CN103320408A - Recombinant human alanine aminotransferase protein standard, recombinant human aspartate aminotransferase protein standard, and preparation methods thereof - Google Patents

Abstract

The invention relates to preparation of standards, and particularly relates to a recombinant human alanine aminotransferase protein standard, a recombinant human aspartate aminotransferase protein standard, and preparation methods thereof. A nucleotide sequence of encoding the recombinant human alanine aminotransferase protein standard is shown in SEQ ID NO:3; the nucleotide sequence of encoding the recombinant human aspartate aminotransferase protein standard is shown in SEQ ID NO:6. The invention also relates to the preparation method of the recombinant human alanine aminotransferase protein standard or the recombinant human aspartate aminotransferase protein standard. The preparation method comprises the following steps: obtaining a target gene; building a gene expression strain; expressing and purifying target protein; processing matrix serum, evaluating the standard, and evaluating a constant value and the uncertainty of the standard. The recombinant human alanine aminotransferase protein standard and the recombinant human aspartate aminotransferase protein standard prepared by adopting a gene recombination technique disclosed by the invention can be applied to clinical test of a laboratory and mass control of a kit.

Description

A kind of recombinant human gpt protein standard substance and recombinant human glutamic-oxal(o)acetic transaminase protein standard substance and preparation method thereof

Technical field

The present invention relates to the standard substance preparation, specifically, relate to a kind of recombinant human gpt protein standard substance and recombinant human glutamic-oxal(o)acetic transaminase protein standard substance and preparation method thereof.

Background technology

Reference material refers to is exactly to have one or more enough all even fine characteristic values of having determined, in order to calibrating measuring device, estimate measuring method or to a kind of material or the material of material assignment.The external diagnosis reagent reference material is to realize the accurate consistent main tool of external diagnosis reagent supervision and inspection data and result, also is the metering material standard that guarantees the value effective communication.Complete trace to the source, in transmission of quantity value and the trimming process, reference material plays a part the reproduction value, transmits the value uncertainty and realizes measuring accurately consistent.According to the requirement of National Laboratory's accreditation criteria, should trace to the source or proofread and correct for the instrument and the Interventions Requested that detect, only have Application standard material guarantee check conclusion accurately consistent.Along with country improves constantly to the increasing of external diagnosis reagent supervision and management dynamics with to the requirement of inspection technology, also more and more stronger to the demand of external diagnosis reagent reference material.

At present, gpt and glutamic-oxal(o)acetic transaminase remain the project of clinical biochemical check, and the transaminase test kit on the China market is of a great variety.In the face of the so many diagnostic reagent of kind on the market, quality control and evaluation to diagnostic reagent become particularly important, international clinical chemistry meeting (IFCC) and Japan Clinic check VESA Video Electronics Standard Association (JCCLS) has developed and has been used for Clinical Laboratory reference laboratory pricer gpt reference material and people's glutamic-oxal(o)acetic transaminase reference material in the world, but these reference materials are to be used in the world estimating Clinical Test Lab, because the applicable elements of these international reference materialses and the restriction of concentration, be difficult to be applied in my quality control of transaminase detection kit.Therefore need to develop the reference material that is applicable to China's transaminase determination test kit quality evalution.

Therefore, development recombinant human transaminase reference material to on China market, has very important meaning to people's gpt detection kit, the quality evalution of people's glutamic-oxal(o)acetic transaminase detection kit.

Transaminase is a kind of seroenzyme, has kind more than 20, and what be used for diagnosing hepatic diseases has two kinds: gpt and glutamic-oxal(o)acetic transaminase.Many internal organs and organize and all contain this two kinds of enzymes, but gpt mainly is distributed in the cytoplasm of liver cell of human body, and glutamic-oxal(o)acetic transaminase mainly is distributed in the plastosome of myocardial cell and liver cell.Under normal circumstances, the content of transaminase is lower in the Healthy Human Serum, and the normal value of gpt and glutamic-oxal(o)acetic transaminase serum is 0-40U/L.When the liver of human body sustained damage because of disease, transaminase entered blood by the liver cell of damage.Because whole liver transaminase content is about 100 times of transaminase content in the blood, therefore, as long as 1% hepatic necrosis is arranged, just be enough to make the enzymic activity in the serum to increase by 1 times.Again since in the liver cell the high 1000-5000 of transaminase concentration ratio serum doubly, liver cell because damage and permeability are when increasing, even liver cell without necrosis, the transaminase in the liver cell also can enter blood because of the concentration difference inside and outside the cell.Therefore, the height of serum transaminase concentration is the sensitive indicator of hepatocellular damage.But the amplitude of Glutamate pyruvate transaminase rises is sometimes not necessarily parallel with the severity of liver injury, and when the liver cell extensive necrosis, liver cell can not be synthesized transaminase, makes the rising of serum transaminase not obvious or lowered by original high level.Therefore, the rising of gpt and glutamic-oxal(o)acetic transaminase only reflects the reactivity of hepatic disease, namely has or not the pathology of liver cell with downright bad, lacks specificity, and various hepatic diseases and many Extrahepatic diseases all can cause the rising of two kinds of enzymes.It is the important index that liver function goes wrong that transaminase activity in the human serum raises, the method of conventional sense transaminase activity is the enzyme kinetics method, its commercially available reagent is divided into according to the content of coenzyme and contains and phosphoric acid pyridoxal (PLP) two classes not, and the observed value that contains PLP reagent is significantly higher than the reagent that does not contain PLP.The calibrating mode of laboratory use is different in addition, has also caused the accuracy of measuring result between the laboratory and comparability poor.Matter comments the result to show between national chambers in 2009, and variation reaches 10.9% between the chamber of ALT.In addition owing to lacking the transaminase reference material, so that some domestic gpt test kits can't carry out performance evaluation.2002 international clinical chemistry meeting (IFCC) announced the reference method that 37 ℃ of lower ALT and AST measure, the method has represented the maximum dose level level of paddy ammonia enzymatic determination, conventional observed value can be traceable to the reference method variable by reference material, and international transaminase standard substance mainly are ERM-AD454 and the ERM-AD457 that is provided by European standard office.International standard substance is mainly used in the checking of reference laboratory reference method accuracy, also is not applicable to the transaminase standard substance that ordinary method checking and diagnostic reagent are estimated at present.

At present domestic research to the transaminase standard substance mainly is the serum by the transaminase of collecting different concns, be used as quality control product, this method is difficult to obtain the serum of the high value level of transaminase, up to now, the domestic report that does not also come production transaminase standard substance raw material by the method for gene recombination.

Express the target protein history of existing decades with intestinal bacteria as engineering strain.The intestinal bacteria system is owing to the first-selected expression system that becomes the many hospitals of expression protein is fully understood by people in its genetics, biological chemistry and molecular biology aspect.The intestinal bacteria genetic map is clear and definite, and easily cultivation and expense are low, and numerous protein is had very strong tolerance, can these protein of high level expression.Therefore can attempt expressing gpt with escherichia expression system.

The normal reference value of gpt is 0～40U/L in the human blood, transaminase concentration in the patient blood of hepatocellular injury is higher, the gpt albumen that therefore, gene recombination can be obtained adds in the people's that contain proteinase inhibitor the serum and prepares restructuring gpt reference material.

The restructuring gpt reference material of producing is carried out homogeneity and estimation of stability, and it is carried out definite value and uncertain assessment, can obtain the gpt reference material.

Summary of the invention

Primary goal of the invention of the present invention is to have proposed a kind of recombinant human gpt protein standard substance and recombinant human glutamic-oxal(o)acetic transaminase protein standard substance.

The second goal of the invention of the present invention has been to propose the preparation method of this recombinant human gpt protein standard substance and recombinant human glutamic-oxal(o)acetic transaminase protein standard substance.

In order to realize purpose of the present invention, the technical scheme of employing is:

A kind of recombinant human gpt protein standard substance, the nucleotide sequence of the described recombinant human gpt protein standard substance of encoding is shown in SEQ ID NO:3, and its aminoacid sequence is shown in SEQ ID NO:1.

A kind of recombinant human glutamic-oxal(o)acetic transaminase protein standard substance, the nucleotide sequence of the described recombinant human glutamic-oxal(o)acetic transaminase protein standard substance of encoding is shown in SEQ ID NO:6, and its aminoacid sequence is shown in SEQ ID NO:4.

SEQ?ID?NO:1：

MASSTGDRSQAVRHGLRAKVLTLDGMNPRVRRVEYAVRGPIVQRALELEQELRQGVKKPFTEVIRANIGDAQAMGQRPITFLRQVLALCVNPDLLSSPNFPDDAKKRAERILQACGGHSLGAYSVSSGIQLIREDVARYIERRDGGIPADPNNVFLSTGASDAIVTVLKLLVAGEGHTRTGVLIPIPQYPLYSATLAELGAVQVDYYLDEERAWALDVAELHRALGQARDHCRPRALCVINPGNPTGQVQTRECIEAVIRFAFEERLFLLADEVYQDNVYAAGSQFHSFKKVLMEMGPPYAGQQELASFHSTSKGYMGECGFRGGYVEVVNMDAAVQQQMLKLMSVRLCPPVPGQALLDLVVSPPAPTDPSFAQFQAEKQAVLAELAAKAKLTEQVFNEAPGISCNPVQGAMYSFPRVQLPPRAVERAQELGLAPDMFFCLRLLEETGICVVPGSGFGQREGTYHFRMTILPPLEKLRLLLEKLSRFHAKFTLEYS

SEQ?ID?NO:2：

ATGGCCTCGAGCACAGGTGACCGGAGCCAGGCGGTGAGGCATGGACTGAGGGCGAAGGTGCTGACGCTGGACGGCATGAACCCGCGTGTGCGGAGAGTGGAGTACGCAGTGCGTGGCCCCATAGTGCAGCGAGCCTTGGAGCTGGAGCAGGAGCTGCGCCAGGGTGTGAAGAAGCCTTTCACCGAGGTCATCCGTGCCAACATCGGGGACGCACAGGCTATGGGGCAGAGGCCCATCACCTTCCTGCGCCAGGTCTTGGCCCTCTGTGTTAACCCTGATCTTCTGAGCAGCCCCAACTTCCCTGACGATGCCAAGAAAAGGGCGGAGCGCATCTTGCAGGCGTGTGGGGGCCACAGTCTGGGGGCCTACAGCGTCAGCTCCGGCATCCAGCTGATCCGGGAGGACGTGGCGCGGTACATTGAGAGGCGTGACGGAGGCATCCCTGCGGACCCCAACAACGTCTTCCTGTCCACAGGGGCCAGCGATGCCATCGTGACGGTGCTGAAGCTGCTGGTGGCCGGCGAGGGCCACACACGCACGGGTGTGCTCATCCCCATCCCCCAGTACCCACTCTACTCGGCCACGCTGGCAGAGCTGGGCGCAGTGCAGGTGGATTACTACCTGGACGAGGAGCGTGCCTGGGCGCTGGACGTGGCCGAGCTTCACCGTGCACTGGGCCAGGCGCGTGACCACTGCCGCCCTCGTGCGCTCTGTGTCATCAACCCTGGCAACCCCACCGGGCAGGTGCAGACCCGCGAGTGCATCGAGGCCGTGATCCGCTTCGCCTTCGAAGAGCGGCTCTTTCTGCTGGCGGACGAGGTGTACCAGGACAACGTGTACGCCGCGGGTTCGCAGTTCCACTCATTCAAGAAGGTGCTCATGGAGATGGGGCCGCCCTACGCCGGGCAGCAGGAGCTTGCCTCCTTCCACTCCACCTCCAAGGGCTACATGGGCGAGTGCGGGTTCCGCGGCGGCTATGTGGAGGTGGTGAACATGGACGCTGCAGTGCAGCAGCAGATGCTGAAGCTGATGAGTGTGCGGCTGTGCCCGCCGGTGCCAGGACAGGCCCTGCTGGACCTGGTGGTCAGCCCGCCCGCGCCCACCGACCCCTCCTTTGCGCAGTTCCAGGCTGAGAAGCAGGCAGTGCTGGCAGAGCTGGCGGCCAAGGCCAAGCTCACCGAGCAGGTCTTCAATGAGGCTCCTGGCATCAGCTGCAACCCAGTGCAGGGCGCCATGTACTCCTTCCCGCGCGTGCAGCTGCCCCCGCGGGCGGTGGAGCGCGCTCAGGAGCTGGGCCTGGCCCCCGATATGTTCTTCTGCCTGCGCCTCCTGGAGGAGACCGGCATCTGCGTGGTGCCAGGGAGCGGCTTTGGGCAGCGGGAAGGCACCTACCACTTCCGGATGACCATTCTGCCCCCCTTGGAGAAACTGCGGCTGCTGCTGGAGAAGCTGAGCAGGTTCCATGCCAAGTTCACCCTCGAGTACTCCTGA

SEQ?ID?NO:3

GCTTCTTCTACTGGTGATCGTTCTCAGGCTGTTCGTCATGGTCTGCGTGCGAAAGTTCTGACCCTGGACGGCATGAACCCGCGTGTTCGTCGCGTCGAATACGCCGTGCGTGGCCCGATCGTTCAGCGTGCTCTGGAACTGGAACAAGAACTGCGTCAGGGCGTTAAAAAGCCGTTCACCGAGGTTATCCGCGCCAACATCGGCGATGCCCAGGCTATGGGTCAGCGTCCTATCACCTTCCTGCGCCAGGTCCTGGCGCTGTGCGTAAACCCAGACCTGCTGAGCTCTCCGAACTTCCCGGACGACGCTAAGAAACGTGCGGAACGCATCCTGCAGGCATGCGGTGGCCACAGCCTGGGCGCTTACAGCGTTTCCTCCGGTATCCAGCTGATTCGTGAAGATGTTGCCCGTTACATCGAGCGCCGTGATGGCGGTATCCCGGCGGACCCTAACAACGTATTCCTGTCTACCGGTGCGTCCGATGCCATTGTTACCGTTCTGAAGCTGCTGGTGGCTGGCGAGGGTCACACCCGTACCGGTGTCCTGATTCCGATTCCACAGTATCCGCTGTATTCTGCTACTCTGGCTGAACTGGGTGCGGTGCAGGTAGACTATTACCTGGATGAGGAGCGCGCTTGGGCGCTGGACGTCGCAGAGCTGCACCGCGCACTGGGCCAGGCACGTGACCACTGCCGTCCGCGTGCGCTGTGCGTGATTAACCCGGGCAACCCGACGGGCCAAGTTCAGACCCGTGAATGCATCGAAGCTGTGATTCGTTTTGCTTTCGAAGAACGTCTGTTCCTGCTGGCGGACGAAGTTTATCAGGACAACGTTTACGCAGCCGGTAGCCAGTTTCATTCTTTCAAGAAAGTTCTGATGGAAATGGGTCCGCCGTATGCGGGTCAGCAAGAACTGGCATCCTTCCACTCTACCTCCAAAGGTTATATGGGTGAGTGTGGCTTCCGTGGTGGTTATGTTGAAGTAGTTAATATGGACGCGGCTGTGCAGCAGCAGATGCTGAAGCTGATGTCTGTGCGCCTGTGCCCGCCTGTGCCGGGTCAAGCCCTGCTGGATCTGGTTGTGTCTCCGCCTGCTCCGACTGATCCGTCCTTCGCACAATTCCAGGCTGAGAAACAGGCCGTTCTGGCGGAACTGGCAGCGAAAGCCAAACTGACGGAACAAGTGTTCAACGAAGCGCCGGGTATCTCCTGCAATCCGGTACAAGGCGCGATGTATAGCTTCCCGCGCGTTCAGCTGCCGCCACGCGCAGTAGAACGTGCACAGGAACTGGGCCTGGCTCCGGACATGTTCTTCTGTCTGCGCCTGCTGGAAGAAACCGGTATTTGCGTTGTACCTGGCAGCGGCTTCGGTCAACGTGAAGGTACTTACCACTTCCGTATGACCATCCTGCCTCCGCTGGAAAAACTGCGTCTGCTGCTGGAAAAGCTGTCCCGTTTTCACGCGAAATTCACTCTGGAATATTCTTAG

SEQ?ID?NO:4

ALLHSGRVLSGVASAFHPGLAAAASARASSWWAHVEMGPPDPILGVTEAFKRDTNSKKMNLGVGAYRDDNGKPYVLPSVRKAEAQIAAKNLDKEYLPIGGLAEFCKASAELALGENNEVLKSGRYVTVQTISGTGALRIGANFLQRFFKFSRDVFLPKPSWGNHTPIFRDAGMQLHSYRYYDPKTCGFDFTGALEDISKIPAQSVILLHACAHNPTGVDPRPEQWKEMATLVKKNNLFAFFDMAYQGFASGDGNKDAWAVRHFIEQGINVCLCQSYAKNMGLYGERVGAFTVVCKDAEEAKRVESQLKILIRPMYSNPPVNGARIASTILTSPDLRQQWLQEVKGMADRIISMRTQLVSNLKKEGSSHNWQHIVDQIGMFCFTGIKPEQVERLTKEFSIYMTKDGRISVAGVTSGNVGYLAHAIHQVTK

SEQ?ID?NO:5

ATGGCCCTGCTGCACTCCGGCCGCGTCCTGTCCGGAGTCGCCTCCGCCTTCCACCCAGGCCTCGCTGCTGCAGCATCTGCCAGAGCCAGCTCCTGGTGGGCTCATGTGGAGATGGGGCCCCCAGATCCCATCCTGGGAGTCACAGAAGCCTTTAAGAGAGACACCAACAGCAAAAAGATGAATCTGGGAGTTGGTGCCTACCGGGATGATAACGGAAAGCCTTACGTGCTCCCTAGTGTCCGAAAGGCAGAGGCGCAGATTGCTGCAAAAAATTTGGACAAAGAATACCTGCCCATTGGAGGACTGGCGGAATTTTGTAAGGCATCTGCAGAACTAGCCCTGGGTGAGAACAATGAGGTGTTGAAAAGTGGCCGGTATGTCACCGTGCAGACCATTTCTGGGACCGGGGCCCTGCGGATCGGAGCCAATTTTCTGCAAAGATTTTTTAAGTTCAGCCGAGATGTCTTCCTGCCGAAACCATCCTGGGGAAATCACACCCCCATCTTCAGGGACGCTGGCATGCAGCTGCATAGTTACCGATACTATGACCCCAAGACCTGCGGCTTTGACTTCACAGGTGCTCTTGAGGACATTTCAAAAATACCAGCTCAGAGTGTAATTCTCCTGCACGCCTGTGCCCACAATCCCACAGGAGTGGACCCTCGTCCTGAGCAGTGGAAGGAGATGGCCACACTGGTGAAGAAAAACAATCTCTTTGCATTCTTTGACATGGCCTACCAAGGCTTTGCCAGTGGCGATGGTAACAAGGATGCTTGGGCAGTGCGCCACTTCATCGAACAGGGCATCAATGTTTGTCTCTGCCAGTCCTATGCCAAGAACATGGGCTTATACGGTGAGCGTGTGGGAGCCTTCACTGTGGTCTGCAAAGATGCTGAGGAAGCCAAAAGGGTGGAGTCACAGTTGAAGATCTTGATCCGTCCTATGTATTCCAACCCTCCTGTCAACGGGGCCCGGATTGCCTCGACCATCCTGACCAGCCCGGATCTGCGGCAACAATGGTTGCAGGAAGTCAAGGGCATGGCCGACCGCATCATTAGCATGAGGACCCAGCTGGTCTCCAACCTCAAGAAGGAGGGCTCCTCCCACAACTGGCAGCACATCGTTGACCAGATCGGCATGTTTTGTTTCACAGGCATAAAGCCTGAACAGGTGGAGCGGCTGACCAAGGAGTTCTCCATCTACATGACAAAGGATGGCCGCATCTCTGTGGCAGGGGTCACCTCTGGCAATGTGGGCTACCTTGCCCATGCCATTCACCAGGTCACCAAGTAA

SEQ?ID?NO:6

GCTCTGCTGCATTCTGGTCGTGTACTGCCTGGTATTGCTGCTGCATTCCACCCGGGCCTGGCCGCGGCGGCTTCTGCACGTGCATCCTCCTGGTGGACTCATGTAGAAATGGGTCCGCCAGATCCGATCCTGGGTGTTACCGAGGCGTTCAAACGCGATACCAATTCCAAGAAGATGAACCTGGGTGTGGGCGCGTACCGTGACGACAATGGCAAACCTTACGTACTGCCATCTGTGCGTAAAGCAGAAGCGCAAATCGCGGCTAAAAACCTGGACAAAGAATATCTGCCAATCGGCGGCCTGGCGGAATTTTGTAAAGCTTCTGCGGAACTGGCGCTGGGTGAAAACAGCGAAGTGCTGAAAAGCGGTCGTTTCGTTACCGTACAGACTATCTCTGGTACCGGTGCTCTGCGCATTGGTGCTTCTTTTCTGCAACGTTTCTTCAAATTCTCTCGTGACGTGTTCCTGCCGAAGCCGACGTGGGGCAACCACACCCCGATTTTTCGCGATGCGGGCATGCAACTGCAAGGTTACCGCTACTATGATCCGAAAACTTGCGGCTTCGACTTTACTGGCGCCGTGGAAGACATCTCCAAGATCCCGGAACAGAGCGTTCTGCTGCTGCACGCATGTGCTCATAACCCAACTGGCGTAGACCCGCGTCCGGAACAGTGGAAAGAAATTGCTACCGTTGTAAAGAAACGTAACCTGTTCGCTTTCTTCGACATGGCCTACCAGGGCTTCGCGTCTGGTGACGGTGATAAGGACGCGTGGGCGGTTCGCCACTTCATTGAACAAGGTATCAATGTATGTCTGTGCCAGAGCTACGCCAAAAACATGGGCCTGTACGGCGAACGTGTGGGCGCCTTCACCATGGTTTGCAAAGATGCTGATGAGGCTAAACGTGTGGAATCTCAGCTGAAAATTCTGATCCGCCCGATGTACAGCAACCCACCTCTGAACGGCGCTCGTATTGCGGCTGCCATTCTGAACACCCCGGACCTGCGTAAACAGTGGCTGCAGGAGGTAAAAGTTATGGCTGATCGTATCATTGGTATGCGTACTCAGCTGGTTTCTAACCTGAAGAAGGAAGGCTCCACCCATAACTGGCAGCATATCACCGATCAGATCGGCATGTTCTGTTTCACGGGTCTGAAACCGGAGCAGGTGGAGCGTCTGATCAAAGAGTTTAGCATTTATATGACCAAGGATGGCCGTATCAGCGTAGCAGGTGTTACCTCCAGCAACGTTGGCTATCTGGCTCATGCTATCCATCAAGTAACCAAG

A kind of recombinant gene expression vector, described recombinant gene expression vector contain SEQ ID NO:3 or the described nucleotide sequence of SEQ ID NO:6.Described recombinant gene expression vector is selected from the PRSF-Duet plasmid.Described PRSF-Duet plasmid inserted the 6His label before the goal gene fragment.

A kind of genetic engineering bacterium, described genetic engineering bacterium contains described recombinant expression vector.Described genetic engineering bacterium is selected from e. coli strain bl21.

The preparation method of this recombinant human gpt protein standard substance or recombinant human glutamic-oxal(o)acetic transaminase protein standard substance may further comprise the steps:

(1) acquisition of goal gene: the sequence of inquirer's gpt albumen and people's glutamic-oxal(o)acetic transaminase albumen according to intestinal bacteria preference codon table, is optimized the sequence of searching, and synthesizes;

(2) make up the genetic expression bacterial strain: the method by double digestion is downcut synthetic gene from replicating vector, connect into the expression vector PRSF-Duet of gene, and the expression vector that builds is converted in the e. coli bl21 thalline, make up engineering strain;

(3) expression and purification of target protein: with the expression of IPTG inducible protein, and the albumen of expressing carried out purifying, obtain people's gpt albumen and people's glutamic-oxal(o)acetic transaminase albumen, and gpt and the glutamic-oxal(o)acetic transaminase albumen that obtains is carried out active mensuration;

(4) processing of matrix serum;

(5) evaluation of recombinant human gpt protein standard substance or recombinant human glutamic-oxal(o)acetic transaminase protein standard substance;

(6) recombinant human gpt protein standard substance or the definite value of recombinant human glutamic-oxal(o)acetic transaminase protein standard substance and the assessment of uncertainty.

The first optimal technical scheme of this preparation method is: in step (3), the inductive condition of target protein is: IPTG concentration is 0.01～2.0mmol/L, and inducing temperature is 15～35 ℃; Be preferably: 2mmol/L, inducing temperature are 25 ℃.

The second optimal technical scheme of this preparation method is: in step (3), the purifying of target protein adopts affinity chromatography and sieve chromatography, the preferred nickel ion affinity chromatograph of described affinity chromatography, the preferred dextran G50 gel molecular of described sieve chromatography sieve chromatography.

This preparation method's the 3rd optimal technical scheme is: behind the protein purification, the protein-active of people's gpt is 80000U/L, and the activity of people's glutamic-oxal(o)acetic transaminase albumen is 136000U/L.

This preparation method's the 4th optimal technical scheme is: in step (4), the processing of matrix serum comprises the examination of pathogenic micro-organism and removes Fibrinogen.

This preparation method's the 5th optimal technical scheme is: in step (5), described Evaluation for Uniformity comprises Evaluation for Uniformity between the interior Evaluation for Uniformity of the bottle of reference material and bottle, and the estimation of stability of reference material comprises the freeze-thaw stability evaluation of reference material, 4 ℃ of evaluations of condition of storage stability inferior, ambient stable evaluation and permanent stability evaluations.

This preparation method's the 6th optimal technical scheme is: in step (6), measuring gpt activity is 1100.7U/L, and uncertainty is 36.73U/L; The glutamic-oxal(o)acetic transaminase activity is 748.8U/L, and uncertainty is 33.20U/L.

The below makes further explanation technical scheme of the present invention.

By people's gpt gene and people's glutamic-oxal(o)acetic transaminase gene order are optimized, and aminotransferase gene is cloned in the PRSF-Duet carrier, carrier is converted in the e. coli bl21 thalline, successful expression people's gpt albumen and glutamic-oxal(o)acetic transaminase albumen, purifying by albumen has obtained active gpt albumen for 80000U/L and actively has been the glutamic-oxal(o)acetic transaminase albumen of 136000U/L, apotransminase is made the transaminase standard substance, by the transaminase standard substance are estimated, draw the transaminase standard substance and have good uniformity, have good stability.At last standard substance are carried out definite value and uncertainty evaluation, drawing gpt activity is 1100.7U/L, and uncertainty is 36.73U/L.The glutamic-oxal(o)acetic transaminase activity is 748.8U/L, and uncertainty is 33.20U/L.

Carry out the expression of goal gene with intestinal bacteria, generally goal gene is from cDNA library, or directly uses the acquisition of increasing from corresponding genome of polymerase chain reaction (PCR) technology.But the goal gene that obtains in this way often be not have protein expression, or the amount of protein expression is very low through after recombinant conversion is to intestinal bacteria, even optimize host's growth conditions, expressing quantity does not still take on a new look.The reason that causes this phenomenon is as the e. coli protein expression system, when expressing foreign protein, codon is had preferences.So far, scientist is the preferences what evolution pressure has caused codon to use in thinking still.Sudden change in every kind of biology between the synonym-selections balance can the partial interpretation genome in GC content on the impact of codon distribution and the change of codon type of service.Also some studies have shown that, the reason that intestinal bacteria preference codon phenomenon occurs is the different amts of tRNA corresponding to synonym different in the intestinal bacteria, and tRNA quantity corresponding to some synonym is more, and causing it is colibacillary preference codon.No matter what reason causes the preferences of codon, incontrovertible is that the preferences of codon has far-reaching influence to the expression of heterologous protein ^[22-23]

The present invention is in order to make e. coli strain bl21 can give expression to smoothly gpt and glutamic-oxal(o)acetic transaminase albumen, the frequency of utilization of codon in the expression in escherichia coli system to target protein done analysis, the codon that analysis draws in the target protein has many frequencies of utilization in escherichia expression system to be lower than 10%, such as Fig. 1, shown in Figure 3, the existence of these codons may affect the normal expression of target protein.Goal gene is optimized according to intestinal bacteria preference codon table, there has not been frequency of utilization to be lower than 10% codon in the codon of optimum result demonstration target protein, such as Fig. 2, shown in Figure 4, the gene clone optimized to expression vector, is converted into expression vector in the e. coli strain bl21 again.Experimental result shows that target protein is expressed smoothly, and the output of target protein is also higher.

Many studies show that, different inductive conditions has a great impact the amount of escherichia coli expression foreign protein, therefore must learn the inductive condition of target protein is explored.Affect target protein expression factor a lot, comprising the selection of Host Strains substratum, Host Strains is induced the size of front cell concn, IPTG concentration during inducible protein, and the inducing temperature of target protein etc. ^[24]Rule of thumb and the document of expressing foreign protein with escherichia expression system as can be known host's substratum should select the LB substratum, it is 0.5 in the OD of 550nm place value that Host Strains cell concn before inducing should reach bacterium liquid.But IPTG concentration is induced the temperature of target protein when inducing target protein, and because the difference of target protein is different, therefore, this research need to be explored these two inductive conditions.

IPTG concentration is very large on the protein expression level impact, in the test, should change the concentration of IPTG in the scope of 0.01～2.0mmol/L, seeks the optimum concn of inducing.The transcription of gene in the IPTG concentration major effect expression system, for some albumen, must slowly transcribe by induction expression plasmid, just can be unlikely the biosynthesizing system overload that makes bacterium, this test is found the expression that albumen can be a large amount of when the IPTG induced concentration was 2.0mmol/L by the exploration to the IPTG induced concentration.

Inducing temperature is to affect the important factor that obtains high-level target protein in the intestinal bacteria, by testing definite optimum temps, is the key of expressing foreign protein.Although inducing temperature target protein between 15～40 ℃ can both obtain abduction delivering, the optimum temperature range of expressing a certain specific protein may be very narrow, only has 2～4 ℃.Inducing temperature is the coefficient result of factors on the impact on the target protein expression level, and these factors comprise: the overload of the availability of folding in the cell of expression product, prothetic group, thermally denature, emiocytosis or the folder of foreign aid's albumen etc.Because the existence of these uncertain factors, the best inducing temperature of inferring in theory is insecure, must test drawing.The best inducing temperature that this test draws target protein gpt and glutamic-oxal(o)acetic transaminase albumen is 25 ℃, and shows that by test-results expressing protein can obtain the higher target protein of concentration under this temperature.

The purifying of albumen is an important step of preparation target protein, target protein is gpt albumen and glutamic-oxal(o)acetic transaminase albumen in this test, these two kinds of albumen itself have the catalytic activity of enzyme, therefore, the purifying of these two kinds of albumen is different from purifying to antigenic protein, need to considers the reservation of protein active in the extraction and purification process to the extraction and purification with bioactive albumen.This research adopts the method for ultrasonic disruption that bacterial cell is carried out fragmentation, with the method for affinity chromatography binding molecule sieve level target protein matter is carried out purifying.

The present invention is in construction recombination plasmid, in expression plasmid, insert before the goal gene fragment, inserted 6His label (seeing Fig. 3, Fig. 4), expression system is meeting amalgamation and expression 6His label in the expression target protein, and this label can be used for the purifying of target protein.Most Histidines can be combined with the various metals inner complex, therefore, can be incorporated into the Ni of curing with the His label that exposes ²⁺Resin, behind suitable other albumen of damping fluid flush away, the emulative sequestrant wash-out with solubility can reclaim target protein again.Imidazoles can be emulative in conjunction with Ni with Histidine ²⁺Resin, the imidazoles solution of a high density is as the eluent of chromatography in the affinity chromatography process ^[25]Can remove a large amount of foreign protein that coexists with target protein by affinity chromatography.

Contain a large amount of imidazoles in the protein soln by the affinity chromatography acquisition, the imidazoles of high density can affect the catalytic activity of target protein.Be biological macromolecular substance according to target protein, and imidazoles is small organic molecule, utilize the greatest differences of target protein and imidazole molecule amount, remove the imidazoles of the high density in the protein solution by sephadex chromatography (sieve chromatography), to obtain active higher target protein.Experimental result shows that purity is higher through the albumen of affinity chromatography and sephadex chromatography purifying, and has kept the catalytic activity of enzyme, has reached the purpose of target protein purifying.

Standard substance must guarantee that it has good uniformity, the homogeneity research of standard substance comprise homogeneity research and standard substance in the bottle of standard substance bottle between homogeneity research.

The variation of characteristic in bottle that the interior Evaluation for Uniformity of the bottle of reference material is the judgement criteria product is poor, and what mainly estimate is when standard substance carry out repeatedly sampling test, the consistence of experimental result.The variation coefficient is another statistic of each observed value degree of variation in the measurement data, so comes the interior uncertainty of bottle of criterion product with the variation coefficient of the observed values that calculate different samplings.Experimental result show reference material the bottle in have good uniformity.This evaluation can illustrate that these standard substance can repeatedly be taken a sample and measure, and the measurement result consistence is good.

Evaluation for Uniformity refers to the variation of characteristic between bottle and bottle of reference material between the bottle of reference material.What mainly estimate is the difference of characteristic value between the different bottles of reference material.Having good uniformity between the bottle of standard substance is the prerequisite of reference material being carried out definite value.These standard substance are that solution with mixing is divided into several operable unit in the final step of preparation.Therefore, namely whether the characteristic value of every bottle of total standard substance is consistent in order to estimate each unit, carrying out between the bottle of reference material homogeneity investigates, according to the upper method to Evaluation for Uniformity between the standard substance bottle of CNAS-GL29 " rule and the statistical method of reference material/standard model definite value ", employing is carried out the statistical method of one-way analysis of variance homogeneity between the bottle of these standard substance is analyzed to experimental result.Analytical results shows, has good uniformity between the standard substance bottle of this test preparation.Can carry out definite value to standard substance.

Reference material stability refers under specific time interval and envrionment conditions, and the characteristic value of reference material remains on the character in the specialized range.As seen the stability of reference material is that the characteristic value of description standard material is time dependent.The specific time interval is longer, show this reference material stability better.This timed interval is called as the validity period of reference material.Clear in " the reference material management method " of China, the stability of primary standard material should be more than 1 year, and the stability of secondary reference material should be more than half a year.The user is in the validity period of regulation, and in accordance with regulations condition is preserved and the Application standard material, and the characteristic value of the surveying instrument that guarantee is calibrated, the measuring method of evaluation or definite other materials is accurate.

The present invention estimates the stability of reference material aspect four in order to guarantee the stability of transaminase reference material in storage and use procedure, and the first, the multigelation estimation of stability of transaminase standard substance.The second, the estimation of stability of transaminase standard substance under 4 ℃ of conditions of storage.The 3rd, the estimation of stability of transaminase standard substance under normal temperature condition.The 4th, the estimation of stability of transaminase standard substance under-80 ℃ of conditions.

The transaminase standard substance of the present invention's preparation are freezing serum standard panel, the phenomenon that inevitably can produce multigelation in the process of using occurs, for the accuracy of validation criteria product characteristic value under moving Freezing-Melting Condition repeatedly, carry out the evaluation of multigelation stability to these transaminase standard substance.Measurement result to standard substance characteristic value behind the multigelation is carried out linear regression analysis, and analytical results shows, in the number of freezing and thawing of regulation, the characteristic value of standard substance and the linear regression of number of freezing and thawing are not obvious.As seen, the freeze-thaw stability of reference material is good.This result of study, can play directive function to the use of this reference material, if residue can be with remaining reference material stored frozen in addition for reference material after once testing in the use procedure of reference material, reuse after when later on experiment, melting again, but the number of times of freeze thawing should be in stipulated number.This has been avoided the waste of reference material greatly.

If the transaminase standard substance need to be when the short period of time takes multiple measurements after once melting again, need under 4 ℃ condition, store for some time, so that the repeatedly use in the short period of time, therefore, the stability that stores under need to 4 ℃ of conditions to the transaminase standard substance is estimated, to guarantee that the transaminase standard substance under 4 ℃ of conditions, store in setting time, it is stable that its characteristic value keeps.Measurement result to standard substance characteristic value after storing under 4 ℃ the condition is carried out linear regression analysis, and analytical results shows, in setting time, the time linear regression that stores under the condition of the characteristic value of standard substance and 4 ℃ is not obvious.As seen, in setting time, stable storing is good under 4 ℃ the condition of reference material.Use provides convenience to reference material in order repeatedly to measure in the short period of time greatly in inferior research.

In the working process of reality, the transaminase standard substance can be placed for some time under the condition of room temperature, therefore, estimate the room temperature stability of transaminase standard substance, guarantee that with this transaminase standard substance place specific time at ambient temperature, it is stable that its characteristic value keeps.Measurement result to standard substance characteristic value under the room temperature condition is carried out linear regression analysis, and analytical results shows, in setting time, the time linear regression that stores under the characteristic value of standard substance and the room temperature condition is not obvious, and the room temperature stability of reference material is good.This test provides foundation under the room temperature condition reference material being melted the operations such as dilution.

What the reference material permanent stability were paid close attention to is to specify under the preservation condition, the unstable of reference material characteristic value, determine preservation condition, and the stability of research standard material under this condition is very important, need to development person the character of the candidate substances of reference material be had certain knowledge and enough understandings such as the storage temperature condition of reference material, perhaps guarantee the storage temperature condition by the great many of experiments of different storage temperatures.Although there are many reference materials that its best preservation condition has been carried out meticulously determining and selecting, its characteristic value is appointed the unstable that so shows in a way.In order to guarantee the transaminase standard substance under the condition of storage of regulation, the stability of standing storage will be estimated the permanent stability of transaminase standard substance.Measurement result to standard substance characteristic value under the prescribed condition is carried out linear regression analysis, analytical results shows, at in setting time, the time linear regression of standing storage under the characteristic value of standard substance and the prescribed condition is not obvious, and the extended storage stability of reference material is good.This test studies show that the transaminase standard substance are good at standing storage internal stability half a year, meet the requirement of secondary reference material, also the use validity period for reference material provides Data support.

The definite value of reference material is the whole process to reference material characteristic quantity assignment, and reference material is a kind of as measurement instrument, and he can reappear, preserves and transmit value, guarantees comparability and consistence at different time and space value.Reference material only has homogeneity and the reference material that has good stability just can carry out definite value behind process homogeneity and estimation of stability.People's transaminase Certified Reference Material Homogeneity of the present invention preparation with have good stability, can carry out the definite value of reference material.The definite value of reference material is divided into process that many reagent measure the transaminase standard substance characteristic value of this research development and assessment two portions content of reference material uncertainty.

According to the upper method to the standard substance definite value of CNAS-GL29 " rule and the statistical method of reference material/standard model definite value ", this research is measured the transaminase standard substance with glutamate-pyruvate transaminase determination reagent kit and glutamic-oxal(o)acetic transaminase mensuration test kit that three companies both domestic and external produce, calibration solution take international standard substance as reagent in the mensuration process is measured the characteristic value of transaminase standard substance.This test has drawn value and the glutamic-oxal(o)acetic transaminase catalytic activity value of standard variety gpt catalytic activity, because the use of definite value process alignment curve plotting is international standard substance, therefore, the characteristic value in these standard substance can be traced to the source to international standard.

The uncertainty of reference material standard value is pressed GB/T15000.3-2008 " rule of standard model work guide rule (3) standard model definite value and statistical method evaluation " evaluation.Overall uncertainty (U _CRM) be mainly derived from uncertainty of measurement (U _Char), the bottle between uncertainty (U _Bb), long-term and short-term stability uncertainty (U _Lts, U _Sts).The calculation formula of overall uncertainty is:

$U_{\mathrm{CRM}}=\mathrm{<figure-callout\; id="2"\; label="k\; U\; char"\; filenames="HDA00003380209500091.png,HDA00003380209500092.png"\; state="\{\{state\}\}">k</figure-callout>}\sqrt{{U_{\mathrm{char}}}^{}}\sqrt{{{}_{}}^2+{{\mathrm{<figure-callout\; id="2"\; label="U\; bb"\; filenames="HDA00003380209500091.png,HDA00003380209500092.png"\; state="\{\{state\}\}">U</figure-callout>}}_{\mathrm{bb}}}^2+{{\mathrm{<figure-callout\; id="2"\; label="U\; lts"\; filenames="HDA00003380209500091.png,HDA00003380209500092.png"\; state="\{\{state\}\}">U</figure-callout>}}_{\mathrm{lts}}}^2+{{\mathrm{<figure-callout\; id="2"\; label="U\; sts"\; filenames="HDA00003380209500091.png,HDA00003380209500092.png"\; state="\{\{state\}\}">U</figure-callout>}}_{\mathrm{sts}}}^2}$

Wherein k is for comprising the factor, and value is 2.

According to the valued methods of international standard substance (gpt international standard substance ERM-AD454, glutamic-oxal(o)acetic transaminase international standard substance ERM-AD457), under selected transport condition, need not the additional uncertainty so the U that consider that short-term stability causes _Sts=0.This section is mainly from uncertainty of measurement (U _Char), the bottle between uncertainty (U _Bb) and permanent stability uncertainty (U _Lts) uncertainty of three aspect evaluation criteria substance characteristics values.Test-results shows that the uncertainty of gpt is 36.73U/L, and the uncertainty of glutamic-oxal(o)acetic transaminase is 33.20U/L, and uncertainty is larger.Causing the large reason of uncertainty mainly is that permanent stability are large to the contribution of uncertainty, this character with standard substance is relevant, improve the storing state of reference material in the research afterwards of this test plan, changing lyophilised state into by freezing standard substance stores, because protein under lyophilised state stable phase than the good stability under the freezing state, permanent stability will reduce greatly to the contribution of uncertainty like this, and overall uncertainty also can correspondingly reduce like this.

The present invention is optimized synthetic by the sequence of people's transaminase that engineered technology will be searched from NCBI, synthetic transaminase sequence cut with being connected by the enzyme of plasmid be cloned in the expression vector, expression plasmid is converted in the e. coli bl21 expression strain again, experimental result shows and successfully made up colibacillary expression strain, and can successful expression go out active higher people's apotransminase.By people's apotransminase is added in the matrix serum, developed people's transaminase reference material.The Certified Reference Material Homogeneity that proves this research development by the evaluation to reference material is good, have good stability, test kit by three companies carries out definite value to this reference material, reference material has been carried out accurately assignment, according to CNAS-GL29 " rule and the statistical method of reference material/standard model definite value " uncertainty of reference material characteristic value is assessed again afterwards, estimated the uncertainty of reference material characteristic value.

Beneficial effect of the present invention is: the present invention has developed restructuring transaminase reference material, and the homogeneity stability of reference material investigated, reference material has been carried out assignment, at last the uncertainty of the characteristic value of reference material is assessed, the reference material biological safety that experiment showed, this research development by some row is good, and characteristic value is high, homogeneity and having good stability has characteristic value accurately and with the uncertainty of characteristic value.The reference material of this research development can be used for the quality control of Clinical Test Lab and external diagnosis reagent, has filled up the blank of the transaminase reference material of China's high density.

Description of drawings:

Fig. 1: the frequency of utilization figure of gpt codon in escherichia expression system of naive;

Fig. 2: the frequency of utilization figure of gpt nucleotide sequence codon in escherichia expression system that crosses through the artificial optimization;

Fig. 3: the frequency of utilization figure of glutamic-oxal(o)acetic transaminase codon in escherichia expression system of naive;

Fig. 4: the frequency of utilization figure of glutamic-oxal(o)acetic transaminase codon in escherichia expression system of naive

Fig. 5: restructuring gpt plasmid map;

Fig. 6: restructuring glutamic-oxal(o)acetic transaminase plasmid map;

Fig. 7: gpt restriction enzyme digestion and electrophoresis result;

Fig. 8: glutamic-oxal(o)acetic transaminase recombinant plasmid restriction enzyme digestion and electrophoresis figure;

Fig. 9: the order-checking comparison result of restructuring gpt plasmid;

Figure 10: the order-checking comparison result of restructuring glutamic-oxal(o)acetic transaminase plasmid;

Figure 11: people's gpt thalline electrophoresis result figure;

Figure 12: people's glutamic-oxal(o)acetic transaminase thalline electrophoresis result figure;

Figure 13: the result of people's gpt Western blot;

Figure 14; The result of people's glutamic-oxal(o)acetic transaminase Western blot;

Figure 15: IPTG concentration is to the test electrophoresis result figure of the protein induced expression of gpt;

Figure 16: IPTG concentration is to the test electrophoresis result figure of the protein induced expression of glutamic-oxal(o)acetic transaminase;

Figure 17: temperature is to the test electrophoresis result figure of the protein induced expression of gpt;

Figure 18: temperature is to the test electrophoresis result figure of the protein induced expression of glutamic-oxal(o)acetic transaminase;

Figure 19: the protein electrophoresis figure of people's gpt thalline supernatant and precipitation;

Figure 20: the protein electrophoresis figure of people's glutamic-oxal(o)acetic transaminase thalline supernatant and precipitation;

Figure 21: the WB result of people's gpt cellular lysate liquid supernatant;

Figure 22: the WB result of people's glutamic-oxal(o)acetic transaminase cellular lysate liquid supernatant;

Figure 23: gpt sieve chromatography curve;

Figure 24: glutamic-oxal(o)acetic transaminase sieve chromatography curve;

Figure 25: the SDS-PAGE protein electrophoresis figure of gpt sample 1 and sample 2;

Figure 26: the SDS-PAGE protein electrophoresis figure of glutamic-oxal(o)acetic transaminase sample 1 and sample 2;

Figure 27: the Western blot experimental result picture of gpt sample 1;

Figure 28: the Western blot experimental result picture of glutamic-oxal(o)acetic transaminase sample 1;

Figure 29: number of freezing and thawing is on the trend map that affects of gpt activity;

Figure 30: number of freezing and thawing is on the trend map that affects of glutamic-oxal(o)acetic transaminase activity;

Figure 31: 4 ℃ of storage periods are on the trend map that affects of gpt activity;

Figure 32: 4 ℃ of storage periods are on the trend map that affects of glutamic-oxal(o)acetic transaminase activity;

Figure 33: temperature affects trend map to gpt activity storage period;

Figure 34: normal temperature storage period is to glutamic-oxal(o)acetic transaminase activity influence trend map;

Figure 35: the storage time affects trend map to gpt activity;

Figure 36: the storage time is to glutamic-oxal(o)acetic transaminase activity influence trend map.

The specific embodiment of the present invention only limits to further explain and explanation the present invention, not to Composition of contents restriction of the present invention.

Embodiment

The acquisition of embodiment 1:ALT goal gene

, as expression plasmid, people's gpt gene is expressed with PRSF-Duet as expression vector with intestinal bacteria.Goal gene obtain and the step optimized as follows:

1. in the aminoacid sequence of NCBI website retrieval people's gpt (ALT) albumen and the gene order of this section albumen of encoding, its aminoacid sequence is shown in SEQ ID NO:1, and its nucleotide sequence is shown in SEQ ID NO:2:

2. the gene order of encoding human gpt (ALT) albumen of retrieval is carried out the analysis of intestinal bacteria preference codon by software, analyze the preference codon frequency of utilization height in this section sequence, the report that obtains is as shown in Figure 1: the frequency of utilization figure of gpt codon in escherichia expression system of Fig. 1 naive, and wherein annotate: the bar chart of black is shown in that frequency of utilization is lower than 10% codon in intestinal bacteria in the table;

3. drawn by above analysis report: draw according to colibacillary preference codon table analysis, can have in people's gpt original series that frequency of utilization is lower than 10% codon in a lot of intestinal bacteria translation processes, if make up plasmid with this nucleotide sequence, can consist of impact to the output of translation so, therefore need to come original series is optimized by colibacillary preference codon table.The gene order of retrieving people's gpt (ALT) albumen that obtains is optimized according to colibacillary preference codon table, to in escherichia expression system, frequency of utilization replace with synonym less than 10% codon, in the process of replacing, will avoid the repetition of sequence as far as possible.The nucleotide sequence that obtains is shown in SEQ ID NO:3:

4. the gene order of people's gpt (ALT) albumen of codon optimization is carried out the analysis of intestinal bacteria preference codon by software again, analyze the preference codon frequency of utilization height in this section sequence, assess codon optimized effect with this.The report that obtains is shown in Figure 2: gpt nucleotide sequence codon the frequency of utilization figure in escherichia expression system of Fig. 2 for crossing through the artificial optimization, the bar chart of black is shown in that frequency of utilization is lower than 10% codon in intestinal bacteria in the table, this this section of report explanation sequence is according to colibacillary preference codon table analysis, there has not been frequency of utilization to be lower than 10% codon

5. people's gpt (ALT) protein gene sequence that will finish sequence optimisation is served the sea and is given birth to worker's biotechnology company limited and synthesize, synthetic gene is connected on the rf plasmid PUC-57, this fragment is downcut and is cloned into the PRSF-Duet plasmid with restriction enzyme from the PUC-57 carrier, plasmid transfection to the e. coli bl21 thalline, can be given expression to target protein.

The acquisition of embodiment 2:AST goal gene

, as expression plasmid, people's glutamic-oxal(o)acetic transaminase gene is expressed with PRSF-Duet as expression vector with intestinal bacteria.Goal gene obtain and the step optimized as follows:

1. in the aminoacid sequence of NCBI website retrieval people's glutamic-oxal(o)acetic transaminase (AST) albumen and the gene order of this section albumen of encoding: its aminoacid sequence is shown in SEQ ID NO:4, and its nucleotide sequence is shown in SEQ ID NO:5;

2. the gene order of encoding human glutamic-oxal(o)acetic transaminase (AST) albumen of retrieval is carried out the analysis of intestinal bacteria preference codon by software, analyze the preference codon frequency of utilization height in this section sequence, the report that obtains is as shown in Figure 3: the frequency of utilization figure of glutamic-oxal(o)acetic transaminase codon in escherichia expression system of Fig. 3 naive, and wherein annotate: the bar chart of black is shown in that frequency of utilization is lower than 10% codon in intestinal bacteria in the table;

3. can be drawn by above-mentioned analysis report: a lot of codons are arranged in colibacillary expression system in the glutamic-oxal(o)acetic transaminase gene of naive, frequency of utilization is not as good as 10%, if directly subsequence is cloned in the expression vector, with expression vector be converted into colibacillary in, when intestinal bacteria are translated this fragment gene sequence, in case the protein translation system runs into these codons, translation stops possibly, even translation does not have to stop can having a strong impact on the output of albumen yet, therefore subsequence need to be passed through manual method, according to colibacillary preference codon table, this fragment gene sequence is optimized, the result who optimizes is as follows: the gene order that will retrieve people's glutamic-oxal(o)acetic transaminase (AST) albumen that obtains is optimized according to colibacillary preference codon table, to in escherichia expression system, frequency of utilization replace with synonym less than 10% codon, will avoid the repetition of sequence in the process of replacing, the nucleotide sequence that obtains is shown in SEQ ID NO:6 as far as possible:

4. the gene order of people's glutamic-oxal(o)acetic transaminase (AST) albumen of codon optimization is carried out the analysis of intestinal bacteria preference codon by software again, analyze the preference codon frequency of utilization height in this section sequence, assess codon optimized effect with this.To the sequence after optimizing, carry out the analysis of intestinal bacteria preference codon, draw analytical results as shown in Figure 4: the gpt gene order that process is optimized and glutamic-oxal(o)acetic transaminase gene order have not had frequency of utilization to be lower than 10% codon according to colibacillary preference codon table analysis

5. the gene order that will finish people's glutamic-oxal(o)acetic transaminase (AST) albumen of sequence optimisation is served the sea and is given birth to worker's biotechnology company limited and synthesize, and synthetic gene is connected on the rf plasmid PUC-57.This fragment is downcut and is cloned into the PRSF-Duet plasmid with restriction enzyme from the PUC-57 carrier, plasmid transfection to the e. coli bl21 thalline, can be given expression to target protein.

Embodiment 3: the structure of gene engineering expression bacterial strain

The present embodiment utilizes molecular biological method, goal gene is cloned in the PRSF-Duet carrier, construct the recombinant expressed plasmid of transaminase, and the recombinant expression plasmid of the success that will make up is converted in the competent escherichia coli cell, with the engineering strain of preparation people's gpt albumen and glutamic-oxal(o)acetic transaminase protein expression.Draw out the collection of illustrative plates of restructuring transaminase expression plasmid according to the information of goal gene fragment and vector plasmid, the plasmid map of restructuring gpt is seen Fig. 5, the plasmid map of the glutamic-oxal(o)acetic transaminase of recombinating is seen Fig. 6.

1. the structure of restructuring transaminase expression plasmid

1.1 enzyme is cut: the method that adopts double digestion.With restriction enzyme the purpose fragment is downcut, with restriction enzyme vector plasmid is cut simultaneously.

With restriction enzyme BamH I and EcoR I digested plasmid PUC57-ALT and plasmid PUC57-AST, with restriction enzyme BamH I and EcoR I digested plasmid pRSF-Duet.Wherein damping fluid is all used the K damping fluid, and reaction system is 20uL, and the reaction system composition is: restriction enzyme BamH I (0.5uL)+EcoR I (0.5uL)+damping fluid (2uL)+plasmid (15uL)+water (2uL).The enzyme time of cutting is two hours, and the temperature of reaction of endonuclease reaction is 37 ℃.After endonuclease reaction carries out 1.5h, cut adding dephosphorylation enzyme (CIAP) in the system at plasmid pRSF-Duet carrier enzyme, purpose is to prevent that the carrier that enzyme is cut from connecting certainly.

1.2 electrophoresis and recovery: the purpose fragment that the method for employing agarose electrophoresis is cut enzyme is separated with carrier, carrier is cut, and reclaim with purpose fragment and the carrier of agarose DNA recovery test kit to electrophoresis.

The agarose gel that solidifies that configures is put into electrophoresis chamber, and in electrophoresis chamber, add the TAE damping fluid, in gel pore, add Mark DNA5uL, DNA sample-loading buffer and the enzyme of 2uL are cut product mix, be loaded in the sepharose hole.The complete rear beginning electrophoresis of loading, voltage is 80V during electrophoresis, the time is 30min.In the gel imaging instrument, observe electrophoresis result behind the electrophoresis.Purpose band with needs under ultraviolet lamp downcuts, and puts into the EP pipe and reclaims.

Reclaim test kit with agarose DNA purpose fragment and carrier are reclaimed, the step of recovery is as follows:

(1) film that adds 10uL according to every 10mg gel adds the film of 750uL in conjunction with liquid in conjunction with the ratio of liquid in each is equipped with the EP pipe of gel.

(2) concussion mixes above mixture, hatches under 65 ℃ 10 minutes, until gel dissolves fully.Every the dissolving of several minutes concussion centrifuge tube with the acceleration gel.

(3) pillar is packed in the collection tube.This preparation of every increment one cover.

(4) gel that melts is changed in the pillar of above combination, hatched at ambient temperature 1 minute.

(5) the centrifugal aforesaid combination of 12000rpm is 1 minute.Take off pillar, outwell the waste liquid in the collection tube, again pillar is reinstalled on the collection tube.

(6) add the film scavenging solution of using 95% alcohol dilution of 750uL in the pillar, centrifugal 1 minute of 12000rpm.After taking off pillar and outwelling waste liquid in the collection tube, pillar is reinstalled in the collection tube.Add again 500uL film scavenging solution, centrifugal 1 minute of 12000rpm.

(7) from whizzer, take out centrifugal column-collection tube combination, the pillar bottom of being sure not to get wet.Outwell the waste liquid in the collection tube.Recentrifuge centrifugal column-collection tube made up 1 minute.

(8) careful pillar being changed in the centrifuge tube of clean 1.5mL adds the ultrapure water of 50uL to pillar central authorities with liquid-transfering gun, incubated at room is after 1 minute, centrifugal 2 minutes of 12000rpm.

(9) abandon pillar, with the centrifuge tube that the DNA elutriant is housed be stored in 4 ℃ for subsequent use.

1.3 connect: with the T4DNA ligase enzyme purpose fragment and the carrier of returning coupled together.This experiment couples together purpose fragment and carrier with the T4 ligase enzyme, the reaction system that connects is: purpose fragment (3uL)+carrier (2uL)+solution 1 contains T4 ligase enzyme (5uL), the temperature of ligation is 16 ℃, and the time of ligation is 90 minutes.

1.4 transform: will connect product and be converted in the bacillus coli DH 5 alpha competent cell, and carry out copying of recombinant plasmid.Step of converting is as follows:

(1) competent cell is taken out from-80 ℃ Ultralow Temperature Freezer, under the condition of ice-water bath, competent cell is melted.

(2) plasmid that connects is joined in the competence bacteria liquid, the ratio of adding is the connection product that 100ul bacterium liquid adds 10ul, afterwards according to the procedure operation of ice bath 30min, 42 ℃ of 60s of heat shock, ice bath 3min.

(3) the SOC substratum that adds 100-200ul is recovered, and centrifuge tube is put into shaking table, and rotating speed is 130-150rpm, and temperature is 37 ℃, and the time is 30min.

(4) bed board is layered on overnight incubation on the solid medium that contains the kan resistance with the bacterium liquid of recovering.

(5) second day takes out culture dish, and the bacterium colony on the picking culture dish is seeded in the substratum that contains kan, 37 ℃ of cultivations.

1.5 the checking of plasmid: the exactness to the front construction recombination plasmid verifies, the step of checking is as follows:

(1) protect bacterium, protect bacterium with glycerine solution, the method for protecting bacterium is: the bacterium that the bacterium liquid 50uL that draws above-mentioned cultivation adds 50uL preserves liquid, and the concussion mixing is stored in the mixture of glycerine and bacterium liquid in-80 ℃ the Ultralow Temperature Freezer.

(2) extraction of plasmid, with the plasmid of plasmid extraction kit extraction bacterial cultures, the step of extracting plasmid is: get the 1.5mL culture in the 1.5mL centrifuge tube, the centrifugal 1min of 12000rpm abandons supernatant.Such as the bacterium amount very little, can add suitable bacterium liquid once centrifugal again.Add the outstanding enchylema of 250 μ l, the concussion mixing adds 250 μ l bacterolysis liquid and puts upside down mixing with hand, places 3-4min, with bacterolysis, discharges plasmid.Add 10 μ l protein enzyme solutions, place 3-4min behind the mixing, to eliminate in the solution DNase to the impact of plasmid.Add 350 μ l neutralization solutions, mixing.Albumen and bacterial genomes DNA is precipitated gets off in this moment solution, plasmid is present in the supernatant, behind the centrifugal 10min of 13,000rpm, draw supernatant to the rotating centrifugal post with collector tube, behind the centrifugal 1min liquid in the collector tube is outwelled, plasmid is attracted on the centrifugal column, adds 750 μ l and washes post liquid to the rotating centrifugal post, centrifugal 1min, wash some albumen that are adsorbed on the centrifugal column off, abandon liquid in the collector tube, add again 250 μ l and wash post liquid repetition above-mentioned steps.Centrifugal column is placed on the new centrifuge tube 13, and the centrifugal 2min of 000rpm is to remove the residual post liquid of washing.Add at last 100 μ l pure water to centrifugal column, centrifugal 1min is with the plasmid DNA on the wash-out post behind the placement 2min.

(3) restriction enzyme digestion and electrophoresis checking: cut the extraction plasmid with restriction enzyme BamH I and EcoR I enzyme, the enzyme system of cutting is restriction enzyme BamH I (0.5uL)+restriction enzyme EcoR I (0.5uL)+plasmid (5uL)+K Buffer(1uL)+water (3uL), the endonuclease reaction condition is 37 ℃ of temperature of reaction, and the reaction times is 2 hours.Afterwards enzyme is cut the product electrophoresis, by restriction enzyme being downcut the size of fragment, judged whether above-mentioned Insert Fragment is the purpose fragment.Show according to the plasmid map that makes up, the clip size of gpt gene is 1506bp, and the carrier segments size is 3849bp, and electrophoresis result is seen Fig. 7 (M representation DNA Marker DL5000,1 representative restructuring gpt plasmid enzyme restriction product), the result meets expection.The size of glutamic-oxal(o)acetic transaminase gene fragment is 1307bp, and the carrier segments size is 3849bp, and electrophoresis result is seen Fig. 8 (M representation DNA Marker DL5000,1 representative restructuring glutamic-oxal(o)acetic transaminase plasmid enzyme restriction product), and the result meets expection.

(4) sequence verification: send the order-checking of invitrogen company with the plasmid that extracts, the order-checking the primer is general because the Down1 primer is compared sequencing result and plasmid map, judges and inserts whether gene is goal gene.

The result: draw sequencing result and plasmid map is in full accord, and comprise goal gene interior, this explanation transaminase construction of recombinant plasmid is correct.The order-checking comparison result of restructuring gpt plasmid is seen Fig. 9, and the order-checking comparison result of restructuring glutamic-oxal(o)acetic transaminase plasmid is seen Figure 10.

Experimental result shows the expression plasmid that has successfully made up the restructuring transaminase, and plasmid is imported in the e. coli strain bl21, can give expression to target protein by low temperature induction.

2. the structure of transaminase expression strain

With the Plasmid Transformation that successfully constructs to the e. coli bl21 thalline, make up colibacillary engineering strain, because e. coli bl21 is the bacterial strain of protease deficiency, the plasmid that makes up is changed in the e. coli bl21, can be that escherichia coli expression goes out target protein.The step of converting of plasmid is as follows:

At first, the competent preparation of e. coli bl21 thalline:

(1) the e. coli bl21 bacterial culture fluid of 4 ℃ of preservations being got 1ML adds in the EP pipe.

(2) 12000r/min is centrifugal 1 minute, abandoning supernatant.

(3) use 1ml CaCl ₂Thalline is suspended centrifugal 1 minute of 12000r/min more afterwards, abandoning supernatant.

(4) CaCl of usefulness 50UL ₂Thalline is suspended, place on the ice-water bath, be 30 minutes storage period.

By above step, the competence of e. coli bl21 is made complete, then will verify correct Plasmid Transformation to the competent cell of the e. coli bl21 of making, and step of converting is as follows:

(1) plasmid is joined in the competence bacteria liquid, the ratio of adding is the plasmid that 50ul bacterium liquid adds 0.5ul, afterwards, and according to the procedure operation of ice bath 30min, 42 ℃ of 60s of heat shock, ice bath 3min.

(2) the SOC substratum that adds 100-200ul is recovered, and centrifuge tube is put into shaking table, and rotating speed is too high, 130-150r/min, and temperature is 37 ℃, the time is 30min.

(3) bed board is layered on overnight incubation on the solid medium that contains the kan resistance with the bacterium liquid of recovering.Second day takes out culture dish, and the bacterium colony on the picking culture dish is seeded in the substratum that contains kan, 37 ℃ of cultivations.The bacterium of turning out namely is people's aminotransferase gene engineering expression strain, expression strain is preserved liquid with bacterial classification protect bacterium.It is complete that people's aminotransferase gene engineering is expressed strain construction.

Embodiment 4: the abduction delivering of target protein

The abduction delivering of target protein mainly be by to the engineered bacterial strain that makes up under suitable medium and culture condition, induce with IPTG, make it express the process of target protein.The abduction delivering of target protein mainly is divided into following Four processes: the first, and a small amount of of target protein is induced.The second, the detection whether target protein expresses.The 3rd, the exploration of protein expression condition.The 4th, the inducing in a large number of target protein.

1. a small amount of of target protein is induced

(1) the LB substratum that 5mL is contained kalamycin resistance joins in sterile environment in the culture tube of 15mL.

(2) the above-mentioned engineering bacteria that builds is seeded in the step (1) in the ready culture tube.

(3) culture tube is put into the constant temperature oscillator concussion and cultivated, the rotating speed of vibrator is 250r/min, and temperature is 37 ℃.

(4) the bacterium liquid of cultivating when concussion is when the absorbance of 550nm wavelength is approximately 0.5 left and right sides, and the IPTG that adds the 1mol/L of 10uL begins the expression of inducible protein.The condition of abduction delivering is: the rotating speed of vibrator is 150r/min, and temperature is 25 ℃.Inducing culture spends the night.

2. the detection whether expressed of target protein

Whether detect the expression of target protein mainly by two tests, an experiment is with the thalline boiling lysis, and with the product S DS-PAGE electrophoresis of cracking, but whether express at test conditions by this test "ball-park" estimate target protein.If the method by the SDS-PAGE electrophoresis can sense the band that is different from thalline, carry out again afterwards Western blot test this band is confirmed, to prove that whether this band is as the target protein band.Below, will carry out concrete elaboration to the detection whether target protein expresses.

Whether the first, express by the method estimating target albumen of cellular lysate product S DS-PAGE electrophoresis, this experiment key step is as follows:

(1) electrophoresis chamber is installed, is prepared gel, and gel is poured in the electrophoresis chamber, normal temperature leaves standstill, and gel is solidified.

(2) the above-mentioned bacterium liquid absorption 1mL that does not express that induces is on a small quantity added in the centrifuge tube of 1.5mL, the centrifuge tube that bacterium liquid is housed is placed the centrifugal 5min of whizzer 12000r/min.

(3) abandon supernatant, the bacterium bottom the centrifuge tube is suspended with PBS, again centrifuge tube is placed the centrifugal 5min of whizzer 12000r/min.

(4) abandon supernatant, in centrifuge tube, add the distilled water of 50uL electrophoresis sample-loading buffer and 150uL, and thalline is suspended.

(5) centrifuge tube is put into 100 ℃ boiling water boiling water bath 5min.

(6) again centrifuge tube is put into the centrifugal 10min of whizzer 12000r/min.

(7) the supernatant liquor 20uL that carefully draws in the centrifuge tube joins in the loading hole of gel, and plugged, beginning electrophoresis, the sample voltage during electrophoresis in concentrated glue is 80V, and the voltage the during electrophoresis of sample in separation gel is 120V.

(8) electrophoresis is carefully peeled off gel after finishing, and gel is placed the dye liquor of Xylene Brilliant Cyanine G, jog, dyeing 30min.

(9) gel is taken out from dye liquor, place in the distilled water and decolour, jog spends the night.

The gel that (10) will decolour complete takes out and observes, record.

By the cellular lysate product is carried out the SDS-PAGE electrophoresis, and to through the electrophoretic band of the thalline of abduction delivering and the electrophoretic band that not have to pass through a thalline of the expression of inducing compare, the thalline ratio that draws through abduction delivering does not obviously have more a protein band through the thalline of abduction delivering, thus, can estimate, target protein has carried out normal expression.People's gpt thalline electrophoresis result is seen Figure 11, the band that gpt engineering bacteria cellular lysate product electrophoresis after the band of arrow indication is and induces among the figure has more than the gpt engineering bacteria cellular lysate product electrophoresis of not inducing, and the size of the band that has more just in time is the size of people's gpt molecular weight; People's glutamic-oxal(o)acetic transaminase thalline electrophoresis result is seen Figure 12, the band that gpt engineering bacteria cellular lysate product electrophoresis after the band of arrow indication is and induces among the figure has more than the gpt engineering bacteria cellular lysate product electrophoresis of not inducing, and the size of the band that has more just in time is the size of people's gpt molecular weight.

In the SDS-PAGE electrophoresis of the second, above-mentioned cellular lysate product the band that is different from thalline is arranged, whether this explanation target protein is abduction delivering, express if further verify target protein, needs the further proved of method by western blot.The experimental procedure of Western blot is as follows:

(1) electrophoresis chamber is installed, is prepared gel, and gel is poured in the electrophoresis chamber, normal temperature leaves standstill, and gel is solidified.

(2) the above-mentioned bacterium liquid absorption 1mL that does not express that induces is on a small quantity added in the centrifuge tube of 1.5mL, the centrifuge tube that bacterium liquid is housed is placed the centrifugal 5min of whizzer 12000r/min.

(3) abandon supernatant, the bacterium bottom the centrifuge tube is suspended with PBS, again centrifuge tube is placed the centrifugal 5min of whizzer 12000r/min.

(4) abandon supernatant, in centrifuge tube, add the distilled water of 50uL electrophoresis sample-loading buffer and 150uL, and thalline is suspended.

(5) centrifuge tube is put into 100 ℃ boiling water boiling water bath 5min.

(6) again centrifuge tube is put into the centrifugal 10min of whizzer 12000r/min.

(7) the supernatant liquor 20uL that carefully draws in the centrifuge tube joins in the loading hole of gel, and plugged, beginning electrophoresis, the sample voltage during electrophoresis in concentrated glue is 80V, and the voltage the during electrophoresis of sample in separation gel is 120V.

(8) after electrophoresis finishes, carefully gel is stripped down from electrophoresis chamber, and be transferred in the transfer groove, the black negative utmost point of transfer groove, the protein belt negative electricity, protein moves to positive pole during transferring film.Transfer groove is placed sliver, three metafiltration paper, gel, pvdf membrane, three metafiltration paper, sliver successively from black plate to Baise plate.Transfer groove is put into the transferring film instrument, plugged examination transferring film, electric current is 300mA during transferring film, the transferring film time is 2 hours.

(9) after transferring film finishes, carefully film is taken out, seal 30min with confining liquid.

(10) in conjunction with primary antibodie, at first with confining liquid primary antibodie is diluted 100 times, in the confining liquid that contains primary antibodie after the film immersion dilution, incubated at room 2 hours.

(11) wash film, primary antibodie is washed film 3 times with PBST solution, each 5 minutes after hatching and finishing.

(12) anti-in conjunction with two, two anti-ly do the 1:2000 dilution with confining liquid, film is immersed contain in the two anti-confining liquids incubated at room 1 hour after the dilution.

(13) wash film, two anti-hatching finish to wash film 3 times with PBST solution, each 5 minutes afterwards.

(14) colour developing according to the specification sheets operation of the low luminous colouring reagents box of background chemical, is put into FluorChem HD2 imaging system with the film bar that adds developer and stablizer and is developed the color, and the time shutter is 5 seconds in the process color.

(15) according to the result of colour developing, judge whether target protein expresses.

By the antibody of anti-human gpt and the antibody of anti-human glutamic-oxal(o)acetic transaminase the purpose band in the SDS-PAGE electrophoretic band is detected, the result of detection is that the purpose band is target protein.People's gpt Western blot the results are shown in Figure 13, and people's glutamic-oxal(o)acetic transaminase Western blot the results are shown in Figure 14.

3. the exploration of protein expression condition

3.1IPTG the exploration of induced concentration

The concentration of IPTG was very large on the height impact of expressing quantity when target protein was carried out abduction delivering, therefore need to explore the IPTG induced concentration, and the step of exploratory experiment is as follows:

(1) engineering strain is seeded in the LB substratum of 400mL adding kantlex, the LB substratum is contained in the triangular flask of 2000mL, and triangular flask is placed 37 ℃ of shaking table shaking culture, and the rotating speed of shaking table is 200rpm.

(2) the bacterium liquid of cultivating when concussion takes out triangular flask when the absorbance of 550nm wavelength is approximately 0.5 left and right sides, wherein bacterium liquid is divided in the triangular flask that is filled to 4 500ml, 100mL in each triangular flask, four triangular flasks be numbered 1-4.

(3) add successively IPTG solution 1uL, 10uL, 100uL, the 200uL that concentration is 1mol/L in the triangular flask that is numbered 1-4, begin to induce, inducing temperature is 25 ℃, and shaking speed is 150rpm, and induction time is 8 hours.

(4) induce complete after, from the 1-4 triangular flask, respectively get 1mL bacterium liquid, place respectively 4 1.5mL centrifuge tubes, centrifugal 5 minutes of 12000rpm.

(5) centrifugal complete, each centrifuge tube is abandoned supernatant, and precipitation is suspended from the 50uL SDS-PAGE electrophoresis sample-loading buffer, and 100 ℃ were heated 5 minutes, and 120000rpm is centrifugal, gets supernatant liquor and carries out the SDS-PAGE electrophoresis.

(6) electrophoresis is complete dyes observations afterwards to gel.

Experimental result: IPTG concentration to the test electrophoresis result of the protein induced expression of gpt see Figure 15 (1 for the IPTG induced concentration be 0.01mmol/L, 2 for the IPTG induced concentration be 0.1mmol/L, 3 for the IPTG induced concentration is 1mmol/L, 4 for the IPTG induced concentration be 2mmol/L.The arrow indication is the target protein band.）；

IPTG concentration to the test electrophoresis result of the protein induced expression of glutamic-oxal(o)acetic transaminase see Figure 16 (1 for the IPTG induced concentration be 0.01mmol/L, 2 for the IPTG induced concentration be 0.1mmol/L, 3 for the IPTG induced concentration is 1mmol/L, 4 for the IPTG induced concentration be 2mmol/L; The arrow indication is the target protein band).

3.2 the exploration of abduction delivering temperature

(1) engineering strain is seeded in the LB substratum of 600mL adding kantlex, the LB substratum is contained in the triangular flask of 2000mL, and triangular flask is placed 37 ℃ of shaking table shaking culture, and the rotating speed of shaking table is 200rpm.

(2) the bacterium liquid of cultivating when concussion takes out triangular flask when the absorbance of 550nm wavelength is approximately 0.5 left and right sides, wherein bacterium liquid is divided in the triangular flask that is filled to 6 500ml, 100mL in each triangular flask, four triangular flasks be numbered 1-6.

(3) will be numbered in the triangular flask of 1-6 and all add the IPTG solution 200uL that concentration is 1mol/L, and begin to induce, inducing temperature is respectively 15 ℃, 20 ℃, 25 ℃, 30 ℃, 35 ℃, 40 ℃, and shaking speed is 150rpm, and induction time is 8 hours.

(4) induce complete after, from the 1-6 triangular flask, respectively get 1mL bacterium liquid, place respectively 4 1.5mL centrifuge tubes, centrifugal 5 minutes of 12000rpm.

(5) centrifugal complete, each centrifuge tube is abandoned supernatant, and precipitation is suspended from the 50uL SDS-PAGE electrophoresis sample-loading buffer, and 100 ℃ were heated 5 minutes, and 120000rpm is centrifugal, gets supernatant liquor and carries out the SDS-PAGE electrophoresis.

(6) electrophoresis is complete dyes observations afterwards to gel.

Experimental result: temperature sees that to the test electrophoresis result of the protein induced expression of gpt (1 is 15 ℃ of inducing temperatures to Figure 17, and 2 is 20 ℃ of inducing temperatures, and 3 is 25 ℃ of inducing temperatures, and 4 is 30 ℃ of inducing temperatures, and 5 is 35 ℃ of inducing temperatures, and 6 is 40 ℃ of inducing temperatures; The arrow indication is the purpose band);

Temperature sees that to the test electrophoresis result of the protein induced expression of glutamic-oxal(o)acetic transaminase (1 is 15 ℃ of inducing temperatures to Figure 18, and 2 is 20 ℃ of inducing temperatures, and 3 is 25 ℃ of inducing temperatures, and 4 is 30 ℃ of inducing temperatures, and 5 is 35 ℃ of inducing temperatures, and 6 is 40 ℃ of inducing temperatures; The arrow indication is the purpose band).

Learnt by test-results, the inductive condition of target protein is: IPTG concentration is 2mmol/L, and inducing temperature is 25 ℃.

3.3 inducing in a large number of target protein

According to above-mentioned detected result, target protein is carried out a large amount of abduction deliverings, the great expression of target protein is divided into following step:

(1) the LB substratum that 400mL is contained kalamycin resistance joins in sterile environment in the triangular flask of 2000mL.

(2) the above-mentioned engineering bacteria that builds is seeded among the step a in the ready culture tube.

(3) triangular flask is put into the constant temperature oscillator concussion and cultivated, the rotating speed of vibrator is 250r/min, and temperature is 37 ℃.

(4) the bacterium liquid of cultivating when concussion is when the absorbance of 550nm wavelength is approximately 0.5 left and right sides, and the IPTG that adds the 1mol/L of 800uL begins the expression of inducible protein.The condition of abduction delivering is: the rotating speed of vibrator is 150r/min, and temperature is 25 ℃.Inducing culture spends the night.

Embodiment 5: the extraction and purification of target protein

The extraction and purification of target protein is a step that obtains the key of apotransminase, the method of good extraction and purification can obtain the apotransminase of high density, and the extraction and purification of recombinant human apotransminase mainly comprises following a few step, the first, the fragmentation of the genetic engineering bacterium after inducing.But the second, the evaluation of the expression of the inclusion body of albumen and solubility expression.Three, the albumen that will slightly carry is further purified by the method for affinity chromatography and sieve chromatography, obtains the higher albumen of purity.This is the key step of target protein extraction and purification.

2.2.4.1 the fragmentation of genetic engineering bacterium thalline

The technology of this experiment employing ultrasonic disruption is carried out fragmentation to the thalline of genetic engineering bacterium, and the step of bacterial cell disruption is as follows:

(1) collects thalline, will be transferred in the Centrifuge Cup through the genetic engineering bacterium bacterium liquid of inducing culture, will be positioned in the whizzer after the Centrifuge Cup statical equilibrium, with the rotating speed of 4000r/min centrifugal 10 minutes.

(2) take out Centrifuge Cup, supernatant discarded, the precipitation thalline is resuspended with the 200mL lysis buffer, again Centrifuge Cup is placed whizzer, with the rotating speed of 4000r/min centrifugal 10 minutes.

(3) take out Centrifuge Cup, supernatant discarded, precipitation is resuspended with the lysis buffer of 50mL, and is transferred in the beaker of 100mL.

(4) the DNA enzyme of adding 10uL in the beaker that bacterium liquid is housed, the RNA enzyme of 10uL, the 20%Triton-X-100 solution of 300uL, the N,O-Diacetylmuramidase of 10mg.Mix rear room temperature and placed 1 hour, put into afterwards 4 ℃ of refrigerator half an hour.

(5) will refrigerate halfhour bacterium liquid and take out, and under the condition of ice bath, carry out ultrasonication, the setting program of ultrasonication is: φ=6, ultrasonic opening 2 seconds, ultrasonic pass 2 seconds, 2 minutes total times.

(6) ultrasonic complete after, beaker is taken out, clean and close Ultrasonic Cell Disruptor, thalline broken complete.

2.2.4.2 the evaluation of solubility expression of target protein

In order to explore the extraction and purification method of target protein, need to whether be that solubility expression is identified to the expression of target protein in genetic engineering bacterium.The method of the solubility expression of research purpose protein mainly is that above-mentioned cellular lysate liquid is centrifugal, and the cellular lysate liquid after centrifugal can be divided into precipitation and supernatant two portions.By the method for SDS-PAGE protein electrophoresis, can draw target protein to the composition analysis in precipitation and the supernatant is that solubility expression or inclusion body are expressed, and with the method for Western blot target protein is verified again.

At first, by the method for SDS-PAGE protein electrophoresis, the solubility expression of target protein is done preliminary judgement, experimental procedure is as follows:

(1) draw cellular lysate product 1mL and add in the centrifuge tube of 1.5mL, centrifuge tube was placed whizzer centrifugal 10 minutes, the rotating speed of whizzer is 12000r/min.

(2) take out centrifuge tube and carefully supernatant solution is drawn in another clean centrifuge tube, simultaneously, keep the precipitation in the centrifuge tube.

(3) take out a small amount of precipitation and add in the centrifuge tube, add SDS-PAGE electrophoresis sample-loading buffer 50uL, add distilled water 150uL, boiling water bath is 5 minutes in boiling water.

(4) after boiling water bath finishes, will discard precipitation through the centrifugal 10min under the condition of 12000r/min of the centrifuge tube behind the boiling water bath, keep supernatant.

(5) supernatant liquor of getting the cellular lysate product mixes with SDS-PAGE protein electrophoresis sample-loading buffer, and the sample that mixes is put gently in the loading hole of gel, simultaneously with the supernatant liquor point in the step (4) in the loading hole of gel.

(6) plugged begins electrophoresis, after electrophoresis finishes, by the dyeing-decolorzing observations.

Electrophoresis result shows: have suitable with the target protein molecular size range in the supernatant of transaminase, and concentration is higher, comparatively significantly electrophoretic band is with and only have to mix in cellular lysate product precipitation, not the electrophoretic band suitable with the target protein molecular size range.This electrophoresis result can be judged, among solubility expression of target protein and the engineered thalline.The protein electrophoresis figure of people's gpt thalline supernatant and precipitation sees Figure 19 (M represents albumen Marker, and 1 represents the protein electrophoresis figure of precipitation, and 2 represent the protein electrophoresis figure of supernatant liquor, and the arrow indication is the target protein band); The protein electrophoresis figure of people's glutamic-oxal(o)acetic transaminase thalline supernatant and precipitation sees that (M represents albumen Marker to Figure 20, and 1 represents the protein electrophoresis figure of supernatant, and 2 represent the protein electrophoresis figure of precipitation, and the arrow indication is the target protein band.

Then, in order to prove albumen in the supernatant liquor really for target protein, this research is passed through the method for Western blot to the albumen proved in the supernatant liquor, and the sample of WB process mid-point sample is the supernatant liquor of cellular lysate supernatant liquor and the precipitation only processed.Employed primary antibodie is the anti-human gpt antibody of rabbit and the anti-human glutamic-oxal(o)acetic transaminase antibody of rabbit, the two anti-goat anti-rabbit igg antibody as the HRP mark that use.The concrete operating process of WB sees above.

Experimental result: the WB of people's gpt cellular lysate liquid supernatant the results are shown in Figure 21, and the WB of people's glutamic-oxal(o)acetic transaminase cellular lysate liquid supernatant the results are shown in Figure 22.

2.2.4.3 nickel ion affinity chromatograph purifying target protein

According to the collection of illustrative plates of plasmid as can be known the recombinant human apotransminase when expressing people's apotransminase, 6 Histidines of amalgamation and expression simultaneously also.Because the imidazole group of these 6 Histidines has the avidity effect to nickel ion, should can be with the target protein in the cellular lysate also supernatant with this principle, be bonded on the microballon with nickel ion, to replace by the target protein that affinity interaction is combined on the microballon by the imidazoles solution that adds high density more afterwards, thereby reach the purpose of purifying protein.Step by affinitive layer purification albumen is as follows:

(1) with the supernatant of cellular lysate liquid and microballon mixing with nickel ion, place the 50mL centrifuge tube, jog is 2 hours under the condition of ice bath.

(2) liquid that above-mentioned supernatant liquor mixed with nickel bead adds in the chromatography column, vertically lays chromatography column, makes the solution in the pillar and flows out by action of gravity for the albumen that is combined on the nickel bead.

(3) wash chromatography column three times with the cellular lysate damping fluid, each consumption is a column volume, guarantees that at every turn the nickel bead in the chromatography column can suspend fully.

(4) wait to wash after three times, with the target protein of combination on the elution buffer wash-out nickel bead.Divide five wash-outs, use the elution buffer of 1mL at every turn, five elutriants are collected in the clean centrifuge tube.

(5) regeneration of chromatography column: add EDTA solution 1ml, make it and the microballon reaction, wash three times with clear water afterwards, add again NiSO ₄Solution makes it reaction, washes three times with clear water again, and washed pillar is carried out 4 ℃ of preservations of mark.

Just finished the affinitive layer purification of target protein by above step.

2.2.4.4 the sieve chromatography purifying of target protein

The imidazoles that contains high density in the protein soln of the purifying by affinity chromatography, other the albumen that also contains simultaneously some and nickel bead combination, the imidazoles of high density can affect the activity of transaminase, containing some other albumen in the protein soln also can affect the purity of protein, therefore need to carrying out sieve chromatography by the protein after the affinity chromatography, remove imidazoles and some foreign proteins in the solution.The step of sieve chromatography is as follows:

(1) pre-treatment of dextran

Dextran G50 gel is put in the beaker, added elutriant in room temperature swelling 2～3 days, repeatedly come down in torrents and remove fine particle, then decompression is bled and is removed air in the gel pore, boils 2～3 hours (can remove air and the sterilization of granule interior) in the boiling water bath.When gel swelling, avoid vigorous stirring, with the destruction of anti-gel crosslinking structure.

(2) dress post

Getting clean glass chromatography column is vertically fixed on the iron stand.In post, inject elutriant (approximately 1/3 post bed height), in the slow impouring post of gel underflow liquid, approximately open water outlet behind 1～2cm height until gel deposition, make the gel sedimentation, and constantly add the gel underflow.Note noticing that gel can not layering in the dress post process.

(3) balance

After the dress post is finished, connect constant flow pump, connect the nucleic acid-protein analyser, the elutriant that makes outflow is through the detection of nucleic acid-protein analyser, and the opening signal collector is that the analytical results of effluent liquid shows on computers with the form of chromatography curve, take elutriant as moving phase, speed with 0.5ml/min begins wash-out, treats that the chromatography curve flattens surely, and chromatography column is described, and balance is complete.

(4) loading, wash-out

Liquid unnecessary in the post is emitted, make liquid level just cover gel, close outlet.Be added to carefully on the gel bed with pipette, extract 6mL protein mixed solution, open water outlet, after sample enters gel fully, add a small amount of elutriant flushing column wall 2 times, in liquid flows to bed fully after, close water outlet.Fill it up with elutriant in the post upper end, open constant flow pump, the beginning wash-out is observed the chromatography curve simultaneously, is to collect elutriant when the chromatography curve begins to raise, and when the chromatography curve is down to baseline, stops to collect elutriant.

(5) processing of gel column

After general gel column is used, repeatedly wash chromatography column with elutriant, after steady for some time, close constant flow pump until the chromatography curve, stop flushing.

Namely finish the sieve chromatography purifying of target protein by above step, namely contain the higher target protein of purity in the elutriant that above-mentioned collection obtains.

2.2.4.5 the evaluation of target protein

By the collection of illustrative plates of sieve chromatography purifying protein as seen, have two peaks to be respectively peak 1 and peak 2 on each collection of illustrative plates, the sample of collecting in the time of will occurring at two peaks becomes sample 1 and sample 2.

Experimental result: the chromatography curve by sieve chromatography purifying target protein is as follows: Figure 23 is gpt sieve chromatography curve, and Figure 24 is glutamic-oxal(o)acetic transaminase sieve chromatography curve.Observing the sieve chromatography curve of transaminase can find, curve has two peaks, and called after sample 1 and sample 2 are distinguished according to the sample that these two peaks are collected in epi-position peak 1 and peak 2 on figure respectively.

1. by the method for protein electrophoresis sample 1 and sample 2 are identified.With sample 1 and sample 2 respectively point sample 10uL carry out protein electrophoresis, the electrophoresis step

Suddenly see above, which is target protein according to electrophoresis result judgement sample 1 and sample 2.

Experimental result: sample 1 and sample 2 are got respectively 10uL, carry out the experiment of SDS-PAGE protein electrophoresis, the result of protein electrophoresis is as follows, Figure 25 is that (M represents albumen Marker for the SDS-PAGE protein electrophoresis figure of gpt sample 1 and sample 2, the electrophoresis result of 1 and 2 representative samples 2, the electrophoresis result of 3 and 4 representative samples 1, arrow points target protein band), Figure 26 is the SDS-PAGE protein electrophoresis figure of glutamic-oxal(o)acetic transaminase sample 1 and sample 2.By electrophorogram as can be known, sample 1 is target protein solution (M represents albumen Marker, the electrophoresis result of 1 and 2 representative samples 2, the electrophoresis result of 3 and 4 representative samples 1, arrow points target protein band).

(2) electrophoresis is judged as carries out Western blot experiment for the sample of target protein, applied sample amount is 10uL, whether the step of Western blot experiment sees above, be that target protein is confirmed to the sample of collecting further by Western blot experiment.

Experimental result: sample 1 is got 10uL, carry out Western blot test, test-results is as follows, and Figure 27 is the Western blot experimental result picture of gpt sample 1, and Figure 28 is the Western blot experimental result picture of glutamic-oxal(o)acetic transaminase sample 1.Further prove conclusively sample 1 by Western blot experiment and be recombinant human apotransminase solution.

Embodiment 6: the mensuration of target protein activity

By above-mentioned experiment, obtained recombinant human apotransminase solution, this test will be measured the activity of the apotransminase solution that obtains.

The mensuration of transaminase activity mainly comprises following a few step:

(1) dilution of sample: with physiological saline the above-mentioned resulting people apotransminase solution of recombinating is diluted, extension rate is 1:1000.

(2) sample tests: according to the operation instruction of Hitachi's 7180 automatic clinical chemistry analyzers, people's apotransminase solution of recombinating of dilution is measured, in the mensuration process take multinomial biochemistry quality control product as Quality Control.

By to the activity of apotransminase solution and the mensuration of quality control product, draw measurement result table 1.

Table 1: recombinant human apotransminase catalytic activity

Embodiment 7: the processing of reference material matrix serum

Development reference material employed matrix be normal people's serum, and the source of normal people's serum is for processing acquisition by the blood plasma to the normal people of collection.In order to guarantee the biological safety of standard substance, in the process of development standard substance, to carry out to the blood plasma of collecting the examination experiment of blood source.Some enzymes in the serum, can degrade to the transaminase raw material that is added in the serum such as the serum protein enzyme, therefore in order to guarantee to be added to the higher active of transaminase in the serum and stability preferably, to in serum, add proteinase inhibitor, suppress with the activity to the proteolytic enzyme in the serum.This test will be carried out from above several aspects the treating processes of reference material matrix serum.

A: blood source examination test

Because the used matrix of standard substance is serum, so in order to guarantee the biological safety of standard substance, need to carry out the examination test of blood source.The examination of blood source mainly is by blood source kit for screening the hepatitis B virus core antigen in the blood plasma, human immunodeficiency virus's antibody, anti-HCV, syphilis helicoid antibody to be detected, and the process of detection is according to the specification sheets operation of test kit.

The blood plasma of collecting by the examination evidence of blood source does not contain four kinds of hepatitis B viruses, human immunodeficiency virus, hepatitis C virus, treponema pallidum and has communicable sex pheromone, and biological safety is good, can be used as standard substance matrix and uses.The examination of blood source the results are shown in Table 2.

Table 2: the blood source examination test-results of collecting blood plasma

B: the processing of blood plasma

Therefore contain the albumen such as Fibrinogen in the blood plasma, the existence meeting of these albumen impacts the quality of standard substance, will remove the Fibrinogen in the blood plasma, makes blood plasma be converted into serum, and serum is the matrix of good transaminase standard substance.The treating processes of blood plasma is as follows:

(1) take out blood plasma 2000ml from-20 ℃ of refrigerators, after 37 ℃ of water-baths dissolvings, pour into respectively in the sterilization Erlenmeyer flask that fills granulated glass sphere, every 100ml serum adds extracting solution 20ml, 37 ℃ of water-bath 1hr, during constantly shake.

(2) the centrifugal 15min of 2000-3000rpm room temperature abandons precipitation.

(3) supernatant is collected in the serum bottle, after 4 ℃ of coolings, places-20 ℃ of freezing spending the night.

(4) room temperature is thawed, and 0.8 μ m membrane filtration once is transferred in the dialysis tubing, dialyses take 1 * PBS as dialyzate.

(5) room temperature is placed 4hr, changes dialyzate, places 4 ℃ of dialysed overnight again.

(6) after the serum after the dialysis filters with the filter membrane of 0.45 μ m, be collected in aseptic glass beaker.Be sub-packed in 1000ml/ bottle in the serum bottle.

(7) add sanitas proclin300, proteinase inhibitor.

(8) 4 ℃ of stirrings mixing that spends the night.

(9) with the serum transfers that stirs to serum bottle ,-80 ℃ of preservations.

Obtained the matrix of enzyme standard substance of the present invention by above experiment.

Embodiment 8: the preparation of reference material

Above-mentioned research has obtained gpt solution and the glutamic-oxal(o)acetic transaminase solution of high density, and has obtained the matrix serum of reference material.Gpt albumen and glutamic-oxal(o)acetic transaminase albumen are added to matrix serum, mix, the transaminase serum solution for preparing is divided to be filled in the cryopreservation tube again, namely finished the preparation of reference material.The preparation process of reference material is as follows:

(1) matrix serum is taken out from-80 ℃ of Ultralow Temperature Freezers, room temperature is melted.

(2) gpt solution and glutamic-oxal(o)acetic transaminase solution are added in the matrix serum, under 4 ℃ condition, spend the night with magnetic stirrer.

(3) the transaminase solution that mixes is divided in the cryopreservation tube that is filled to 1.5mL with the ML504B liquid dispenser in Bechtop.

The cryopreservation tube that (4) standard substance will be housed is carried out mark, is positioned in-80 ℃ the refrigerator to store.

Embodiment 9: Evaluation for Uniformity in the bottle of reference material

The variation of characteristic in bottle that the interior Evaluation for Uniformity of the bottle of reference material is the judgement criteria product is poor.Usually need to get a part of increment during the Application standard material from the unit measures.In order to control the deviation of each part increment measurement result, reference material need to carry out inhomogeneity evaluation in the bottle.

Process to Evaluation for Uniformity in the bottle of transaminase standard substance is as follows:

(1) sampling: take out at random transaminase standard substance, melt under the room temperature, divide with pipettor and draw standard substance for ten times to the centrifuge tube of 1.5mL, get 50uL at every turn.Afterwards, in each centrifuge tube, add the physiological saline of 450uL, mixing.

(2) measure above-mentioned transaminase solution with normal saline dilution with Hitachi's 7180 automatic clinical chemistry analyzers, used kit is measured test kit for glutamate-pyruvate transaminase determination reagent kit and glutamic-oxal(o)acetic transaminase that Beijing Li Deman biochemical reagents limited-liability company provides, operation steps is seen Hitachi's 7180 automatic clinical chemistry analyzer specification sheetss and relevant test kit process specifications, and each sample is measured three times.

Whether (3) processing of evaluation result at first, has outlier among detecting the data obtained with lattice cloth Lars method, if any outlier with abnormality value removing, secondly, try to achieve ten sub-samplings the variation coefficient of sample measurement, the formula of the variation coefficient is as follows:

$\mathrm{CV}=\frac{S}{\stackrel{\&OverBar;}{x}}\&times;100\%$

In the formula:

The mean value of-measuring result (n 〉=8); S-standard deviation; CV-variation coefficient.

According to homogeneity in the bottle of variation coefficient judging criterion product.

Evaluation for Uniformity evaluation result in the bottle of transaminase standard substance:

Ten sub-samplings sample in the activity of gpt see Table 3, the activity of glutamic-oxal(o)acetic transaminase sees Table 4, detect by lattice cloth Lars method, in the data without dubious value, by calculating the variation coefficient CV=0.45% that takes a sample in the gpt bottle, the variation coefficient CV=0.64% of sampling in the glutamic-oxal(o)acetic transaminase bottle can draw thus in the bottle of transaminase standard substance and has good uniformity.

Table 3: ten sub-sampling glutamate-pyruvate transaminase determinations are active

Table 4: ten sub-sampling glutamic-oxal(o)acetic transaminases are measured active

Embodiment 10: Evaluation for Uniformity between the bottle of reference material

Evaluation for Uniformity refers to the variation of characteristic between bottle and bottle of reference material between the bottle of reference material.The final step of transaminase standard substance preparation is that the transaminase standard solution that will mix divides in the cryopreservation tube that is filled to 1.5mL, for the deviation to the measuring result of each bottle transaminase reference material is controlled, so will carry out Evaluation for Uniformity between the bottle of transaminase standard substance.Process to estimation of stability between the bottle of transaminase standard substance is as follows:

(1) sampling: adopt the method for stochastic sampling to sample.According to the relevant regulations of primary standard material technical specifications (JJG1006-1994), minute loading amount is greater than 500, and the sample drawn number should not be less than 25, and for the sample that has good uniformity, minute loading amount is greater than 500, and the sample drawn number should not be less than 15.Serum reference materials is liquid, belongs to the sample that has good uniformity.In order better the homogeneity of reference material to be estimated, this paper extracts 25 samples, and each sample is drawn three times, each 200uL with pipettor, and does the 1:2 dilution with physiological saline and become the subsample.

(2) measure the upward transaminase solution of above-mentioned subsample with Hitachi's 7180 automatic clinical chemistry analyzers, used kit is measured test kit for glutamate-pyruvate transaminase determination reagent kit and glutamic-oxal(o)acetic transaminase that Beijing Li Deman biochemical reagents limited-liability company provides, operation steps is seen Hitachi's 7180 automatic clinical chemistry analyzer specification sheetss and relevant test kit process specifications, and each sample is measured three times.

(3) processing of evaluation result at first, with among the lattice cloth Lars method detection the data obtained whether outlier being arranged,, afterwards, is processed the data obtained with the method for one-way analysis of variance abnormality value removing if any outlier.According to homogeneity between the bottle of result judgement gpt standard substance.

Evaluation for Uniformity result between the bottle of standard substance:

The active size of Evaluation for Uniformity test determination sees Table 5 between the gpt bottle, and one-way analysis of variance the results are shown in Table 6.The active size of Evaluation for Uniformity test determination sees Table 7 between the glutamic-oxal(o)acetic transaminase bottle, and one-way analysis of variance the results are shown in Table 8.The one-way analysis of variance P value that can find out activity value between the gpt bottle by the one-way analysis of variance table is being 0.10, and the one-way analysis of variance P value of activity value is 0.06 between the glutamic-oxal(o)acetic transaminase bottle.Two P values all draw thus between the bottle of transaminase standard substance greater than 0.05 and have good uniformity.

Table 5: the active size of Evaluation for Uniformity test determination between the gpt bottle

Table 6: Evaluation for Uniformity test data memorandum factor variance analytical results between the gpt bottle

Table 7: the active size of Evaluation for Uniformity test determination between the glutamic-oxal(o)acetic transaminase bottle

Table 8: Evaluation for Uniformity test data memorandum factor variance analytical results between the glutamic-oxal(o)acetic transaminase bottle

Embodiment 11: the freeze-thaw stability evaluation of reference material

The transaminase standard substance of this research preparation are freezing serum standard panel, the phenomenon that inevitably can produce multigelation in the process of using occurs, in order to guarantee that standard substance in the accuracy of repeatedly moving characteristic value under the Freezing-Melting Condition, carry out the evaluation of multigelation stability to these transaminase standard substance.

To the multigelation estimation of stability of transaminase standard substance is that process of the test is as follows:

(1) take out at random 24 transaminase standard substance, be divided into 8 groups, marshalling number is 1-8.Every group 3, respectively 1-8 group is carried out the processing of freeze thawing 1-8 time, every group number of freezing and thawing is identical with group #.

(2) sample that is disposed is carried out the 1:2 dilution with physiological saline, use afterwards Hitachi's 7180 automatic clinical chemistry analyzers, detect diluting good sample, the detection kit used glutamate-pyruvate transaminase determination reagent kit that provides for the Beijing Leaderman Biochemistry Co., Ltd and glutamic-oxal(o)acetic transaminase are measured test kit, and each sample is measured 3 times.

(3) processing of evaluation result at first, with among the lattice cloth Lars method detection the data obtained whether outlier being arranged,, afterwards, is processed the data obtained with the method for analysis of variance in regression abnormality value removing if any outlier.Judge the freeze-thaw stability of gpt standard substance according to result.

The freeze-thaw stability evaluation test of gpt the results are shown in Table 9, and number of freezing and thawing is seen Figure 29 to the trend map of gpt activity impact, and the analysis of variance in regression table sees Table 10.The freeze-thaw stability evaluation test of glutamic-oxal(o)acetic transaminase the results are shown in Table 11, and number of freezing and thawing is seen Figure 30 to the trend map of gpt activity impact, and the analysis of variance in regression table sees Table 12.Draw by the analysis of variance in regression table, the analysis of variance in regression P value of gpt activity and number of freezing and thawing is 0.29, and the active analysis of variance in regression P value with number of freezing and thawing of glutamic-oxal(o)acetic transaminase is 0.17.This shows, under the condition of freeze thawing 8 times, the characteristic quantity value stabilization of transaminase standard substance is good.

Table 9: the freeze-thaw stability evaluation test result of gpt

Table 10: the freeze-thaw stability evaluation result analysis of variance in regression table of gpt

Table 11: the freeze-thaw stability evaluation test result of glutamic-oxal(o)acetic transaminase

Table 12: the freeze-thaw stability evaluation result analysis of variance in regression table of glutamic-oxal(o)acetic transaminase

Embodiment 12: reference material is estimated at 4 ℃ of condition of storage stability inferiors

The transaminase standard substance once need to store for some time behind multiple the melting under 4 ℃ condition, so that reusing in the short period of time, therefore, the stability that stores under need to 4 ℃ of conditions to the transaminase standard substance is estimated, to guarantee that the transaminase standard substance are under 4 ℃ of conditions, store in setting time, it is stable that its characteristic value keeps.4 ℃ of estimation of stabilitys of transaminase standard substance are as follows:

(1) take out at random 14 transaminase standard substance, be divided into 7 groups every group 2,7 groups of standard substance are numbered 1-7,7 groups of standard substance were placed 1-7 days under 4 ℃ condition respectively, every group of storage period is identical with group #.

(2) sample that is disposed is carried out the 1:2 dilution with physiological saline, use afterwards Hitachi's 7180 automatic clinical chemistry analyzers, detect diluting good sample, the detection kit used glutamate-pyruvate transaminase determination reagent kit that provides for the Beijing Leaderman Biochemistry Co., Ltd and glutamic-oxal(o)acetic transaminase are measured test kit, and each sample is measured 3 times.

(3) result treatment: with lattice cloth Lars method check determination data, if data have outlier, reject the outlier of data, afterwards, with the method for analysis of variance in regression the data obtained is processed.4 ℃ of stable storings judging the gpt standard substance according to result are qualitative.

Experimental result: 4 ℃ of stable storing accepted opinion valency test-results of gpt see Table sees Figure 31 to the trend that affects of gpt activity 13,4 ℃ of storage periods, and the analysis of variance in regression table sees Table 14.4 ℃ of stable storing accepted opinion valency test-results of glutamic-oxal(o)acetic transaminase see Table sees Figure 32 to the trend that affects of glutamic-oxal(o)acetic transaminase activity 15,4 ℃ of storage periods, and the analysis of variance in regression table sees Table 16.Draw by the analysis of variance in regression table, the analysis of variance in regression P value in gpt activity and 4 ℃ of storage times is 0.07, and the active analysis of variance in regression P value with 4 ℃ of storage times of glutamic-oxal(o)acetic transaminase is 0.06.This shows, under 7 days condition of 4 ℃ of storages, the characteristic quantity value stabilization of transaminase standard substance is good.

Table 13: 4 ℃ of stable storing accepted opinion valency test-results of gpt

Table 14: the analysis of variance in regression table in gpt activity and 4 ℃ of storage times

Table 15: 4 ℃ of stable storing accepted opinion valency test-results of glutamic-oxal(o)acetic transaminase

Table 16: glutamic-oxal(o)acetic transaminase activity and the analysis of variance in regression table in 4 ℃ of storage times

Embodiment 13: reference material is placed the evaluation of condition stability inferior at normal temperature

In the working process of reality, the transaminase standard substance can be placed for some time under the condition of room temperature, therefore, estimate the room temperature stability of transaminase standard substance, guarantee that with this transaminase standard substance place specific time at ambient temperature, it is stable that its characteristic value keeps.The ambient stable evaluation of transaminase standard substance is as follows:

(1) take out at random 15 transaminase standard substance, be divided into 5 groups every group 3,5 groups of standard substance are numbered 1-5,5 groups of standard substance are transferred in the condition of normal temperature respectively set to 0 hour, 2 hours, 4 hours, 6 hours, 8 hours.

(2) sample that is disposed is carried out the 1:2 dilution with physiological saline, use afterwards Hitachi's 7180 automatic clinical chemistry analyzers, detect diluting good sample, the detection kit used glutamate-pyruvate transaminase determination reagent kit that provides for the Beijing Leaderman Biochemistry Co., Ltd and glutamic-oxal(o)acetic transaminase are measured test kit, and each sample is measured 3 times.

(3) result treatment: with lattice cloth Lars method check determination data, if data have outlier, reject the outlier of data, afterwards, with the method for analysis of variance in regression the data obtained is processed.The ambient stable of judging the gpt standard substance according to result is qualitative.

The ambient stable accepted opinion valency test-results of gpt sees Table 17, and normal temperature affects trend map to gpt activity and see Figure 33 storage period, and the analysis of variance in regression table sees Table 18.The ambient stable accepted opinion valency test-results of glutamic-oxal(o)acetic transaminase sees Table 19, and normal temperature is seen Figure 34 to glutamic-oxal(o)acetic transaminase activity influence trend map storage period, and the analysis of variance in regression table sees Table 20.Draw by the analysis of variance in regression table, the analysis of variance in regression P value of gpt activity and normal temperature storage period is 0.10, and the active analysis of variance in regression P value with normal temperature storage period of glutamic-oxal(o)acetic transaminase is 0.10.This shows, under 8 hours condition of normal temperature placement, the characteristic quantity value stabilization of transaminase standard substance is good.

Table 17: the ambient stable accepted opinion valency test-results of gpt

Table 18: the analysis of variance in regression table of gpt activity and normal temperature storage period

Table 19: the ambient stable accepted opinion valency test-results of glutamic-oxal(o)acetic transaminase

Table 20: glutamic-oxal(o)acetic transaminase activity and the normal temperature analysis of variance in regression table of storage period

Embodiment 14: the permanent stability evaluation of reference material

The ambient stable evaluation of transaminase standard substance is as follows:

(1) sampling: from the reference material preparation is finished, the characteristic value of reference material is measured once every other month, measured 3 standard substance at every turn.

(2) sample is carried out the 1:2 dilution with physiological saline, use afterwards Hitachi's 7180 automatic clinical chemistry analyzers, detect diluting good sample, the detection kit used glutamate-pyruvate transaminase determination reagent kit that provides for the Beijing Leaderman Biochemistry Co., Ltd and glutamic-oxal(o)acetic transaminase are measured test kit, and each sample is measured 3 times.

(3) result treatment: with lattice cloth Lars method check determination data, if data have outlier, reject the outlier of data, afterwards, with the method for analysis of variance in regression the data obtained is processed.Judge the steady in a long-term qualitative of gpt standard substance according to result.

The accepted opinion valency test-results steady in a long-term of gpt sees Table 21, and the storage time affects trend map to gpt activity and sees Figure 35, and the analysis of variance in regression table sees Table 22.The accepted opinion valency test-results steady in a long-term of glutamic-oxal(o)acetic transaminase sees Table 23, and the storage time is seen Figure 36 to glutamic-oxal(o)acetic transaminase activity influence trend map, and the analysis of variance in regression table sees Table 24.Draw by the analysis of variance in regression table, the analysis of variance in regression P value of gpt activity and storage time is 0.33, and the active analysis of variance in regression P value with the storage time of glutamic-oxal(o)acetic transaminase is 0.54.This shows, store half a year under-80 ℃ condition of storage, the characteristic quantity value stabilization of transaminase standard substance is good.

Table 21: the accepted opinion valency test-results steady in a long-term of gpt

Table 22: gpt activity and storage time analysis of variance in regression table

Table 23: the accepted opinion valency test-results steady in a long-term of glutamic-oxal(o)acetic transaminase

Table 24: glutamic-oxal(o)acetic transaminase activity and storage time analysis of variance in regression table

The definite value of embodiment 15 reference materials

This research is measured the transaminase standard substance with glutamate-pyruvate transaminase determination reagent kit and glutamic-oxal(o)acetic transaminase mensuration test kit that three companies both domestic and external produce, calibration solution take international standard substance as reagent in the mensuration process is measured the characteristic value of transaminase standard substance.The mensuration process of the characteristic value of transaminase standard substance is as follows:

(1) gpt international standard substance and glutamic-oxal(o)acetic transaminase international standard substance are added according to the specification sheets of standard substance heats up in a steamer water and redissolve.The redissolution process is: the first, international standard substance is taken out balance to room temperature from refrigerator, fully in the situation in the bottom of ampoule, open gently ampoule at validation criteria product lyophilized powder.The second, the distilled water that under the condition of 23 ℃ of room temperatures, slowly adds 1mL in the ampoule.Three, after the international standard substance dissolving, shake up gently, for subsequent use.

(2) take out 18 transaminase reference material physiological saline and do the 1:2 dilution.

(3) use international standard substance as calibration solution, glutamate-pyruvate transaminase determination reagent kit and glutamic-oxal(o)acetic transaminase test kit to three companies are calibrated, instrument after the calibration and reagent begin the diluted sample in the step (2) is measured, measure every day twice, the interval is no more than two hours, continuously measured three days.

(4) measuring result is carried out the check of outlier with lattice cloth Lars method, and determine the characteristic value of survey with the method for averaging.

The glutamate-pyruvate transaminase determination reagent kit of different company sees Table 25 to the measurement result of gpt activity in the transaminase standard substance.

Table 25: the measurement result of gpt activity

The gpt characteristic value is the mean value of said determination measured value, so the measured value of gpt is: X=(1097.9+1104.4+1099.9)/3=1100.7(U/L).

The glutamic-oxal(o)acetic transaminase mensuration test kit of different company sees Table 26 to the measurement result of millet straw transaminase activity in the transaminase standard substance.

Table 26: the measurement result of glutamic-oxal(o)acetic transaminase activity

The glutamic-oxal(o)acetic transaminase characteristic value is the mean value of said determination measured value, so the measured value of gpt is: X=(751.1+748.7+746.7)/3=748.8(U/L).

The probabilistic assessment of embodiment 16 reference materials

The uncertainty of reference material standard value is pressed GB/T15000.3-2008 " rule of standard model work guide rule (3) standard model definite value and statistical method evaluation " evaluation.Overall uncertainty (U _CRM) be mainly derived from uncertainty of measurement (U _Char), the bottle between uncertainty (U _Bb), long-term and short-term stability uncertainty (U _Lts, U _Sts).The calculation formula of overall uncertainty is:

$U_{\mathrm{CRM}}=\mathrm{<figure-callout\; id="2"\; label="k\; U\; char"\; filenames="HDA00003380209500091.png,HDA00003380209500092.png"\; state="\{\{state\}\}">k</figure-callout>}\sqrt{{U_{\mathrm{char}}}^{}}\sqrt{{{}_{}}^2+{{\mathrm{<figure-callout\; id="2"\; label="U\; bb"\; filenames="HDA00003380209500091.png,HDA00003380209500092.png"\; state="\{\{state\}\}">U</figure-callout>}}_{\mathrm{bb}}}^2+{U_{\mathrm{lts}}}^2+{{\mathrm{<figure-callout\; id="2"\; label="U\; sts"\; filenames="HDA00003380209500091.png,HDA00003380209500092.png"\; state="\{\{state\}\}">U</figure-callout>}}_{\mathrm{sts}}}^2}$

Wherein k is for comprising the factor, and value is 2.

According to the valued methods of international standard substance (gpt international standard substance ERM-AD454, glutamic-oxal(o)acetic transaminase international standard substance ERM-AD457), under selected transport condition, need not the additional uncertainty so the U that consider that short-term stability causes _Sts=0.This section is mainly from uncertainty of measurement (U _Char), the bottle between uncertainty (U _Bb) and permanent stability uncertainty (U _Lts) uncertainty of three aspect evaluation criteria substance characteristics values.

2.2.15.1 uncertainty of measurement (U _Char) to the contribution of overall uncertainty

Carry out uncertainty of measurement according to CNAS-GL29 " rule and the statistical method of reference material/standard model definite value " contribution of the overall uncertainty of transaminase activity is studied, uncertainty of measurement is estimated with the method for variance analysis the contribution of overall uncertainty.

According to the method that CNAS-GL29 " rule and the statistical method of reference material/standard model definite value " provides, at first the measuring result of transaminase is carried out variance analysis, the uncertainty of measurement of transaminase standard substance can be tried to achieve by following formula afterwards.

$U_{\mathrm{char}}=\sqrt{\frac{{s_L}^2}{p}+\frac{{s_r}^2}{n\&CenterDot;p}}$

In the formula:

s _r ²The quantity of selected reagent in the=Mean squares within group p representative test, n represents the quantity that each reagent detects.

2.2.15.2 uncertainty (U between bottle _Bb) to the contribution of overall uncertainty

According to CNAS-GL29 " rule and the statistical method of reference material/standard model definite value " carry out uncertainty between bottle to the overall uncertainty of transaminase activity contribution study, uncertainty adopts the method for one-way analysis of variance to estimate to the contribution of overall uncertainty between bottle.Uncertainty is as follows to the method for estimation of overall uncertainty contribution between the bottle of transaminase activity:

The homogeneity variance analysis sees above between the transaminase bottle, and according to CNAS-GL29 " rule and the statistical method of reference material/standard model definite value ", uncertainty is tried to achieve the available following formula of the estimation of overall uncertainty contribution between the bottle of transaminase activity.

In the formula: U _BbRepresent uncertainty between bottle, n represents test number (TN), MS _{Between group}Represent Mean squares between groups, MS _{In the group}Represent Mean squares within group.

2.2.15.3 permanent stability uncertainty (U _Char) to the contribution of overall uncertainty

According to CNAS-GL29 " rule and the statistical method of reference material/standard model definite value " carry out the permanent stability uncertainty to the overall uncertainty of transaminase activity contribution study.Owing to not having at present the truly description standard material mechanism that characteristic reduces or raises in standing storage of model a kind of physical quantity or chemistry, therefore adopt straight line as empirical model.If the slope of straight line levels off to zero, then reference material permanent stability uncertainty also levels off to zero to the contribution of overall uncertainty.

Slope can calculate with following formula:

${\mathrm{<figure-callout\; id="1"\; label="b"\; filenames="HDA00003380209500052.png,HDA00003380209500061.png"\; state="\{\{state\}\}">b</figure-callout>}}_1=\frac{\underset{i=1}{\overset{n}{\mathrm{\&Sigma;}}}(X_i-\stackrel{\&OverBar;}{X})(Y_i-\stackrel{\&OverBar;}{Y})}{\underset{i=1}{\overset{n}{\mathrm{\&Sigma;}}}{(X_i-\stackrel{\&OverBar;}{X})}^2}$

Intercept is calculated by following formula:

${\mathrm{<figure-callout\; id="0"\; label="b"\; filenames="HDA00003380209500133.png,HDA00003380209500141.png"\; state="\{\{state\}\}">b</figure-callout>}}_0=\stackrel{\&OverBar;}{Y}-b_1\stackrel{\&OverBar;}{X}$

The standard deviation of Points on Straight Line can calculate with following formula:

${\mathrm{<figure-callout\; id="2"\; label="s"\; filenames="HDA00003380209500091.png,HDA00003380209500092.png"\; state="\{\{state\}\}">s</figure-callout>}}^2=\frac{\underset{i=1}{\overset{n}{\mathrm{\&Sigma;}}}(Y_i-b_0-b_i{X}_i{)}^2}{n-2}$

The uncertainty relevant with slope calculated with following formula:

$s\left(b\right)=\frac{s}{\sqrt{\underset{i=1}{\overset{n}{\mathrm{\&Sigma;}}}{(X_i-\stackrel{\&OverBar;}{X})}^2}}$

Validity period t month permanent stability uncertainty to the contribution of overall uncertainty is:

U _lts=s（b）×t

In the above-mentioned formula: The mean value that refers to the sample storage time in the test of transaminase estimation of stability.

The mean value that refers to sample determination activity in the test of transaminase estimation of stability.N represents the number of times of measuring transaminase activity in the transaminase stability test.

2.2.15.4 the calculating of transaminase standard substance overall uncertainty

Draw the uncertainty of transaminase activity in the transaminase standard substance according to the estimated result of the calculation formula of overall uncertainty and above-mentioned uncertainty.The uncertain assessment result of reference material

1. uncertainty of measurement (U _Char) to the contribution of overall uncertainty

(1) analysis of variance table of gpt measuring result sees Table 27.

Table 27: the analysis of variance table of gpt measuring result

According to the method that CNAS-GL29 " rule and the statistical method of reference material/standard model definite value " provides, the gpt uncertainty of measurement can be tried to achieve by following formula.

$U_{\mathrm{char}}=\sqrt{\frac{{s_L}^2}{p}+\frac{{s_r}^2}{n\&CenterDot;p}}=\sqrt{\frac{11.21}{3}+\frac{0.37}{18}}=1.93(U/L)$

In the formula: s _r ²=Mean squares within group=0.37,

The quantity of selected reagent in the p representative test, n represents the quantity that each reagent detects.

(2) analysis of variance table of glutamic-oxal(o)acetic transaminase measuring result sees Table 28.

The variance analysis of table 28 glutamic-oxal(o)acetic transaminase measuring result

According to the method that CNAS-GL29 " rule and the statistical method of reference material/standard model definite value " provides, the glutamic-oxal(o)acetic transaminase uncertainty of measurement can be tried to achieve by following formula.

$U_{\mathrm{char}}=\sqrt{\frac{{s_L}^2}{p}+\frac{{s_r}^2}{n\&CenterDot;p}}=\sqrt{\frac{4.92}{3}+\frac{0.53}{18}}=1.29(U/L)$

In the formula:

The quantity of selected reagent in the p representative test, n represents the quantity that each reagent detects.

The bottle between uncertainty (U _Bb) to the contribution of overall uncertainty

(1) estimation that uncertainty is contributed overall uncertainty between the bottle of gpt activity

The homogeneity variance analysis sees Table 9 between the gpt bottle, according to CNAS-GL29 " rule and the statistical method of reference material/standard model definite value ", uncertainty is tried to achieve the available following formula of the estimation of overall uncertainty contribution between the bottle of gpt activity.

$U_{\mathrm{bb}}=\sqrt{126.17}=11.23(U/L)$

(2) estimation that uncertainty is contributed overall uncertainty between the bottle of glutamic-oxal(o)acetic transaminase activity

The homogeneity variance analysis sees Table 10 between the glutamic-oxal(o)acetic transaminase bottle, according to CNAS-GL29 " rule and the statistical method of reference material/standard model definite value ", uncertainty is tried to achieve the available following formula of the estimation of overall uncertainty contribution between the bottle of glutamic-oxal(o)acetic transaminase activity.

$U_{\mathrm{bb}}=\sqrt{66.53}=8.16(U/L)$

3. permanent stability uncertainty (U _Char) to the contribution of overall uncertainty

(1) the permanent stability uncertainty of gpt activity is to the estimation of overall uncertainty contribution

The long-term stable experiment of gpt activity the results are shown in Table 24 in the transaminase standard substance, can calculate s(b according to test-results in conjunction with above-mentioned formula)=0.08, t=180 days, therefore U _Lts=14.4(U/L).

(2) the permanent stability uncertainty of glutamic-oxal(o)acetic transaminase activity is to the estimation of overall uncertainty contribution

The long-term stable experiment of gpt activity the results are shown in Table 25 in the transaminase standard substance, can calculate s(b according to test-results in conjunction with above-mentioned formula)=0.08, t=180 days, therefore U _Lts=14.4(U/L).

4. the calculating of transaminase standard substance overall uncertainty

The uncertainty that draws transaminase standard variety gpt activity according to the estimated result of the calculation formula of overall uncertainty and above-mentioned uncertainty is:

$U_{\mathrm{CRM}}=\mathrm{<figure-callout\; id="2"\; label="k\; U\; char"\; filenames="HDA00003380209500091.png,HDA00003380209500092.png"\; state="\{\{state\}\}">k</figure-callout>}\sqrt{{U_{\mathrm{char}}}^{}}\sqrt{{{}_{}}^2+{{\mathrm{<figure-callout\; id="2"\; label="U\; bb"\; filenames="HDA00003380209500091.png,HDA00003380209500092.png"\; state="\{\{state\}\}">U</figure-callout>}}_{\mathrm{bb}}}^2+{U_{\mathrm{lts}}}^2}=2\sqrt{1.93^2+11.23^2+{14.4}^2}=36.73(U/L)$

The uncertainty that draws transaminase standard variety glutamic-oxal(o)acetic transaminase activity according to the estimated result of the calculation formula of overall uncertainty and above-mentioned uncertainty is:

$U_{\mathrm{CRM}}=\mathrm{<figure-callout\; id="2"\; label="k\; U\; char"\; filenames="HDA00003380209500091.png,HDA00003380209500092.png"\; state="\{\{state\}\}">k</figure-callout>}\sqrt{{U_{\mathrm{char}}}^{}}\sqrt{{{}_{}}^2+{{\mathrm{<figure-callout\; id="2"\; label="U\; bb"\; filenames="HDA00003380209500091.png,HDA00003380209500092.png"\; state="\{\{state\}\}">U</figure-callout>}}_{\mathrm{bb}}}^2+{U_{\mathrm{lts}}}^2}=2\sqrt{1.{29}^2+{8.16}^2+{14.4}^2}=33.20(U/L)$

5. by using international standard substance as calibration solution with different test kits and instrument, standard substance have been carried out definite value, and the uncertainty of characteristic value in the transaminase reference material assessed, by this section test, draw value such as the table 29 of gpt activity and glutamic-oxal(o)acetic transaminase activity in the transaminase standard substance.

Table 29: the value of gpt activity and glutamic-oxal(o)acetic transaminase activity in the transaminase standard substance

Claims (16)

1. a recombinant human gpt protein standard substance is characterized in that, the nucleotide sequence of the described recombinant human gpt protein standard substance of encoding is shown in SEQ ID NO:3.

2. a recombinant human gpt protein standard substance is characterized in that, the aminoacid sequence of described recombinant human gpt protein standard substance is shown in SEQ ID NO:1.

3. a recombinant human glutamic-oxal(o)acetic transaminase protein standard substance is characterized in that, the nucleotide sequence of the described recombinant human glutamic-oxal(o)acetic transaminase protein standard substance of encoding is shown in SEQ ID NO:6.

4. a recombinant human glutamic-oxal(o)acetic transaminase protein standard substance is characterized in that, the aminoacid sequence of described recombinant human glutamic-oxal(o)acetic transaminase protein standard substance is shown in SEQ ID NO:4.

5. a recombinant gene expression vector is characterized in that, described recombinant gene expression vector contains claim 1 or nucleotide sequence claimed in claim 3.

6. recombinant gene expression vector according to claim 5 is characterized in that, described recombinant gene expression vector is selected from the PRSF-Duet plasmid.

7. recombinant gene expression vector according to claim 6 is characterized in that, described PRSF-Duet plasmid inserted the 6His label before the goal gene fragment.

8. a genetic engineering bacterium is characterized in that, described genetic engineering bacterium contains the described recombinant expression vector of the arbitrary claim of claim 5～7.

9. genetic engineering bacterium according to claim 8 is characterized in that, described genetic engineering bacterium is selected from e. coli strain bl21.

10. the preparation method such as claim 1 or 3 described recombinant human gpt protein standard substances or recombinant human glutamic-oxal(o)acetic transaminase protein standard substance is characterized in that, may further comprise the steps:

(1) acquisition of goal gene: the sequence of inquirer's gpt albumen and people's glutamic-oxal(o)acetic transaminase albumen according to intestinal bacteria preference codon table, is optimized the sequence of searching, and synthesizes;

(2) make up the genetic expression bacterial strain: the method by double digestion is downcut synthetic gene from replicating vector, connect into the expression vector PRSF-Duet of gene, and the expression vector that builds is converted in the e. coli bl21 thalline, make up engineering strain;

(3) expression and purification of target protein: with the expression of IPTG inducible protein, and the albumen of expressing carried out purifying, obtain people's gpt albumen and people's glutamic-oxal(o)acetic transaminase albumen, and gpt and the glutamic-oxal(o)acetic transaminase albumen that obtains is carried out active mensuration;

(4) processing of matrix serum;

(5) evaluation of recombinant human gpt protein standard substance or recombinant human glutamic-oxal(o)acetic transaminase protein standard substance;

(6) recombinant human gpt protein standard substance or the definite value of recombinant human glutamic-oxal(o)acetic transaminase protein standard substance and the assessment of uncertainty.

11. preparation method according to claim 10 is characterized in that, in step (3), the inductive condition of target protein is: IPTG concentration is 0.01～2.0mmol/L, and inducing temperature is 15～35 ℃; Be preferably: 2mmol/L, inducing temperature are 25 ℃.

12. preparation method according to claim 10, it is characterized in that, in step (3), the purifying of target protein adopts affinity chromatography and sieve chromatography, the preferred nickel ion affinity chromatograph of described affinity chromatography, the preferred dextran G50 gel molecular of described sieve chromatography sieve chromatography.

13. preparation method according to claim 10 is characterized in that, in step (3), behind the protein purification, the protein-active of people's gpt is 80000U/L, and the activity of people's glutamic-oxal(o)acetic transaminase albumen is 136000U/L.

14. preparation method according to claim 10 is characterized in that, in step (4), the processing of matrix serum comprises the examination of pathogenic micro-organism and removes Fibrinogen.

15. preparation method according to claim 10, it is characterized in that, in step (5), described Evaluation for Uniformity comprises Evaluation for Uniformity between the interior Evaluation for Uniformity of the bottle of reference material and bottle, and the estimation of stability of reference material comprises the freeze-thaw stability evaluation of reference material, 4 ℃ of evaluations of condition of storage stability inferior, ambient stable evaluation and permanent stability evaluations.

16. preparation method according to claim 10 is characterized in that, in step (6), measuring gpt activity is 1100.7U/L, and uncertainty is 36.73U/L; The glutamic-oxal(o)acetic transaminase activity is 748.8U/L, and uncertainty is 33.20U/L.

Images