - Google Patents
Probe for recovering and identifying p21 target gene-correlative miRNA, kit and method Download PDFInfo
- Publication number
- CN103320430A CN103320430A CN201310202354XA CN201310202354A CN103320430A CN 103320430 A CN103320430 A CN 103320430A CN 201310202354X A CN201310202354X A CN 201310202354XA CN 201310202354 A CN201310202354 A CN 201310202354A CN 103320430 A CN103320430 A CN 103320430A
- Authority
- CN
- China
- Prior art keywords
- mirna
- target gene
- cell
- probe
- mrna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to a method for recovering and identifying target gene-correlative miRNA, a kit and a method, concretely nucleic acid probe for recovering and identifying miRNA of target p21 gene mRNA, which has a nucleotide sequence of SEQ ID NO:1. The invention provides an action principle for recovering and indentifying the miRNA. The invention discloses application and an implementation strategy of the novel recovery and identification method, particularly recovery and identification of miRNA of specific gene RNA locus applied in a cell. The invention confirms that the locus recovery technology can specifically recover miRNA combined to mRNA of a p21 gene, and conforms that the miRNA can regulate and control p21 gene expression, and the method can effectively recovering and indentifying miRNA of the target specific gene mRNA.
Description
Technical field
The invention belongs to biotechnology and medical field.Particularly, the present invention relates to implementation method and application, the especially application in animal cell line of the relevant miRNA recovery of target gene, authenticate technology, for example the implementation method in human tumor cell line and purposes.
Background technology
MicroRNA (miRNA) is about 20～24nt, noncoding Microrna, and they are by suppressing the mRNA translation or promoting the mRNA degraded that target gene is carried out the regulation and control (Bartel, D.P., Cell.2004,116:281-297) of post-transcriptional level.MiRNA is the very widely little RNA of non-coding of a kind of regulating cell function, is almost controlling each biological procedures, comprises differentiation, growth, the proliferation and apoptosis of cell.In addition, studies show that now the imbalance of miRNA expression level and a lot of diseases comprise disease closely related (Hobert, Trends Biochem.Sci.2004, the 29:462 such as tumour, autoimmune disorder, diabetes, heart trouble; Lu, J. etc., Nature.2005,435:834-838; Li, Q.J. etc., Cell.2007,129:147-161; Cheng, H.Y. etc., Neuron.2007,54:813-829; Chang, T.C. etc., Mol Cell.2007,26:745-752; He, L. etc., Nature.2005,435:828-833; Care, A. etc., NatMed.2007,13:613-618).
The biological function of MiRNA is the problem that people pay special attention to, and determining of miRNA target gene is the key of research miRNA biological function, predict and biological experimental method (Daniel about the main computer bioinformatics software that leans on of determining of miRNA target gene at present, W.T. etc., Nucleic Acids Res.2011,39:6845-53;
U.A. etc., Gene.2009,451:1-5).
At present, computer Bioinformatics Prediction software commonly used has miRanda, PicTar, TargetScan, PITA and RNA22.Bioinformatics method mainly is to utilize certain algorithm the target gene sample is marked and to screen, because people find in research process, the effect between miRNA and target gene has certain regularity.Therefore, although present Forecasting Methodology is different, mainly follow following principle commonly used (Krek, A. etc., Nat Genet.2005,37:495-500; Lall, S. etc., Curr Biol.2006,16:460-71; Lewis, B.P. etc., Cell.2005,120:15-20; Kiriakidou, M. etc., Genes Dev.2004,18:1165-78; Kertesz, M. etc., Nat Genet.2007,39:1278-84; Miranda, K.C. etc., Cell.2006,126:1203-17):
(1) complementarity of miRNA and its target site;
(2) conservative property of miRNA target site between different plant species;
(3) thermostability between the miRNA-mRNA two strands;
(4) the miRNA target site place complicated secondary structure that do not have;
(5) 5 of miRNA ' end is better than 3 ' end with the binding ability of target gene.
Yet, using that the miRNA target gene is a very difficult thing in the computer forecast animal, this mainly is because miRNA and its target gene are taked the pattern of non-complete complementary in the zooblast.At present known miRNA target gene and definite target spot thereof and few do not have enough known sample can reference in the algorithm compiling procedure, even constantly increase and improve restricted condition, are difficult to acquisition yet and have simultaneously high specific and highly sensitive algorithm.And at present to computer forecast target gene out also neither one high throughput identification method fast, this has also affected the assessment to the algorithm accuracy to a great extent, thereby can't be optimized it.
Because there is certain limitation in computer simulation when prediction miRNA target gene, a lot of scholars wish to utilize biological experimental method directly to seek the miRNA target gene.Biological experimental method is sought the miRNA target gene and is mainly contained following several mode:
(1) seek miRNA target gene (Lim, L.P. etc., Nature.2005,433:769-773) from the mRNA level, the stability that affects mRNA by miRNA is sought the target gene of miRNA.But the method exists can not distinguish direct target gene or the shortcoming of indirect target gene.Simultaneously, this method has difficulties when having sought the inhibiting miRNA target gene of translation;
(2) from the complex body of the miRNA combination searching target gene of starting with.Because miRNA is by working with form and the target gene mRNA combination of Protein formation complex body, so this mode by mark miRNA or mark conjugated protein, is sought target gene (Beitzinger, the M. etc. of miRNA with the mode of co-precipitation, RNA Biol.2007,4:76-84; Ulf Andersson Orom etc., Cell.2008,30:460-471; Hafner, M. etc., Cell.2010,141:129-141; Chi, S.W. etc., Nature.2009,460:479-86).This mode can obtain the target sequence of specific miRNA or whole miRNA, but that often obtain is the result of truth in a kind of non-body, this is express the mode that miRNA enters cell and carry out because experiment is often adopted to cross, and non-specific result is very many, has affected determining true target gene;
(3) seek the miRNA target gene from protein level.Studies show that miRNA mainly plays regulating and controlling effect in translation skill to target gene, so target gene (Selbach, M. etc., Nature.2008, the 455:58-63 of miRNA are sought in the change of a lot of scholar's research protein levels; Baek, D. etc., Nature.2008,455:64-71).This mode is the same with above-mentioned mode (1), can not distinguish direct result or indirect consequence, so can not effectively determine the target gene of miRNA.
In sum, in miRNA research, the searching of target gene remains a global difficult problem, particularly the searching of the true target gene of miRNA in the animal body also there is not a kind of effectively accurately mode (Daniel from the present, W.T. etc., Nucleic Acids Res.2011,39:6845-53;
U.A. etc., Gene.2009,451:1-5).The whole world is a lot of at research fund and the manpower that drop in this field every year, owing to there not being a kind of effective target gene finding method, still produces little effect although cause expended a large amount of manpower and financial resources every year.
The miRNA authentication method of therefore, being correlated with in the urgent need to developing effective miRNA target gene authentication method or reverse target gene in this area.
Summary of the invention
One of purpose of the present invention has just provided a kind of novel relevant miRNA authenticate technology of target gene, and the new purposes in relevant miRNA research.Another object of the present invention provides the action principle of the relevant miRNA authenticate technology of this novel target gene.Another purpose of the present invention has provided purposes and the implementation strategy of this new technique in miRNA research, particularly is applied to the hit evaluation of gene-correlation miRNA of zooblast.New technology provided by the invention can specificity reclaim the miRNA that combines with target gene mRNA, and confirms that these miRNA can regulate and control the expression of target gene, and the method can effectively reclaim, identify the miRNA of target specific gene mRNA.Of the present invention also have a purpose to provide probe for this technology, the specific dna probe that particularly reclaims for the miRNA of p21 gene.
In one aspect of the invention, provide a kind of nucleic acid probe, its nucleotide sequence is SEQ ID NO:1.
In another aspect of the present invention, provide comprise above-mentioned nucleic acid probe for separating of and/or identify test kit or the cover box of miRNA, wherein said miRNA can with specific target gene mRNA specific binding in the cell, described target gene is the p21 gene, also comprises in described test kit or the cover box:
(i) cell cross-linking reagent;
(ii) RNA extracts reagent;
(iii) separate linking agent;
(iv) the nucleic acid probe conjugate reclaims reagent;
(v) miRNA separates and/or indentifying substance.
Recovery and/or evaluation miRNA from cell are provided in another aspect of the present invention, be used for the method for the detection of target gene mRNA, described target gene is the p21 gene mRNA, wherein said miRNA can with the mRNA of target gene described in cell specific binding, it is characterized in that, described method comprises:
(a) so that above-mentioned nucleic acid probe enter cell and be combined with described target gene mRNA;
(b) described cell is carried out crosslinked so that be connected with the described target gene mRNA of described nucleic acid probe and with it the miRNA of specific binding keep bonding state;
(c) from described cell, reclaim nucleic acid probe-target gene mRNA binding substances, nucleic acid probe-target gene mRNA-miRNA binding substances;
(d) separate crosslinked to the recovery product of step (c);
(e) miRNA of separation and/or evaluation and described target gene mRNA specific binding.
In a preference aspect this, nucleic acid probe enters cell and realizes by electricity irritation, chemical process or mechanical means, preferred Writhing test, liposome mediated-method, electric shocking method, electroporation, laser pore or the mediation of DEAE one dextran, more preferably liposome mediated-method.
Also having in the preference aspect this, described crosslinked mode is selected from: ultraviolet-crosslinkable, Paraformaldehyde 96 is crosslinked or their combination, and preferred Paraformaldehyde 96 is crosslinked.
In a preferred implementation aspect this, also comprise smudge cells in step (b) with (c).
In a preferred implementation aspect this, smudge cells is to be undertaken by the mode that is selected from lower group: broken with cell pyrolysis liquid cracking, ultrasonic disruption, grinding, and preferred ultrasonic disruption mode.
In another preference aspect this, the described recovery in the step (c) is undertaken by affine absorption or affinity chromatography, and used carrier is selected from: cross-linked agarose gel, crosslinked magnetic bead, preferred crosslinked magnetic bead.
Separating crosslinked in another preference aspect this is to be undertaken by one or more modes that are selected from lower group: with Proteinase K process, 30～90 ℃ process or their combination preferred 65 ℃ of processing.
Adopt one or more modes that are selected from lower group to carry out in the separation that also has miRNA in the preference aspect this and/or evaluation: miRNA chip detection, miRNA quantitative PCR detection, miRNA quantitative PCR chip detection or miRNA large scale sequencing, preferred miRNA quantitative PCR chip detection.
In certain embodiments, described RNA extraction reagent comprises the reagent that smudge cells is used.
In further embodiments, described test kit or cover box also comprise one or more materials that are selected from lower group: the reagent that container, thinner, buffer reagent, smudge cells are used, specification sheets.
In another aspect of the present invention, put down in writing in the specification sheets and adopted probe of the present invention, test kit of the present invention or cover box, use method of the present invention to reclaim and/or evaluation miRNA.
Provide in still another aspect of the invention the action principle of the relevant miRNA authenticate technology of this novel target gene in the content.The probe of target gene complementation can specificity reclaim the miRNA of target gene and combination thereof, thereby provides new technical means for the relevant miRNA of research specific gene studies.
Provide in still another aspect of the invention the relevant miRNA authenticate technology of this novel target gene zoologizeing purposes and the implementation strategy of the relevant miRNA of specific gene in the cell in the content, particularly be applied to prevention and the treatment of the miRNA that specific gene is relevant in the mammalian cell strain.
Other side of the present invention is because the disclosure of this paper is apparent to those skilled in the art.
Description of drawings
The invention will be further described below in conjunction with accompanying drawing, and wherein the following drawings only shows in order to illustrate embodiment of the present invention, rather than in order to limit to scope of the present invention.
Fig. 1: the example technique route map of the miRNA authentication method that target gene of the present invention is relevant;
Fig. 2: adopt the relevant miRNA authenticate technology specificity of target gene of the present invention to reclaim target gene mRNA:
The mode chart of A:p21 gene mRNA and the binding site of probe, PCR detection site;
B: with the detected result of p21 probe special recovery p21 gene mRNA in HepG2 and PC-3 cell and contrast probe recovery result's detection case;
The mode chart of C:STAT3 gene mRNA and the binding site of probe, PCR detection site;
The detection case that the detected result of D:STAT3 probe special recovery STAT3 gene mRNA in the HepG2 cell and contrast probe reclaim the result;
The mode chart of E:Smad3 gene mRNA and the binding site of probe, PCR detection site;
The detection case that the detected result of F:Smad3 probe special recovery Smad3 gene mRNA in the HepG2 cell and contrast probe reclaim the result;
Fig. 3: adopt the relevant miRNA authenticate technology specificity of target gene of the present invention to reclaim the miRNA relevant with the p21 gene mRNA:
A: the quantitative PCR chip detection result who reclaims the miRNA relevant with the p21 gene mRNA with the relevant miRNA authenticate technology specificity of target gene;
B: the PCR detected result of the miRNA relevant with the p21 gene mRNA;
Fig. 4: the functional analysis of the miRNA relevant with the p21 gene mRNA that the miRNA authenticate technology of being correlated with target gene detects:
A: the miRNA relevant with the p21 gene mRNA that the miRNA authenticate technology specificity of being correlated with target gene is recovered to is to the fluorescence report gene test result of p21 Gene Expression;
B: the miRNA relevant with the p21 gene mRNA that the miRNA authenticate technology specificity of being correlated with target gene is recovered to is to rna level and the protein level detected result of p21 Gene Expression;
C: the detected result that the miRNA relevant with the p21 gene mRNA that is recovered to the relevant miRNA authenticate technology specificity of target gene affects p21 gene function (cell proliferation);
The result is shown as mean+SD, n=3; *, P＜0.05; *, P＜0.01; * *, P＜0.001.
Embodiment
The inventor has successfully set up the relevant miRNA authenticate technology of target gene through long-term and deep research.The contriver also is applied to cell lines with the miRNA authenticate technology that target gene is correlated with, successfully identify the miRNA of being combined with the p21 gene mRNA, and confirm that these miRNA can regulate and control the expression of p21 gene, the contriver has set up a kind of brand-new miRNA target investigative technique thus, thereby has finished on this basis the present invention.
As used herein, have comprised " containing ", " having " or " comprising " " comprising ", " mainly by ... consist of ", " basically by ... consist of " and " by ... consist of "; " mainly by ... consist of ", " basically by ... consist of " and " by ... formation " belong to the subordinate concept of " containing ", " having " or " comprising ".
The feature that the present invention mentions, or the feature that embodiment mentions can arbitrary combination.All features that this case specification sheets discloses can with any composition forms and usefulness, each feature that discloses in the specification sheets can anyly provide the alternative characteristics of identical, impartial or similar purpose to replace.Therefore except special instruction is arranged, the feature that discloses only is the general example of equalization or similar features.
Particularly, the research of the target-seeking of miRNA is focus and the difficult point of molecular biology and RESEARCH ON CELL-BIOLOGY, seeks and identifies the miRNA target gene or identify that the effective technology of the miRNA that target gene is relevant has extensively application prospect at functional genome research.
The contriver finds by research: biotin labeled dna probe can be by the mode specific binding and the mRNA of probe complementation of hybridization, can specificity reclaims and the mRNA fragment of probe complementation by the crosslinked magnetic bead of affinity element.Design is tested for the probe of gene p21 and is shown, the p21 probe can specificity reclaim p21 gene mRNA fragment in hepatoma cell strain HepG2, and can not reclaim other gene fragment, and the contrast probe can not reclaim any gene mRNA fragment.In ptostate cancer PC 3 cell line, the p21 probe also can only specificity reclaim p21 gene mRNA fragment and can not reclaim other gene fragment, and is same, and the contrast probe can not reclaim any gene mRNA fragment.Design has obtained similar result for the probe of other gene such as STAT3, Smad3.Comprehensive above experiment, the inventor has confirmed that biotinylated probe can specific binding and reclaim mRNA fragment with the probe complementation, the material (for example miRNA) that this mode is combined with the mRNA fragment for research has extensive and high using value.
Among the appended Fig. 1 of the present invention a kind of preferred implementation of the present invention has been described, but those of ordinary skills can be based on the purpose of the ordinary method in this area and concrete operations, wherein used mode, reagent, step etc. are carried out corresponding change or improvement, and do not break away from spirit of the present invention.For example, the biotinylated derivative on the probe can be replaced with other marker; The method not only can act on the miRNP shown in the figure, also can act on the not yet mRNA-miRNA binding substances of conjugated protein; Etc..
Recovery and the authentication method of the miRNA of specific binding target gene mRNA
The invention provides a kind of method that reclaims and identify the miRNA of specific binding target gene mRNA, described method by with specificity for combining in the probe transfered cell of target gene mRNA and with this target gene mRNA, so that this probe indirectly with the miRNA that is incorporated into this target gene mRNA or miRNP (namely be combined miRNA ribonucleoprotein complex) combination, by being carried out crosslinking Treatment, cell can stablize this combination, then from cell, separate the binding substances that comprises probe, by separating crosslinked this binding substances, reclaim RNA wherein, be tested and appraised and distinguish the miRNA that obtains.
Adopt method of the present invention can obtain under the physiological status, miRNA with target gene mRNA specific binding, and can obtain simultaneously the multiple miRNA of being combined with same target gene mRNA, thereby provide strong instrument and approach for the research and development of miRNA, research and the application of mRNA regulation and control.Mostly adopt the method for computer forecast or the method for artificial interference to predict or study miRNA in the research in the past, the result often produces very high false positive rate, and adopt mode of the present invention directly to obtain the truth that mRNA is combined with miRNA in the cell, have higher confidence level and accuracy.
A. specificity is for the nucleic acid probe of target gene mRNA
Can adopt in the method for the invention the oligonucleotide probe of genome DNA probe, cDNA probe, rna probe and synthetic etc., preferred dna probe.
In the method for the invention, the preferred marker that detects and/or separate with can be used for target gene mRNA that adopts, described marker can be radioactively labelled substance or non-radioactive marker, preferred non-radioactive marker's (such as fluorescent marker).The radioactively labelled substance that can be used in the inventive method can be radio isotope commonly used in this area, for example includes but not limited to: isotropic substance
32P,
3H,
35S etc., preferred
32P uses the most general.Non-the penetrating property marker that can be used in the inventive method includes but not limited to, for example: vitamin H (biotin) and digoxin (digoxigenin), the two all is haptens.Vitamin H is a kind of micromolecular water soluble vitamin, and to the affine avidity that have uniqueness, both can form stable compound, detect by the substance that show color (such as enzyme, fluorescein etc.) that is connected on avidin or the avidin.Digoxin is a kind of steroid hapten molecule, can utilize its antibody to carry out immunodetection, and principle is similar to the detection of vitamin H.
In order to separate the binding substances (for example probe-target gene mRNA-miRNA) that comprises probe-target gene mRNA, preferably on probe with biology to a member among the member, so that this binding substances is carried out the separation of the modes such as affinity chromatography.The biology that can be used for probe mark of the present invention can be selected from a member of following biological centering to the member: a member of receptor-ligand, Ag-Ab, enzyme-substrate centering, a kind of member in biological example element-Streptavidin, biotin-avidin, vitamin H-neutral avidin, lectin-carbohydrate, staphylococcal protein A,SPA-IgG, Ag-Ab, anionic-cationic or hormone VITAMIN and lipid and the acceptor; Preferably Gaoxin, vitamin H, enzyme (such as alkaline phosphatase, horseradish peroxidase), more preferably vitamin H.
In some embodiments of the present invention, can comprise lock nucleic acid (locked nucleic acid, LNA) in the used nucleic acid probe.LNA is a kind of class oligonucleotide derivative, in the structure 2 of β-D-RIBOSE '-O, 4 '-C position forms the structure of rigidity by the shrink effect.LNA Nucleotide comprises A, C, G, T, M, six kinds of bases of mC, generally is found in A-DNA or RNA.This class nucleic acid can increase the melting temperature(Tm) (T of primer or probe (probe)
mValue), strengthens the stability of these materials, can be applicable in the technology such as real time aggregation enzyme chain reaction (real-time PCR).
Those of ordinary skills can be according to the probe of probe design principle design for the particular target gene mRNA, or determine whether to adopt lock nucleic acid and position thereof etc., or can be designed, provide described probe (becoming biotech firm etc. such as Premier company, health) by the commercial company of specialty.
Can adopt method conventional in this area, in described probe molecule transfered cell.These methods include but not limited to: electricity irritation, chemical process or mechanical means, preferred Writhing test, liposome mediated-method, electric shocking method, electroporation, laser pore or the mediation of DEAE one dextran, more preferably liposome mediated-method.
B. cell is crosslinked
As used herein, term " cell is crosslinked " or " cell is carried out crosslinking Treatment " refer to: make nucleic acid-protein or protein-protein generation covalent attachment in the cell by physics or chemical process (such as ultraviolet-crosslinkable, Paraformaldehyde 96 is crosslinked or their combination).
In the method for the invention, in probe enters cell and after target gene mRNA is combined, cell is carried out crosslinking Treatment.The purpose of this processing is: reinforce the combination of miRNA mixture and target gene mRNA, make it more stable at recovery stage.
Can adopt in this area conventional method that cell is carried out crosslinking Treatment, these methods include but not limited to: ultraviolet-crosslinkable, Paraformaldehyde 96 is crosslinked or their combination, and preferred Paraformaldehyde 96 is crosslinked.
C. comprise the recovery of the binding substances of probe-target gene mRNA
By probe in cell in conjunction with target gene mRNA, can produce the binding substances that comprises probe-target gene mRNA, such as probe-target gene mRNA-miRNA, probe-target gene mRNA-miRNP, probe-target gene mRNA-mRNA in conjunction with albumen etc.
Can adopt in this area ordinary method to reclaim intracellular these and comprise the binding substances of probe-target gene mRNA.For example, but smudge cells (as adopting the modes such as cell pyrolysis liquid cracking, ultrasonic disruption, grinding fragmentation), and the marker on the dependence probe carries out affine separation (as for the biotinylated derivative on the probe, carrying out the separation and combination thing with the magnetic bead of avidin mark) to binding substances.
D. separation and the evaluation of the crosslinked and miRNA of the solution of binding substances
As used herein, term " is separated crosslinked " to refer to so that comprise the Method and Process that the miRNA in the binding substances of probe-target gene mRNA discharges from binding substances.
The binding substances that comprises probe-target gene mRNA that can adopt ordinary method in this area or currently known methods that recovery is obtained is separated crosslinked, therefrom to discharge miRNA.Can adopt such as: separate crosslinked with methods such as lysate and Proteinase K processing, high temperature.
By reclaiming the RNA that separates in the cross-linking products, can obtain to comprise the target gene RNA of unbound state and the mixture of miRNA.Can adopt in this area to separate and with the ordinary method of separating miRNA the miRNA in the mixture be separated and identify.
The miRNA separation and/or the evaluation mode that can be used in the inventive method include but not limited to: (1) miRNA chip detection; (2) miRNA quantitative PCR detection; (3) miRNA quantitative PCR chip detection; (4) miRNA large scale sequencing etc.
By method of the present invention can obtain simultaneously under physiological status can in conjunction with and act on the multiple miRNA of same target gene mRNA.Those of ordinary skills can be as required, and the ordinary method in employing this area is is further researched and developed the miRNA of gained.
Advantage of the present invention
Advantage of the present invention mainly is:
(a) the present invention has disclosed a kind of technology and application thereof of novel research miRNA target gene, especially zoologizes the application of miRNA target gene in the cell;
(b) the present invention can study the truth of the miRNA of target gene combination in the body, can study the multiple miRNA of same target gene combination by this technology;
(c) the present invention can obtain target gene that forecasting software do not detect usually in advance in conjunction with miRNA, for the brand-new gate of a fan has been opened in miRNA research.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used for explanation the present invention and be not used in and limit the scope of the invention.Those skilled in the art can make suitable modification, change to the present invention, and these modifications and change are all within the scope of the present invention.
The experimental technique of unreceipted actual conditions in the following example, can adopt the ordinary method in this area, for example with reference to " molecular cloning experiment guide " (third edition, New York, press of cold spring harbor laboratory, New York:Cold Spring Harbor Laboratory Press, 1989) or the condition of advising according to supplier.The sequence measurement of DNA is the method for this area routine, also can provide test by commercial company.
Unless otherwise indicated, otherwise per-cent and umber calculate by weight.Unless otherwise defined, the same meaning that employed all specialties and scientific words and one skilled in the art are familiar with in the literary composition.In addition, any method similar or impartial to described content and material all can be applicable in the inventive method.The usefulness that better implementation method described in the literary composition and material only present a demonstration.
Embodiment 1: the probe specificity with mark reclaims complementary gene mRNA
Hepatoma cell strain HepG2, ptostate cancer PC 3 cell line are available from Chinese Typical Representative culture collection center (CCTCC).
With 1 * 10
3-1 * 10
8(preferred 5 * 10
6So use in this test) individual HepG2 cell spreads into containing 20ml perfect medium (RPMI1640 substratum+10% foetal calf serum, all available from PAA company) the 10cm plate in and overnight incubation, adopt the transfection of transfection reagent INTERFERin (Polyplus company) difference next day with biotin labeled p21 probe and contrast probe, probe sequence is as follows:
The P21 probe:
Vitamin H-5 '-AGAGAGGAAAAGGAGAACACGGGATGAGGAGGCTTTAAATAGTATTTCAT-3 ' (SEQ ID NO:1)
The contrast probe:
Vitamin H-5 '-GCTATGAAGAGATACATTAAGGCTATGAAGAGATACATTAAGGCTATGAA-3 ' (SEQ ID NO:2)
With 1 * 10
3-1 * 10
8(preferred 5 * 10
6So use in this test) individual PC-3 cell spreads into containing 20ml perfect medium (RPMI1640 substratum+10% foetal calf serum, all available from PAA company) the 10cm plate in overnight incubation, adopt transfection reagent INTERFERin (Polyplus company) the respectively biotin labeled p21 probe of transfection and contrast probe next day, probe sequence is as follows:
The P21 probe:
Vitamin H-5 '-AGAGAGGAAAAGGAGAACACGGGATGAGGAGGCTTTAAA
TAGTATTTCAT-3 ' (SEQ ID NO:1)
The contrast probe:
Vitamin H-5 '-GCTATGAAGAGATACATTAAGGCTATGAAGAGATACATTAAGGCTATGAA-3 ' (SEQ ID NO:2)
With 1 * 10
3-1 * 10
8(preferred 5 * 10
6So use in this test) individual HepG2 cell spreads into containing 20ml perfect medium (RPMI1640 substratum+10% foetal calf serum, all available from PAA company) the 10cm plate in overnight incubation, adopt transfection reagent INTERFERin (Polyplus company) the respectively biotin labeled STAT3 probe of transfection and contrast probe next day, probe sequence is as follows:
The STAT3 probe:
Vitamin H-5 '-AATGCAGGTAGGCGCCTCAGTCGTATCTTTCTGCAGCTTCCGTTCTCAGC-3 ' (SEQ ID NO:3)
The contrast probe:
Vitamin H-5 '-GCTATGAAGAGATACATTAAGGCTATGAAGAGATACATTAAGGCTATGAA-3 ' (SEQ ID NO:2)
With 1 * 10
3-1 * 10
8Preferred 5 * 10
6So use a HepG2 cell to spread into containing 20ml perfect medium (RPMI1640 substratum+10% foetal calf serum in this test, all available from PAA company) the 10cm plate in overnight incubation, adopt transfection reagent INTERFERin (Polyplus company) the respectively biotin labeled Smad3 probe of transfection and contrast probe next day, probe sequence is as follows:
The Smad3 probe:
Vitamin H-5 '-ATGCAACTGACTACATAAACCAATATAGCCGTATGCATCA
GAATCTGGAG-3′(SEQ?ID?NO：26)
The contrast probe:
Vitamin H-5 '-GCTATGAAGAGATACATTAAGGCTATGAAGAGATACATTAAGGCTATGAA-3 ' (SEQ ID NO:2)
Transfection is collecting cell after 24 hours, reclaims as follows RNA:
(1) with 0.1-10% (preferred 0.5-5%, in this experiment 1%) Paraformaldehyde 96 (formaldehyde) room temperature fixed cell 1-60 (preferred 5-30 minute, during this is tested 10 minutes);
(2) with glycine (glycine) balance 5 minutes at room temperature;
(3) the 10ml PBS with precooling washes three times;
(4) add 0.5-5ml (preferred 1ml, such as this experiment) lysate A (1-100mM, preferred 10-50mM, this test 20mM) Tris, pH7.0～9.0,1-5000mM (preferred 100-1000mM, this test 500mM) NaCl, 1-100mM (preferred 1-10mM, this test 2.5mM) MgCl
2, 0.1-10% (preferred 0.5-5%, this test 1%) SDS, Superase-In (Ambion company), proteinase inhibitor (Roche company) scrapes cell, and room temperature was placed 1 minute;
(5) by following pattern ultrasonication cell (VCX130, SONICS; MATERIALS company): 1-60 second (preferably such as this test 30 seconds) gap; 1-60 second (preferably such as this test 30 seconds) is ultrasonic; 1-100% (preferably such as this test 50%) total power; Ultrasonic time 1-60 minute altogether (preferably such as this test 10 minutes);
(6) with 10000g at room temperature centrifugal 10 minutes, get supernatant, get 50 μ l supernatants as input (Input) contrast;
(7) add the crosslinked magnetic bead M-280 (Invitogen company) of Streptavidin, 4-75 ℃ (preferably such as 30 ℃ of this tests) rolled in conjunction with 2 hours;
(8) remove supernatant, with cleaning buffer solution B (1-100mM (preferred 5-50mM, such as the 10mM in this test) Tris, pH7.0～9.0,1-5000mM (preferred 100-2000mM, such as the 1000mM in this test) NaCl, 1-1000mM (preferred 10-500mM is such as the 40mM in this test) EDTA, Superase-In (Ambion company), proteinase inhibitor (Roche company) washes twice, each 0.5-10ml (the preferably 2ml in this test);
(9) with cleaning buffer solution C (1-100mM (preferred 5-50mM, such as the 10mM in this test) Tris, pH7.0～9.0,1-5000mM (preferred 10-1000mM, such as the 150mM in this test) NaCl, 1-1000mM (preferred 10-500mM, such as the 40mM in this test) EDTA, 0.1-10% (preferred 0.5-5%, such as 1% in this test) SDS, Superase-In (Ambion company), proteinase inhibitor (Roche company) washes twice, each 0.5-10ml (the preferably 2ml in this test);
(10) remove supernatant, add 10-5000 μ l (preferably 200 μ l in this test) lysate A, add again 1-1000 μ l (preferably 10 μ l in this test) Proteinase K (20mg/ml), input contrast supernatant adds 10-5000 μ l (preferably 150 μ l in this test) lysate A, add 1-1000 μ l (preferably 10 μ l in this test) Proteinase K (20mg/ml), 10-90 ℃ (preferably 65 ℃ in this test) separate crosslinked 0.1-10 hour (preferably 1 hour in this test) again;
(11) add 10-1000 μ l (preferably 300 μ l in this test) TRIzol (Invitrogen company), extract RNA;
(12) processed 30 minutes at 37 ℃ of lower DNase I of using (TaKaRa company), add 500 μ l TRIzol (Invitrogen company), extract the RNA that is further purified.
Adopt reverse transcription PCR (RT-PCR) method to detect reclaiming the result: RT-PCR uses SYBR RT-PCR test kit (Takara company) and finishes at LightCycler (Roche company) quantitative PCR instrument.
The PCR primer of P21 gene mRNA:
5 '-AAA CTA GGC GGT TGA ATG AG-3 ' (upstream, SEQ ID NO:4); With
5 '-AAA GGA GAA CAC GGG ATG AG-3 ' (downstream, SEQ ID NO:5).
The PCR primer of STAT3 gene mRNA is:
5 '-CAT GGA GTT GAC CTC GGA GTG-3 ' (upstream, SEQ ID NO:6); With
5 '-TGG CAG AAT GCA GGT AGG C-3 ' (downstream, SEQ ID NO:7).
The PCR primer of Smad3 gene mRNA is:
5 '-CGT GGG ATG GCA TTT GGT C-3 ' (upstream, SEQ ID NO:27); With
5 '-GCA TCA GAA TCT GGA GCA A-3 ' (downstream, SEQ ID NO:28).
The PCR primer of confidential reference items beta-actin:
5 '-CAG CAA GCA GGA GTA TGA CG-3 ' (upstream, SEQ ID NO:8); With
5 '-GAA AGG GTG TAA CGC AAC TAA-3 ' (downstream, SEQ ID NO:9).
The PCR condition is: 95 ℃ 2 minutes; 95 ℃ of 5 second, 60 ℃ of 10 second, 72 ℃ of 15 second, 76 ℃ of fluoroscopic examinations, 40 circulations.
PCR result adopts 4% agarose gel electrophoresis to identify, the recovering state of p21 probe and contrast probe is shown in Fig. 2 B in HepG2 and the PC-3 cell.The mode chart of p21 gene mRNA and the binding site of probe, PCR detection site are shown in Fig. 2 A.The mode chart of STAT3 gene mRNA and the binding site of probe, PCR detection site are shown in Fig. 2 C, and the recovering state of STAT3 probe and contrast probe is shown in Fig. 2 D in the HepG2 cell.The mode chart of Smad3 gene mRNA and the binding site of probe, PCR detection site are shown in Fig. 2 E, and the recovering state of Smad3 probe and contrast probe is shown in Fig. 2 F in the HepG2 cell.
The result shows: the p21 probe can specificity reclaim the p21 gene mRNA from HepG2, PC-3 cell, and can not reclaim the beta-actin gene mRNA, and the contrast probe then both can not reclaim.In the HepG2 cell, the STAT3 probe can special recoverys STAT3 gene mRNA and can not reclaim the beta-actin gene mRNA, contrasts probe and then both can not reclaim.In the HepG2 cell, the Smad3 probe can special recoverys Smad3 gene mRNA and can not reclaim the beta-actin gene mRNA, contrasts probe and then both can not reclaim.
Embodiment 2: adopt the p21 probe specificity to reclaim the miRNA of being combined with the p21 gene mRNA
Adopt miRNA quantitative PCR detection chip (Exiqon company) that the RNA that probe reclaims is detected:
To serve the Haikang with the sample that reclaims with the contrast probe with the sample that the P21 probe reclaims and become biotechnology company limited to carry out miRNA quantitative PCR chip detection, and use the subsidiary software of PCR instrument to carry out the preliminary data analysis, obtain original Ct value.
The Δ Ct that calculates the relevant miRNA gene of each path in each treatment group adopts following formula:
The average Ct of the average Ct-external source of Δ Ct=confidential reference items;
Calculate the formula of the Δ Δ Ct of each gene in 2 treatment group pcr chips:
Δ Δ Ct=Δ Ct (p21)-Δ Ct (contrast).
The result shows: with respect to the contrast probe, the p21 probe specificity has reclaimed 20 kinds of miRNA (10 times to the contrast probe), 3 kinds of miRNA:miR-92a, miR-92b, miR-296-5p multiple are wherein arranged greater than 100 times, be called as the miRNA (Fig. 3 A) that combines closely most.
Adopt reverse transcription PCR (RT-PCR) method that the miRNA that combines closely is most detected: RT-PCR uses All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia company), and finishes at LightCycler (Roche company) quantitative PCR instrument.
The PCR primer of the miRNA that combines closely most is:
miR-92a：
5 '-TAT TGC ACT TGT CCC GGC CTG T-3 ' (upstream, SEQ ID NO:10); With
General downstream primer (test kit carries);
miR-92h：
5 '-TAT TGC ACT CGT CCC GGC CTC C-3 ' (upstream, SEQ ID NO:11); With
General downstream primer (test kit carries);
miR-296-5p：
5 '-AGG GCC CCC CCT CAA TCC TGT-3 ' (upstream, SEQ ID NO:12); With
General downstream primer (test kit carries).
The PCR primer of confidential reference items U6 small nuclear rna:
5 '-GTG CTC GCT TCG GCA GCA CAT ATA C-3 ' (upstream, SEQ ID NO:13); With
5 '-AAA AAT ATG GAA CGC TCA CGA ATT TG-3 ' (downstream, SEQ ID NO:14).
The condition of PCR is: 95 ℃ 10 minutes; 95 ℃ of 5 second, 58 ℃ of 10 second, 72 ℃ of 15 second, 76 ℃ of fluoroscopic examinations, 40 circulations.
PCR result adopts 4% agarose gel electrophoresis, detects p21 probe and the recovering state (referring to Fig. 3 B) of contrast probe to miRNA in the HepG2 cell.
The result shows: the p21 probe can special recoverys HepG2 cell in the p21 gene mRNA miRNA that combines closely most, and can not reclaim the U6 gene mRNA, contrast probe and then both can not reclaim.
Embodiment 3: regulate and control the expression of p21 gene with the miRNA of p21 probe specificity recovery
The miRNA that combines closely most (miR-92a, miR-92b, miR-296-5p) high expression level or the inhibition of adopting respectively following sequence (synthetic by Shanghai Ji Ma company) to obtain in the HepG2 cell so that among the embodiment 2 are expressed:
MiR-92a stand-in: UAUUGCACUUGUCCCGGCCUGU (SEQ ID NO:15);
MiR-92b stand-in: UAUUGCACUCGUCCCGGCCUCC (SEQ ID NO:16);
MiR-296-5p stand-in: AGGGCCCCCCCUCAAUCCUGU (SEQ ID NO:17);
Little RNA contrast: UUCUCCGAACGUGUCACGUTT (SEQ ID NO:18, it is modifying method commonly used during little RNA sequence is synthesized that 3 ' end adds TT outstanding, on the not impact of its function, mainly is the effect [Wilda that plays the stable nucleus thuja acid, M. etc., Oncogene.2002; 21:5176-5124]);
The miR-92a inhibition: 2 '-O-Me-ACAGGCCGGGACAAGUGCAAUA (SEQ ID NO:19);
The miR-92b inhibition: 2 '-O-Me-GGAGGCCGGGACGAGUGCAAUA (SEQ ID NO:20);
The miR-296-5p inhibition: 2 '-O-Me-ACAGGAUUGAGGGGGGGCCCU (SEQ ID NO:21); And
The inhibition contrast: 2 '-O-Me-CAGUACUUUUGUGUAGUACAA (SEQ ID NO:22).
According to bibliographical information, adopt little RNA to the HepG2 cell of INTERFERin transfection reagent (Polyplus company) transfection [Hou, J. etc., J Immunol.2009; 183:2150-2158] so that the final concentration of miRNA stand-in transfection is 50nM, the final concentration of miRNA inhibition transfection is 200nM.
Adopt the fluorescence report gene approach detect gained among the embodiment 2 combine closely most miRNA to p21 gene 3 ' non-coding region (3 '-Untranslated Region, 3 ' UTR) in conjunction with situation:
A. comprise the preparation of the fluorescence report carrier in p21 gene 3 ' UTR district
The fluorescence report carrier that comprises p21 gene 3 ' UTR district prepares (used restriction enzyme, PrimerSTAR HS archaeal dna polymerase are all available from Takara company) specific as follows:
Contain and obtain after react through PCR with the fragment (primer) of following two chemosynthesis in p21 gene 3 ' UTR district:
Fragment 1 (SEQ ID NO:23, upstream primer):
5′-
GAACTAGTAATCCGCCCACAGG-3′；
Fragment 2 (SEQ ID NO:24, downstream primer):
5′-
TGAAGCTTCTGAGGTAGAACTAGGG-3′
Underscore mark place is restriction enzyme site and protection base.
Gained p21 gene 3 ' UTR district is 953bp altogether, and (SEQ ID NO:25) is as follows for its sequence:
AATCCGCCCACAGGAAGCCTGCAGTCCTGGAAGCGCGAGGGCCTCAAAG
GCCCGCTCTACATCTTCTGCCTTAGTCTCAGTTTGTGTGTCTTAATTATTAT
TTGTGTTTTAATTTAAACACCTCCTCATGTACATACCCTGGCCGCCCCCTG
CCCCCCAGCCTCTGGCATTAGAATTATTTAAACAAAAACTAGGCGGTTGA
ATGAGAGGTTCCTAAGAGTGCTGGGCATTTTTATTTTATGAAATACTATTT
AAAGCCTCCTCATCCCGTGTTCTCCTTTTCCTCTCTCCCGGAGGTTGGGTG
GGCCGGCTTCATGCCAGCTACTTCCTCCTCCCCACTTGTCCGCTGGGTGGT
ACCCTCTGGAGGGGTGTGGCTCCTTCCCATCGCTGTCACAGGCGGTTATG
AAATTCACCCCCTTTCCTGGACACTCAGACCTGAATTCTTTTTCATTTGAG
AAGTAAACAGATGGCACTTTGAAGGGGCCTCACCGAGTGGGGGCATCAT
CAAAAACTTTGGAGTCCCCTCACCTCCTCTAAGGTTGGGCAGGGTGACCC
TGAAGTGAGCACAGCCTAGGGCTGAGCTGGGGACCTGGTACCCTCCTGGC
TCTTGATACCCCCCTCTGTCTTGTGAAGGCAGGGGGAAGGTGGGGTCCTG
GAGCAGACCACCCCGCCTGCCCTCATGGCCCCTCTGACCTGCACTGGGGA
GCCCGTCTCAGTGTTGAGCCTTTTCCCTCTTTGGCTCCCCTGTACCTTTTGA
GGAGCCCCAGCTACCCTTTTTCTCCAGCTGGGCTCTGCAATTCCCCTCTGC
TGCTGTCCCTCCCCCTTGTCCTTTCCCTTCAGTACCCTCTCAGCTCCAGGT
GGCTCTGAGGTGCCTGTCCCACCCCCACCCCCAGCTCAATGGACTGGAAG
GGGAAGGGACACACAAGAAGAAGGGCACCCTAGTTCTACCTCAG
Reaction system is: PCR reaction system cumulative volume is 25 μ l, 5 * PrimerSTAR damping fluid, 5 μ l wherein, dNTP mixture 2 μ l; Template cDNA0.2 μ g, PrimerSTAR HS archaeal dna polymerase 0.25 μ l, each 0.5 μ l of upstream and downstream primer, ddH
2O polishing to 25 μ l.
Reaction parameter is: 98 ℃ of 10s, 58 ℃ of 10s, 72 ℃ of 3min, 40 rear 72 ℃ of extension 10min of circulation.The upstream and downstream primer is introduced respectively BamH I and position, Not I enzyme point of contact.Glue reclaim above PCR product, with BamH I and Not I double digestion and be connected among the fluorescence report carrier pMIR-Report (Ambion company) through same double digestion.
B. fluorescence report detects
With 5 * 10
4Individual HepG2 cell spreads into containing 0.5ml perfect medium (RPMI1640 substratum+10% foetal calf serum, all available from PAA company) 24 orifice plates in overnight incubation, adopt next day miRNA stand-in, the 25ng of transfection reagent JetPRIME (Polyplus company) cotransfection 100nM final concentration to contain fluorescence report carrier and the 6ng confidential reference items fluorescent expression vector pRL-TK (Promega company) in p21 gene 3 ' UTR district;
With 2 * 10
4Individual HepG2 cell spreads into containing 0.5ml perfect medium (RPMI1640 substratum+10% foetal calf serum, all available from PAA company) 24 orifice plates in overnight incubation, adopt the miRNA inhibition of transfection reagent JetPRIME (Polyplus company) transfection 200nM final concentration next day, contain fluorescence report carrier and the 6ng confidential reference items fluorescent expression vector pRL-TK (Promega company) in p21 gene 3 ' UTR district after 24 hours with transfection reagent JetPRIME (Polyplus company) cotransfection 25ng;
Adopt two fluorescence report gene detection systems (Dual-Luciferase Reporter Assay System (Promega company)) to detect after 36 hours.
The result is shown in Fig. 4 A.This result shows: the miRNA that combines closely most with the p21 gene mRNA can suppress to contain the expression of the fluorescence report gene in p21 gene 3 ' UTR district very significantly, accordingly the miRNA inhibition then can be significantly or the utmost point strengthen significantly the expression of the fluorescence report gene that contains p21 gene 3 ' UTR district.
This result shows: adopt miRNA that method of the present invention identifies, that combine closely most with the p21 gene mRNA can with p21 gene 3 ' UTR district in conjunction with and performance expression regulating effect.
Embodiment 4: detect the impact of miRNA on p21 genetic expression in the HepG2 cell of combining closely most among the embodiment 2
A. on the detection of the impact of mRNA level
With 2 * 10
5Individual HepG2 cell spreads into containing 2ml perfect medium (RPMI1640 substratum+10% foetal calf serum, all available from PAA company) 6 orifice plates in overnight incubation, renew bright substratum next day, adopt the respectively miRNA stand-in of transfection 50nM final concentration of INTERFERin transfection reagent (Polyplus company), the miRNA inhibition of 200nM final concentration, difference collecting cell after 48 hours, use TRIzol (Invitrogen company) extracting total tissue RNA, carry out qRT-PCR (using SYBR RT-PCR test kit (Takara company) to finish at LightCycler (Roche company) real-time PCR).
The PCR primer of P21 gene mRNA is:
5 '-AAA CTA GGC GGT TGA ATG AG-3 ' (upstream, SEQ ID NO:4); With
5 '-AAA GGA GAA CAC GGG ATG AG-3 ' (downstream, SEQ ID NO:5).
The PCR primer of confidential reference items beta-actin is:
5 '-CAG CAA GCA GGA GTA TGA CG-3 ' (upstream, SEQ ID NO:8); With
5 '-GAA AGG GTG TAA CGC AAC TAA-3 ' (downstream, SEQ ID NO:9).
The PCR condition: 95 ℃ 2 minutes; 95 ℃ of 5 second, 60 ℃ of 10 second, 72 ℃ of 15 second, 76 ℃ of fluoroscopic examinations, 40 circulations.
PCR result adopts 4% agarose gel electrophoresis check, the miRNA high expression level of combining closely most with p21 in the HepG2 cell or suppressed impact on p21 gene mRNA level shown in Fig. 4 B figure below.
B. on the detection of the impact of protein level
With 2 * 10
5Individual HepG2 cell spreads into containing 2ml perfect medium (RPMI1640 substratum+10% foetal calf serum, all available from PAA company) 6 orifice plates in overnight incubation, renew bright substratum next day, adopt the respectively miRNA stand-in of transfection 50nM final concentration of INTERFERin transfection reagent (Polyplus company), the miRNA inhibition of 200nM final concentration, difference collecting cell after 48 hours, adopt Western blotting (Western blot, with reference to [Wu, S. etc., Oncogene.2010; 29:2302-2308]) detect p21 protein level wherein, and be confidential reference items with beta-actin, the result is shown in the upper figure of Fig. 4 B.
Above result shows: little to p21 gene mRNA level affects in the HepG2 cell with the miRNA that the p21 gene mRNA is combined closely most, and the translation skill of major effect protein: high expression level miRNA causes the reduction of p21 gene protein level, and opposite miRNA inhibition causes the rising of p21 gene protein level.
Embodiment 5. detects the impact of miRNA on the HepG2 cell function of combining closely most among the embodiment 2
With 2 * 10
3Individual HepG2 cell spreads into containing 0.2ml perfect medium (RPMI1640 substratum+10% foetal calf serum, all available from PAA company) 96 orifice plates in overnight incubation, adopt the miRNA stand-in of INTERFERin transfection reagent (Polyplus company) difference transfection 50nM final concentration or the miRNA inhibition of 200nM final concentration next day, respectively transfection one day after, adopted CCK-8 assay kit (Dojindo company) to carry out cell proliferation in two days, three days to detect, the result is shown in Fig. 4 C.
The result shows: the miRNA high expression level of combining closely most with the p21 gene mRNA can promote the propagation of cell, and the miRNA inhibition can suppress the propagation of cell.
All quote in this application as a reference at all documents that the present invention mentions, just as each piece document is quoted separately as a reference.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.
Claims (10)
1. a nucleic acid probe is characterized in that, its nucleotide sequence is SEQ ID NO:1.
One kind comprise nucleic acid probe claimed in claim 1 for separating of and/or identify test kit or the cover box of miRNA, wherein said miRNA can with specific target gene mRNA specific binding in the cell, described target gene is the p21 gene, also comprises in described test kit or the cover box:
(i) cell cross-linking reagent;
(ii) RNA extracts reagent;
(iii) separate linking agent;
(iv) the nucleic acid probe conjugate reclaims reagent;
(v) miRNA separates and/or indentifying substance.
3. one kind is reclaimed and/or identifies miRNA from cell, is used for the method for the detection of target gene mRNA, and described target gene is the p21 gene mRNA, wherein said miRNA can with the mRNA of target gene described in cell specific binding, it is characterized in that, described method comprises:
(a) so that nucleic acid probe claimed in claim 1 enter cell and be combined with described target gene mRNA;
(b) described cell is carried out crosslinked so that be connected with the described target gene mRNA of described nucleic acid probe and with it the miRNA of specific binding keep bonding state;
(c) from described cell, reclaim nucleic acid probe-target gene mRNA binding substances, nucleic acid probe-target gene mRNA-miRNA binding substances;
(d) separate crosslinked to the recovery product of step (c);
(e) miRNA of separation and/or evaluation and described target gene mRNA specific binding.
4. method as claimed in claim 3, it is characterized in that, described nucleic acid probe enters cell and realizes by electricity irritation, chemical process or mechanical means, preferred Writhing test, liposome mediated-method, electric shocking method, electroporation, laser pore or the mediation of DEAE one dextran, more preferably liposome mediated-method.
5. method as claimed in claim 3 is characterized in that, described crosslinked mode is selected from: ultraviolet-crosslinkable, Paraformaldehyde 96 is crosslinked or their combination, and preferred Paraformaldehyde 96 is crosslinked.
6. method as claimed in claim 3 also comprises smudge cells in step (b) with (c).
7. method as claimed in claim 6 is characterized in that, described smudge cells is to be undertaken by the mode that is selected from lower group: broken with cell pyrolysis liquid cracking, ultrasonic disruption, grinding, and preferred ultrasonic disruption mode.
8. method as claimed in claim 3 is characterized in that, the described recovery in the step (c) is undertaken by affine absorption or affinity chromatography, and used carrier is selected from: cross-linked agarose gel, crosslinked magnetic bead, preferred crosslinked magnetic bead.
9. method as claimed in claim 3 is characterized in that, described solution is crosslinked to be to be undertaken by one or more modes that are selected from lower group: with Proteinase K process, 30～90 ℃ process or their combination preferred 65 ℃ of processing.
10. method as claimed in claim 3, it is characterized in that, the separation of described miRNA and/or evaluation adopt the kind or the various ways that are selected from lower group to carry out: miRNA chip detection, miRNA quantitative PCR detection, miRNA quantitative PCR chip detection or miRNA large scale sequencing, preferred miRNA quantitative PCR chip detection.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310202354.XA CN103320430B (en) | 2013-05-27 | 2013-05-27 | Probe for recovering and identifying p21 target gene-correlative miRNA, kit and method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310202354.XA CN103320430B (en) | 2013-05-27 | 2013-05-27 | Probe for recovering and identifying p21 target gene-correlative miRNA, kit and method |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103320430A true CN103320430A (en) | 2013-09-25 |
| CN103320430B CN103320430B (en) | 2014-11-26 |
Family
ID=49189474
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310202354.XA Active CN103320430B (en) | 2013-05-27 | 2013-05-27 | Probe for recovering and identifying p21 target gene-correlative miRNA, kit and method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103320430B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2581447A1 (en) * | 2011-10-12 | 2013-04-17 | Royal College of Surgeons in Ireland | Selective isolation of a messenger RNA molecule having its cognate micro RNA molecules bound thereto |
-
2013
- 2013-05-27 CN CN201310202354.XA patent/CN103320430B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2581447A1 (en) * | 2011-10-12 | 2013-04-17 | Royal College of Surgeons in Ireland | Selective isolation of a messenger RNA molecule having its cognate micro RNA molecules bound thereto |
Non-Patent Citations (2)
| Title |
|---|
| 吴顺全等: "慢病毒荧光素酶载体介导的miRNA 靶向基因筛选系统的建立及应用", 《中国实验血液学杂志》, vol. 20, no. 1, 31 January 2012 (2012-01-31), pages 159 - 163 * |
| 王炜等: "分子新表荧光探针快速检测p21mRNA的新方法", 《化学传感器》, vol. 25, no. 2, 30 June 2005 (2005-06-30) * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103320430B (en) | 2014-11-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Rask et al. | High expression of miR‐21 in tumor stroma correlates with increased cancer cell proliferation in human breast cancer | |
| Yang et al. | Progress risk assessment of oral premalignant lesions with saliva miRNA analysis | |
| Nakayama et al. | Clinicopathological significance of the CRTC3–MAML2 fusion transcript in mucoepidermoid carcinoma | |
| Heinzelmann et al. | MicroRNAs with prognostic potential for metastasis in clear cell renal cell carcinoma: a comparison of primary tumors and distant metastases | |
| Tahiri et al. | Deregulation of cancer-related miRNAs is a common event in both benign and malignant human breast tumors | |
| Arora et al. | MicroRNA‐328 is associated with (non‐small) cell lung cancer (NSCLC) brain metastasis and mediates NSCLC migration | |
| Gao et al. | MiR-15a, miR-16-1 and miR-17-92 cluster expression are linked to poor prognosis in multiple myeloma | |
| AU2015242941B2 (en) | ncRNA and uses thereof | |
| Wach et al. | MicroRNA profiles of prostate carcinoma detected by multiplatform microRNA screening | |
| Lae et al. | Global gene expression profiling of PAX‐FKHR fusion‐positive alveolar and PAX‐FKHR fusion‐negative embryonal rhabdomyosarcomas | |
| Morokoff et al. | Molecular subtypes, stem cells and heterogeneity: Implications for personalised therapy in glioma | |
| Egloff et al. | The 7SK snRNP associates with the little elongation complex to promote snRNA gene expression | |
| Gahan | Circulating nucleic acids in plasma and serum: diagnosis and prognosis in cancer | |
| Li et al. | Increased expression of miR-93 is associated with poor prognosis in head and neck squamous cell carcinoma | |
| Boldrini et al. | Role of microRNA-33a in regulating the expression of PD-1 in lung adenocarcinoma | |
| Zhou et al. | miR-223 is repressed and correlates with inferior clinical features in mantle cell lymphoma through targeting SOX11 | |
| WO2013006195A1 (en) | Methods of detecting gene fusions | |
| KR20110106436A (en) | Genetic analysis of cells | |
| WO2020102513A1 (en) | Systems and methods for characterizing and treating cancer | |
| AU2018364987A1 (en) | Non-coding RNA for detection of cancer | |
| Hu et al. | Long noncoding RNA LINC00460 aggravates invasion and metastasis by targeting miR-30a-3p/Rap1A in nasopharyngeal carcinoma | |
| Huang et al. | Inhibition of ZEB1 by miR-200 characterizes Helicobacter pylori-positive gastric diffuse large B-cell lymphoma with a less aggressive behavior | |
| Park et al. | Identification and clinical implications of circulating microRNAs for estrogen receptor-positive breast cancer | |
| Shi et al. | RNA methylation-mediated LINC01559 suppresses colorectal cancer progression by regulating the miR-106b-5p/PTEN axis | |
| Attia et al. | ITGA4 gene methylation status in chronic lymphocytic leukemia |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |