CN103308502B - Handheld general microfluidic chip real-time detection device and application - Google Patents
Handheld general microfluidic chip real-time detection device and application Download PDFInfo
- Publication number
- CN103308502B CN103308502B CN201310212756.8A CN201310212756A CN103308502B CN 103308502 B CN103308502 B CN 103308502B CN 201310212756 A CN201310212756 A CN 201310212756A CN 103308502 B CN103308502 B CN 103308502B
- Authority
- CN
- China
- Prior art keywords
- microchip
- intelligent mobile
- mobile equipment
- excitation source
- reaction
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Landscapes
- Investigating, Analyzing Materials By Fluorescence Or Luminescence (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
Abstract
The invention provides a handheld general microfluidic chip real-time detection device. The detection device is composed of a smart mobile device, a microprocessor, a mobile power supply, a lens, a light filter, two excitation light sources, a microchip, a temperature sensor, a heating plate, a heat transfer plate, a wireless communication module, an built-in imaging chip of the smart mobile device, a built-in lens of the smart mobile device, a large server or a personal computer. The detection device has the advantages of simple and reasonable design structure, small size and low cost, and many defects of a traditional on-chip reaction control and detection device are overcome. The integrated design with low power consumption is combined with the self processing capacity and data transfer capability of the smart mobile device, an external power supply and an external large computer are not needed, and the applicable range of the detection device is greatly extended. Based on applications (APP) which operate on the smart mobile device, the detection device is easy to operate and can be applied to the nucleic acid amplification reaction.
Description
Technical field
The invention belongs to micro-fluidic chip reaction controlling and detection technique field, relate to the instant pick-up unit of a kind of handheld general microfluidic chip.
Background technology
Microchip, because of the advantage of its highly integrated, low reagent loss, is widely used in the numerous areas such as medical diagnosis, environmental protection, drug screening.The application of microchip needs reaction controlling and reaction result in engagement tabs to detect, its basic skills is: controlled accurately reaction on sheet by high-precision temperature control module, after having reacted, excitation source is irradiated in microchannel or micro-reaction small chamber, fluorescent material obtains energy and sends fluorescence, becomes electric signal by computing equipment process through electrooptical device.
Reaction controlling and pick-up unit on traditional sheet, volume is heavy, expensive, power consumption is high, need external power supply, mainframe computer.Also higher to the operation requirements of user.
Summary of the invention
The object of this invention is to provide the instant pick-up unit of a kind of handheld general microfluidic chip, be made up of Intelligent mobile equipment, microprocessor, portable power source, lens, optical filter, left excitation source, right excitation source, microchip, temperature sensor, heating plate, heat-conducting plate, wireless communication module, the built-in imager chip of Intelligent mobile equipment, Intelligent mobile equipment Built-in lens, large server or personal computer; Left excitation source, right excitation source are positioned at relative both sides above microchip, its exciting light is made evenly to be projected to microchip, microchip is made up of injection port, outlet and reaction member, microchip lower surface and heat-conducting plate are close to, temperature sensor is embedded in heat-conducting plate center of inside, and heat-conducting plate lower surface and heating plate are close to; The built-in imager chip of optical filter, lens, Intelligent mobile equipment, Intelligent mobile equipment Built-in lens are positioned at directly over microchip, constitute fluorescence detection optical path, gather the fluorescence information of microchip, fluorescence information with the form of digital picture via Intelligent mobile equipment process, can with large server or personal computer mutual further; Microprocessor real-time temperature sensor data also control heating plate, left excitation source, right excitation source by wireless communication module and Intelligent mobile equipment communication, the control of constituent apparatus and communication module; Pick-up unit is powered by portable power source, without the need to external power supply.
Form temperature control module by temperature of micro sensor heating plate, temperature regulating range is 0-100 DEG C, and degree of regulation is 0.1 DEG C, accurately controls the temperature of reaction in microchip.
The surface of microchip keeps level and smooth, transparent, makes material selection glass, silicon, polymethyl methacrylate, epoxy resin, teflon, polystyrene, dimethyl silicone polymer etc.
Microprocessor Real-time Collection temperature sensor data, control heating plate, left excitation source, right excitation source, by wireless communication module and Intelligent mobile equipment communication.
The fluorescence image signal gathered via Intelligent mobile equipment process, detect data can by multiple wireless transmission method and large server or personal computer mutual further.
Device is powered by portable power source, without the need to external power supply.
The reaction member side size range of microchip can at 1-10000 μm, and corresponding detecting unit quantitative range is 1-100000/mm
2.
By the application program (APP) that Intelligent mobile equipment runs, can control strip react, detection reaction result, processes further to data, with computer interactive, carries out data management etc.
Another object of the present invention is to provide the application of said apparatus in nucleic acid amplification reaction, comprises and needs polymerase chain amplification to react (PCR) or do not need the application in the isothermal nucleic acid isothermal amplification reaction of thermal cycle.
Structure of the present invention is simple, and compact is with low cost, overcomes the shortcomings of reaction controlling and pick-up unit on traditional sheet.The global design of low-power consumption the processing power of combined with intelligent mobile device self and data transmission capabilities, without the need to externally fed and external mainframe computer, extend the applicable scope of device greatly.Coordinate the application program (APP) that Intelligent mobile equipment runs, be easy to operation.
Advantage of the present invention:
1. compare with pick-up unit with reaction controlling on conventional sheet, in portable general matrix in the present invention, reaction controlling and instant pick-up unit take full advantage of the integrated taking module of Intelligent mobile equipment, computing ability and data-transformation facility, greatly simplify volume and the complexity of device, accomplish real portable.Cost is very cheap.The high flux real time reaction that can be widely used in microchip controls and immediately detects.
2. in the portable general matrix in the present invention reaction controlling and instant pick-up unit overall power very low, use portable power source power, without the need to external power supply, decrease device use restriction, extend the applicable scope of device.
3. in the portable general matrix in the present invention reaction controlling and instant pick-up unit function contain reaction controlling on sheet, reaction result detect with late time data process, transmit and manage, integrated level is high, and integraty is good.
4. in the portable general matrix in the present invention, reaction controlling and instant pick-up unit are applicable to control that multiple micro-fluidic chip reacts and result detects, such as PCR reaction or isothermal nucleic acid amplification reaction.
5. in the portable general matrix in the present invention, reaction controlling and instant pick-up unit can detect different types of chip, such as glass, silicon, polymethyl methacrylate, epoxy resin, teflon, polystyrene, dimethyl silicone polymer etc.
6. in the portable general matrix in the present invention, reaction controlling and instant pick-up unit can use the Intelligent mobile equipment of number of different types, the smart mobile phone of such as various operating system and panel computer etc.
7. reaction controlling and the application program (APP) of instant pick-up unit by Intelligent mobile equipment runs in the portable general matrix in the present invention, control strip can be reacted, detection reaction result, processes further to data, with computer interactive and information management.Be highly susceptible to operation.
Accompanying drawing explanation
Fig. 1 is device schematic diagram of the present invention.
Fig. 2 is microchip schematic diagram.
Fig. 3 is that microchip adopts the detected image obtained during integrated fluidic chip.
Embodiment
The present invention is described further in conjunction with the accompanying drawings and embodiments
Embodiment 1
See Fig. 1, the instant pick-up unit of a kind of handheld general microfluidic chip, is made up of Intelligent mobile equipment 1, microprocessor 2, portable power source 3, lens 4, optical filter 5, left excitation source 6 ', right excitation source 6, microchip 7, temperature sensor 8, heating plate 9, heat-conducting plate 10, wireless communication module 11, the built-in imager chip 12 of Intelligent mobile equipment, Intelligent mobile equipment Built-in lens 13, large server or personal computer 14; Mainly be divided into Intelligent mobile equipment 1 and external device two parts, external device is made up of microprocessor 2, portable power source 3, lens 4, optical filter 5, left excitation source 6 ', right excitation source 6, microchip 7, temperature sensor 8, heating plate 9, heat-conducting plate 10, wireless communication module 11; Left excitation source 6 ' is positioned at relative both sides above microchip 7 with right excitation source 6, its exciting light is made evenly to be projected to microchip 7, microchip 7 is made up of injection port 15, outlet 16 and reaction member 17, microchip 7 lower surface and heat-conducting plate 10 are close to, temperature sensor 8 is embedded in heat-conducting plate 10 center of inside, and heat-conducting plate 10 lower surface and heating plate 9 are close to; The built-in imager chip 12 of optical filter 5, lens 4, Intelligent mobile equipment, Intelligent mobile equipment Built-in lens 13 are positioned at directly over microchip 7, constitute fluorescence detection optical path, gather the fluorescence information of microchip 7, fluorescence information processes via Intelligent mobile equipment 1 with the form of digital picture, can be mutual further with large server or personal computer 14; Core-microprocessor 2 temperature sensor 8 data, control heating plate 9, left excitation source 6 ', right excitation source 6 in real time of external device, and by wireless telecommunications mode excitation light source block 11 and Intelligent mobile equipment 1 communication, form and control and communication module; Whole pick-up unit is powered, without the need to external power supply by portable power source 3.
Form temperature-controlling system by microprocessor 2 temperature sensor 8 heating plate 9, temperature regulating range is 0-100 DEG C, and degree of regulation is 0.1 DEG C, accurately controls the temperature of reaction in microchip 7.
The surface of microchip 7 keeps level and smooth, transparent, makes material selection glass, silicon, polymethyl methacrylate, epoxy resin, teflon, polystyrene, dimethyl silicone polymer etc.
Microchip 7 and heat-conducting plate 10 are close to, and the temperature control module of microprocessor 2, temperature sensor 8, heating plate 9 composition controls the reaction in microchip 7.After having reacted, left excitation source 6 ' irradiates from the relative both sides of microchip 7 with right excitation source 6, and the detection light path be made up of optical filter 5, lens 4, the built-in imager chip 12 of Intelligent mobile equipment, Intelligent mobile equipment Built-in lens 13 is positioned at directly over microchip 7.
Microprocessor 2 Real-time Collection temperature sensor 8 data, control heating plate 9, control excitation source 6, by wireless communication module 11 and Intelligent mobile equipment 1 communication.
The fluorescence image signal gathered processes via Intelligent mobile equipment 1, and detecting data can by multiple wireless transmission method and large server or personal computer 14 further not alternately.
Device is powered, without the need to external power supply by portable power source 3.
By the application program (APP) that Intelligent mobile equipment runs, can control strip react, detection reaction result, processes further to data, with computer interactive, carries out data management etc.
See Fig. 2, the structure of microchip 7 comprises injection port 15, outlet 16, passage and reaction member 17.Reaction member 17 side size range of microchip 7 can at 1-10000 μm, and corresponding detecting unit quantitative range is 1-100000/mm
2.
The fluorescence image signal gathered processes via Intelligent mobile equipment 1, and detecting data can by multiple wireless transmission method and large server or personal computer 14 further not alternately.
Nucleic acid isothermal amplification on the instant pick-up unit of embodiment 2 handheld general microfluidic chip
The present embodiment adopts the device in embodiment 1 to carry out, and chip adopts the chip of application number CN103071548A embodiment 4 to carry out, and carries out follow-up digital nucleic acid isothermal amplification.
Concrete steps:
1, microchip 7 adopts dimethyl silicone polymer (PDMS) to be material, and with the template with Micro Channel Architecture of multilayer soft lithography fabrication techniques for mould, the PDMS at mould upper with ventilative character solidify to form.
2, the micro-fluidic PDMS chip completed is placed in container and vacuumizes degasification, after PDMS chip carries out vacuumizing degassing processing, the polymkeric substance block internal gas pressure of gas penetration potential declines, stop vacuumize degasification after and be placed under normal pressure time, passage and reaction member (17) form draught head with external environment, and this draught head drives sample solution to be evenly full of reaction member 17.
3, business-like E. is adopted
coli16s rRNA investigates device overall performance as reaction template: template DNA is diluted to suitable concentration and mixes with appropriate LAMP reaction reagent and DNA fluorescent dye SYBR Green I:
4, according to 50 μ L system configurations LAMP reaction mixture: E.
coli16s rRNA template 1 μ L, primers F IP(40 μM) 2 μ L, primer BIP(40 μM) 2 μ L, primers F 3(5 μM) 2 μ L, primer B3(5 μM) 2 μ L, dNTP (2.5mM each) 8 μ L, MgSO
4(50mM) 6 μ L, betaine (5M) 10 μ L, Bst enzyme 2 μ L, Bstbuffer5 μ L, SYBR Green I 2 μ L, ddH
2o 8 μ L.LAMP primer is as follows:
F3:5’GATGTGCCCAGATGGGATT3’
B3：5’GGCCTTCTTCATACACGCG3’
FIP:5’TGGTCATCCTCTCAGACCAGCTTTTTGCTAGTAGGTGGGGTAACGG3’
BIP:5’TGGAACTGAGACACGCTCCAGATTTTATGGCTGCATCAGGCTTG3’
5, sample solution is added injection port 15 place, sample solution is full of passage and reaction member 17 under the driving of draught head.
6, be evenly full of after whole passage and reaction member 17 until sample solution, add with water inconsistent oil phase liquid at injection port 15 place, oil phase liquid is full of passage under the driving of draught head, thus response sample packing is entered in reaction member 17.
7, open the instant pick-up unit of handheld general microfluidic chip, microchip 7 and device heat-conducting plate 10 are close to.Open the vertical application (APP) on supporting Intelligent mobile equipment 1.
8, the vertical application (APP) on operative intelligence mobile device 1, realize it and be connected with the communication of external equipment, arrange reaction type, temperature of reaction and reaction time, control device starts amplified reaction.
9, microprocessor 2 temperature sensor 8 data, and send data to Intelligent mobile equipment 1 by wireless communication module 11, realize monitoring in real time.
10, after question response completes, microprocessor 2 control open left excitation source 6 ', right excitation source 6, make its exciting light evenly be projected to microchip 7; Vertical application (APP) opens the camera function of Intelligent mobile equipment 1, and the detection light path that fluorescence information is made up of optical filter 5, lens 4, the built-in imager chip 12 of Intelligent mobile equipment, Intelligent mobile equipment Built-in lens 13 with the form of digital picture obtains.
11, when SYBR Green I fluorescent dye and DNA double chain combination, send the fluorescence of stronger 800 ~ 1000 times, therefore, the cell that amplified reaction occurs presents green fluorescence, and feminine gender will change without color.When there being nucleic acid molecules to enter certain independent reaction unit 17, this reaction member 17 will produce green fluorescence after the reaction; If nucleic acid concentration is enough low, make the most multipotency of each reaction member 17 assign to a nucleic acid molecules.Then by just accurate quantification can be carried out to initial nucleic acid-templated amount to the counting in positive hole.
12, the reaction result fluorescence information that obtains of the form of digital picture is by the embedded image processing algorithm process of vertical application (APP), can show net result at short notice.Detect data also can with large server or personal computer 14 further mutual, process.Result is see Fig. 3.
<110> Zhejiang University
The instant pick-up unit of <120> handheld general microfluidic chip and application
<160> 4
<210> 1
<211> 19
<212> DNA
<213> artificial sequence
<220>
<223> is according to the LAMP F3 sequence of E.coli 16s rRNA sequences Design
<400> 1
5’-GATGTGCCCAGATGGGATT-3’
<210> 2
<211> 19
<212> DNA
<213> artificial sequence
<220>
<223> is according to the LAMP B3 sequence of E.coli 16s rRNA sequences Design
<400> 2
5’-GGCCTTCTTCATACACGCG-3’
<210> 3
<211> 46
<212> DNA
<213> artificial sequence
<220>
<223> is according to the LAMP FIP sequence of E.coli 16s rRNA sequences Design
<400> 3
5’-TGGTCATCCTCTCAGACCAGCTTTTTGCTAGTAGGTGGGGTAACGG-3’
<210> 4
<211> 44
<212> DNA
<213> artificial sequence
<220>
<223> is according to the LAMP BIP sequence of E.coli 16s rRNA sequences Design
<400> 4
5’-TGGAACTGAGACACGCTCCAGATTTTATGGCTGCATCAGGCTTG-3’
Claims (4)
1. the instant pick-up unit of handheld general microfluidic chip, it is characterized in that, be made up of Intelligent mobile equipment (1), microprocessor (2), portable power source (3), lens (4), optical filter (5), left excitation source (6 '), right excitation source (6), microchip (7), temperature sensor (8), heating plate (9), heat-conducting plate (10), wireless communication module (11), the built-in imager chip of Intelligent mobile equipment (12), Intelligent mobile equipment Built-in lens (13), large server or personal computer (14); Left excitation source (6 '), right excitation source (6) are positioned at both sides relatively, microchip (7) top, its exciting light is made evenly to be projected to microchip (7), microchip (7) is made up of injection port (15), outlet (16) and reaction member (17), microchip (7) lower surface and heat-conducting plate (10) are close to, temperature sensor (8) is embedded in heat-conducting plate (10) center of inside, and heat-conducting plate (10) lower surface and heating plate (9) are close to; Optical filter (5), lens (4), the built-in imager chip of Intelligent mobile equipment (12), Intelligent mobile equipment Built-in lens (13) are positioned at directly over microchip (7), constitute fluorescence detection optical path, gather the fluorescence information of microchip (7), fluorescence information with the form of digital picture via Intelligent mobile equipment (1) process, mutual with large server or personal computer (14); Real-time temperature sensor (8) data of microprocessor (2) also control heating plate (9), left excitation source (6 '), right excitation source (6), by wireless communication module (11) and Intelligent mobile equipment (1) communication, the control of constituent apparatus and communication module; Described device is powered, without the need to external power supply by portable power source (3); Form temperature control module by microprocessor (2) temperature sensor (8) heating plate (9), temperature regulating range is 0-100 DEG C, and degree of regulation is 0.1 DEG C, accurately controls the temperature of reaction in microchip (7); Microprocessor (2) Real-time Collection temperature sensor (8) data, control heating plate (9), left excitation source (6 '), right excitation source (6), by wireless communication module (11) and Intelligent mobile equipment (1) communication; The fluorescence image signal gathered via Intelligent mobile equipment (1) process, detect data can by multiple wireless transmission method and large server or personal computer (14) mutual further.
2. the instant pick-up unit of a kind of handheld general microfluidic chip according to claim 1, it is characterized in that, the surface of microchip (7) keeps level and smooth, transparent, makes material selection glass, silicon, polymethyl methacrylate, epoxy resin, teflon, polystyrene or dimethyl silicone polymer.
3. the instant pick-up unit of a kind of handheld general microfluidic chip according to claim 1, it is characterized in that, microchip (7) is made up of injection port (15), outlet (16), passage and reaction member (17), reaction member (17) side size range can at 1-10000 μm, and corresponding detecting unit quantitative range is 1-100000/mm
2.
4. according to the arbitrary described application of the instant pick-up unit of a kind of handheld general microfluidic chip in nucleic acid amplification reaction of claim 1-3, it is characterized in that, react needing polymerase chain amplification or do not need the application in the isothermal nucleic acid isothermal amplification reaction of thermal cycle.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310212756.8A CN103308502B (en) | 2013-06-01 | 2013-06-01 | Handheld general microfluidic chip real-time detection device and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310212756.8A CN103308502B (en) | 2013-06-01 | 2013-06-01 | Handheld general microfluidic chip real-time detection device and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103308502A CN103308502A (en) | 2013-09-18 |
| CN103308502B true CN103308502B (en) | 2015-06-17 |
Family
ID=49133960
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310212756.8A Active CN103308502B (en) | 2013-06-01 | 2013-06-01 | Handheld general microfluidic chip real-time detection device and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103308502B (en) |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103595864A (en) * | 2013-11-06 | 2014-02-19 | 上海交通大学 | Microfluidic chip liquid control system based on wireless mobile intelligent terminal |
| CN105802848A (en) * | 2014-11-27 | 2016-07-27 | 江苏奇天基因生物科技有限公司 | Recombinase-mediated isothermal nucleic acid amplification reaction real-time detection apparatus |
| CN105138042A (en) * | 2015-10-08 | 2015-12-09 | 北京化工大学 | High-flux isothermal amplification device |
| CN107613162B (en) * | 2017-08-11 | 2020-11-20 | 浙江大学 | Portable micro-fluidic chip imaging system |
| CN112322472B (en) * | 2020-11-05 | 2022-07-12 | 上海交通大学 | Instant detection device suitable for nucleic acid detection |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CL2008003008A1 (en) * | 2007-10-12 | 2009-10-02 | Bigtec Private Ltd | A portable micro polymerase chain reaction (pcr) device based on a low temperature co-firing ceramic (ltcc) micro chip comprising reaction chamber, heater, heater temperature control, communication interface optical detection, and the method of monitoring and controlling it. |
| CN101949847B (en) * | 2010-08-13 | 2012-05-30 | 浙江大学 | Lensless fluorescence imaging detection device and application |
| CN202216907U (en) * | 2011-06-09 | 2012-05-09 | 北京工业大学 | Fluorescence micro-spectrum detection device of biological chip |
| CN103071548B (en) * | 2012-04-05 | 2015-08-19 | 浙江大学 | A kind of passive delivery valveless type Single Molecule Detection chip and application |
-
2013
- 2013-06-01 CN CN201310212756.8A patent/CN103308502B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN103308502A (en) | 2013-09-18 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103308502B (en) | Handheld general microfluidic chip real-time detection device and application | |
| AU2022209255B2 (en) | Systems and methods for performing biological assays | |
| Yang et al. | Novel developments in mobile sensing based on the integration of microfluidic devices and smartphones | |
| CN101868721B (en) | Hand held micro PCR device | |
| US10184946B2 (en) | Method for operating a system for the integrated and automated analysis of DNA or protein | |
| CN103820316B (en) | Based on the real-time PCR detection system of rotary micro-fluidic chip | |
| CN104136596B (en) | Sample preparation, treatment and analysis system | |
| US9322054B2 (en) | Microfluidic cartridge | |
| US20170297020A1 (en) | Mobile molecular diagnostics system with wireless communication | |
| KR20160143795A (en) | Portable nucleic acid analysis system and high-performance microfluidic electroactive polymer actuators | |
| TW201842181A (en) | Fluidic test cassette | |
| CN111197003B (en) | Integrated nucleic acid extraction amplification detection analysis device and method based on smart phone | |
| CN101576557A (en) | Integrated micro-fluidic chip system | |
| US20220186325A1 (en) | Systems for sample analysis | |
| NZ620826A (en) | Nucleic acid purification | |
| CN204439554U (en) | Smart mobile phone wide field fluoroscope imager | |
| CN108034703A (en) | Digital pcr system based on EWOD drivings and constant temperature source | |
| Wang et al. | On-board control of wax valve on active centrifugal microfluidic chip and its application for plasmid DNA extraction | |
| Hawkins et al. | Microfluidic diagnostics for low-resource settings | |
| CN115093961A (en) | Multi-volume liquid drop digital LAMP nucleic acid absolute quantitative detection device and method and application | |
| CN105985905A (en) | PCR module, PCR system having the same, and method of inspecting using the same | |
| CN204824895U (en) | A portable environmental chamber for test paper | |
| CN113528326A (en) | Microfluidic nucleic acid detection device and application | |
| Priye et al. | DNA-to-go: A portable smartphone-enabled PCR assay platform | |
| CN204325370U (en) | Hand-held instant detection device |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |