CN103305598B - Method for detecting RET (Receptor Tyrosine Kinase) gene fusion, and applications thereof - Google Patents

Abstract

The invention relates to a method for detecting RET (Receptor Tyrosine Kinase) gene fusion, and applications thereof. The method specifically comprises the steps of: (1) detecting the relative expression quantity of the front part of RET gene transcript in a sample to be detected as PA1, detecting the relative expression quantity of the rear part of the RET gene transcript as PB1, and calculating the relative expression ratio of the two as P value; and (2) comparing the P value of the sample to be detected with that of a non-fused sample of the RET gene, wherein if remarkable difference exists between the P value of the sample to be detected and the P value of the non-fused sample of the RET gene, fusion exists in the RET gene in the sample to be detected; and the method also possibly comprises the steps of carrying out PCR (Polymerase Chain Reaction) identification to the sample to be detected with remarkable difference of P values, and conducting 5'RACE and sequencing analysis, thus confirming the fusion mode of the RET gene.

Description

A kind of method and application thereof detecting RET gene fusion

Technical field

The invention belongs to biological technical field, particularly, the present invention relates to a kind of method and the application thereof that detect RET gene fusion.

Background technology

Cancer threatens human life and healthy principal disease at present, cancer cells in vivo unrestrictedly, hyperplasia without end, the nutritive substance in patient body is consumed in a large number, and cancer cells also can discharge multiple toxin, makes human body produce series of symptoms; Severe patient is dead due to organ failure.

Lung cancer is current global main cancer, according to statistics, nineteen ninety-five the whole world have 600,000 people to die from lung cancer, within 2003, the World Health Organization (WHO) mortality ratio announced is 1,100,000/year.Lung cancer is also the major disease of serious harm our people life and health, at present the number of patients about 1,200,000/year of annual China lung cancer.

Existing research discloses: there is a key pathogenetic transgenation in adenocarcinoma of lung patient: RET gene fusion.RET is a receptor tyrosine kinase, expresses lower, and often express higher in lung cancer sample in normal lung tissue.Research shows, RET gene there occurs the fusion of gene in lung cancer sample, this fusion derives from the transposition of chromosomal DNA level, and the extracellular domain of associated protein (as KIF5B or CCDC6) and the kinase activity district of RET can be caused to permeate new albumen.

RET gene fusion has direct directive significance for " individuation " treatment of the patients with lung adenocarcinoma with RET gene fusion.The method of the RET gene fusion that existing several possible searching is new at present, as: by genome sequencing (Whole genome sequencing), transcript profile order-checking (Whole transcriptomesequencing), method such as order-checking (Next generation sequencing) or Exon chip (Exonarray) etc. of future generation, a large amount of candidate genes is screened, then verify one by one with RACE and RT-PCR.These methods are not only expensive, also need to carry out a large amount of checking work and confirm candidate gene, and the result obtained is very rough, and accuracy is short of, and is not therefore suitable for clinical detection.In addition, Split FISH is by identifying whether the signaling point that before and after RET gene, two portions are corresponding the method for separation occurs to determine whether RET gene there occurs fusion, this method is expensive, testing cost is high, patient's economical load weight, also not getting rid of gene fusion may occur in position nearer on same karyomit(e) simultaneously, and now Split Fish can not detect completely.In addition, also have the primer utilized across position of fusion, detect RET gene fusion known in sample with PCR, this method can not detect unknown amalgamation mode completely.

Therefore this area does not also have a kind of method of simple and efficient, cheap, workable detection RET gene fusion at present.Therefore the method for RET gene fusion is detected in this area in the urgent need to exploitation

Summary of the invention

Object of the present invention is just to provide a kind of method and the application thereof that detect RET gene fusion.

In a first aspect of the present invention, provide and a kind ofly detect the method that in sample to be tested, whether RET gene merges, comprise step:

(1) detect the relative expression quantity of RET gene transcripts front portion in described sample to be tested, be designated as PA ₁, and detect the relative expression quantity at RET gene transcripts rear portion, be designated as PB ₁, and the relative expression ratio both calculating, be designated as P value:

(2) the P value that sample the P value of testing sample and RET gene is not occurred to merge compares, and wherein, if the P value that sample does not occur to merge for the P value of testing sample and RET gene exists significant difference, then represents that the RET gene in sample to be tested exists fusion.

In another preference, described sample to be tested is mRNA or cDNA.

In another preference, described P value is PB ₁/ PA ₁.

In another preference, described method also comprises step: testing sample P value being existed to significant difference is analyzed, thus confirms the amalgamation mode of RET gene.

In another preference, described analysis comprises: regular-PCR, 5 ' RACE and/or order-checking.

In another preference, the amalgamation mode of described RET gene is: the position of merging occurs RET gene, and/or with RET gene, the upstream gene (Partner) that merges occurs.

In another preference, described RET gene does not occur to merge sample and is: without the normal sample of tumor tissues, and/or do not have the tumor tissues sample of RET gene fusion.

In another preference, described tumour is selected from lower group: lung cancer (as adenocarcinoma of lung) tumour or thyroid carcinoma tumour.

In another preference, step (1) comprises step: with cDNA sample for template, by the method for Real-Time PCR, respectively cDNA sequence corresponding to cDNA sequence corresponding to RET gene transcripts and RET gene transcripts rear portion is increased, obtain the relative expression quantity of RET gene transcripts front portion and the relative expression quantity at RET gene transcripts rear portion.

In another preference, the anterior corresponding cDNA sequence of above-mentioned RET gene transcripts is: the cDNA sequence between the 1st exon of RET gene to the 7th exon.

In another preference, the anterior corresponding cDNA sequence of above-mentioned RET gene transcripts is as shown in SEQ IDNO.:5.

In another preference, the cDNA sequence that above-mentioned RET gene transcripts rear portion is corresponding is: the 12nd exon to the 19th exon 5 ' of RET gene holds the cDNA sequence between 148bp.

In another preference, cDNA sequence corresponding to above-mentioned RET gene transcripts rear portion is as shown in SEQ IDNO.:6.

In another preference, use the primer pair of sequence as shown in SEQ ID NO.:1 and SEQ ID NO.:2, the anterior corresponding cDNA sequence of RET gene transcripts is increased; Use the primer pair of sequence as shown in SEQ ID NO.:3 and SEQ ID NO.:4, the cDNA sequence corresponding to RET gene transcripts rear portion increases.

In another preference, there is significant difference and be in the P value that sample do not occur to merge for the P value of described testing sample and RET base: the P value>=RET gene of testing sample does not occur to merge 2 times of the P value of sample, preferably>=4 times, more preferably>=8 times, best>=10 times, wherein said P value is PB ₁/ PA ₁.

In a second aspect of the present invention, provide a kind of primer collection, described primer collection at least comprises two pairs of primer pairs, and under suitable amplification condition, the first primer pair has the ability of the anterior corresponding cDNA sequence of amplification RET gene transcripts; Second primer pair has the ability of cDNA sequence corresponding to amplification RET gene transcripts rear portion.

In another preference, under suitable amplification condition, the ability of one section between the 1st exon that the first primer pair has an amplification RET gene to the 7th exon corresponding cDNA sequence (sequence preferably as shown in SEQ ID NO.:5); The 12nd exon to the 19th exon 5 ' that second primer pair has an amplification RET gene holds the ability of one section between 148bp corresponding cDNA sequence (sequence preferably as shown in SEQ ID NO.:6).

In another preference, the sequence of the first primer pair is as shown in SEQ ID NO.:1 and SEQ ID NO.:2; The sequence of the second primer pair is as shown in SEQ ID NO.:3 and SEQ ID NO.:4.

In a third aspect of the present invention, provide a kind of test kit containing primer collection described in second aspect present invention.

In another preference, described test kit also comprises one or more reagent being selected from lower group:

I () is for the reagent that sample rna extracts and cDNA synthesizes;

(ii) for the reagent of PCR;

(iii) for the reagent of 5 ' RACE;

(vi) reagent for checking order.

In a fourth aspect of the present invention, provide the purposes of described primer collection or described test kit, whether it is used to detect RET gene in sample to be tested and merges and/or confirm the amalgamation mode of RET gene.

Should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the present invention and can combining mutually between specifically described each technical characteristic in below (eg embodiment), thus form new or preferred technical scheme.As space is limited, tiredly no longer one by one to state at this.

Accompanying drawing explanation

Following accompanying drawing for illustration of specific embodiment of the invention scheme, and is not used in the scope of the invention limiting and defined by claims.

Fig. 1 shows the mode of RET gene fusion.

Fig. 2 shows the PCR qualification result of KIF5B-RET gene fusion in tumor sample 2LC.

Fig. 3 shows the sequencing result of KIF5B-RET gene fusion in tumor sample 2LC.

Fig. 4 shows the sequencing result of ELE1-RET gene fusion in tumor sample 3LC.

Fig. 5 shows the PCR qualification result of ELE1-RET gene fusion in tumor sample 3LC.

Embodiment

The present inventor, through extensive and deep research, establishes a kind of method detecting RET gene fusion first, particularly, comprises step: (1) detects the relative expression quantity of RET gene transcripts front portion in described sample to be tested, is designated as PA ₁, and detect the relative expression quantity at RET gene transcripts rear portion, be designated as PB ₁and the relative expression ratio both calculating, be designated as P value: the P value of testing sample and the P value without the sample of RET gene fusion compare by (2), wherein, if the P value of testing sample exists significant difference with the P value without the sample of RET gene fusion, then represent that the RET gene in sample to be tested exists fusion; Also may comprise step: testing sample P value being existed to significant difference carries out 5 ' RACE and sequencing analysis, thus confirm the amalgamation mode of RET gene.Complete the present invention on this basis.

Term

RET albumen and fusion thereof

RET albumen is a member of receptor tyrosine kinase (Recepter tyrosine kinases) family.RET albumen is a transmembrane protein, has 1114 amino acid, comprises extracellular region, cross-film district and intracellular kinase activity district, wherein the 724th-1016 totally 293 amino acid are kinase activity districts.

The precursor RNA that RET genetic transcription produces, through shearing, produces two kinds of ripe mRNA.Wherein, the first mRNA comprises Exon1-Exon18 (3229bp) and Exon19b (930bp), the second mRNA comprise Exon1-18 (3229bp) and Exon19a (148bp), Exon20 (2240bp).That is: front 18 exon sequences of two kinds of mRNA are identical, and just the first mRNA also has an Exon19b, and the second mRNA also has an Exon19a and Exon20.But the Exon19a of total length 148bp is identical with 148bp before the Exon19b of total length 930bp.

The fusion (Fig. 1) of RET gene and other genes (partner) is there is, as the extracellular domain of KIF5B or CCDC6 and the kinase activity district of RET permeate a new genes/proteins in lung cancer in cancer patient.The position of merging is there is: 1) in thyroid carcinoma, the position of fusion of TRIM27-RET is before Exon10, and the meromixis namely from RET Exon10 is on TRIM27 about RET gene; PCM1-RET, CCDC6-RET, GOLGA5-RET, TRIM24-RET and TRIM33-RET position of fusion is before Exon12, and the meromixis namely from RET Exon12 is on Partner.2) in lung cancer, KIF5B-RET be the part from RET Exon11 or Exon8 or the meromixis from RET Exon12 on KIF5B, the meromixis of CCDC6-RET from RET Exon12 is on CCDC6.

Sample obtains and process

Those of ordinary skill in the art uses general method can obtain cancer sample, obtains or obtain when performing the operation to lung cancer patient as lung cancer sample by puncture method.The sample of other cancers can obtain by standard method clinically, and such as leukemia can obtain with from patient blood.

In a preference of the present invention, contriver cuts sample from tumor tissues after lung cancer patient operation terminates, and in the medium-term and long-term preservation of liquid nitrogen, to prevent RNA from degrading, takes out when needs from liquid nitrogen, dry ice cuts use.The sample cut is put into immediately the lysate of 1ml commercialization Trizol liquid or RNA extraction agent box, then with homogenizer by tissue homogenate, next carry out RNA extracting by general method.

Primer

As used herein, term " primer " refers to and is matching with template, can with it for starting point carries out synthesizing the general name with the oligonucleotide acid of the DNA chain of template complementation under the effect of archaeal dna polymerase.Primer can be natural RNA, DNA, also can be any type of natural nucleotide.Primer can be even that non-natural Nucleotide is as LNA or ZNA etc.

The complementary that primer " haply " (or " substantially ") is special with on a chain in template.Primer must with of a template chain fully complementation could start to extend, but the sequence of primer need not with the sequence complete complementary of template.Such as, hold at one 3 ' end and 5 ' of the primer of template complementation and adds the preceding paragraph and the not complementary sequence of template, such primer still haply with template complementation.As long as there is sufficiently long primer can be combined fully with template, the primer of non-fully complementation also can form primer-template complex with template, thus increases.

The present invention devises a kind of primer collection for detecting RET gene fusion, and described primer collection at least comprises two pairs of primers, and pair of primers can increase the DNA fragmentation of RET transcript front portion, and another pair of primers can increase the DNA fragmentation at RET transcript rear portion.In a preference of the present invention, pair of primers can increase RET Exon1-Exon7 between sequence, the pair of primers Exon12-Exon18 that can increase adds the sequence of 148bp scope.

Sequence between Exon1-Exon7 is as follows:

agtcccgcga ccgaagcagg gcgcgcagca gcgctgagtg ccccggaacg tgcgtcgcgc 60

ccccagtgtc cgtcgcgtcc gccgcgcccc gggcggggat ggggcggcca gactgagcgc 120

cgcacccgcc atccagaccc gccggcccta gccgcagtcc ctccagccgt ggccccagcg 180

cgcacgggcg atggcgaagg cgacgtccgg tgccgcgggg ctgcgtctgc tgttgctgct 240

gctgctgccg ctgctaggca aagtggcatt gggcctctac ttctcgaggg atgcttactg 300

ggagaagctg tatgtggacc aggcggccgg cacgcccttg ctgtacgtcc atgccctgcg 360

ggacgcccct gaggaggtgc ccagcttccg cctgggccag catctctacg gcacgtaccg 420

cacacggctg catgagaaca actggatctg catccaggag gacaccggcc tcctctacct 480

taaccggagc ctggaccata gctcctggga gaagctcagt gtccgcaacc gcggctttcc 540

cctgctcacc gtctacctca aggtcttcct gtcacccaca tcccttcgtg agggcgagtg 600

ccagtggcca ggctgtgccc gcgtatactt ctccttcttc aacacctcct ttccagcctg 660

cagctccctc aagccccggg agctctgctt cccagagaca aggccctcct tccgcattcg 720

ggagaaccga cccccaggca ccttccacca gttccgcctg ctgcctgtgc agttcttgtg 780

ccccaacatc agcgtggcct acaggctcct ggagggtgag ggtctgccct tccgctgcgc 840

cccggacagc ctggaggtga gcacgcgctg ggccctggac cgcgagcagc gggagaagta 900

cgagctggtg gccgtgtgca ccgtgcacgc cggcgcgcgc gaggaggtgg tgatggtgcc 960

cttcccggtg accgtgtacg acgaggacga ctcggcgccc accttccccg cgggcgtcga 1020

caccgccagc gccgtggtgg agttcaagcg gaaggaggac accgtggtgg ccacgctgcg 1080

tgtcttcgat gcagacgtgg tacctgcatc aggggagctg gtgaggcggt acacaagcac 1140

gctgctcccc ggggacacct gggcccagca gaccttccgg gtggaacact ggcccaacga 1200

gacctcggtc caggccaacg gcagcttcgt gcgggcgacc gtacatgact ataggctggt 1260

tctcaaccgg aacctctcca tctcggagaa ccgcaccatg cagctggcgg tgctggtcaa 1320

tgactcagac ttccagggcc caggagcggg cgtcctcttg ctccacttca acgtgtcggt 1380

gctgccggtc agcctgcacc tgcccagtac ctactccctc tccgtgagca ggagggctcg 1440

ccgatttgcc cagatcggga aagtctgtgt ggaaaactgc caggcattca gtggcatcaa 1500

cgtccagtac aagctgcatt cctctggtgc caactgcagc acgctagggg tggtcacctc 1560

agccgaggac acctcgggga tcctgtttgt gaatgacacc aaggccctgc ggcggcccaa 1620

gtgtgccgaa cttcactaca tggtggtggc caccgaccag cagacctcta ggcaggccca 1680

ggcccagctg cttgtaacag tggaggggtc at 1712

(SEQ ID NO：5)

Exon12-Exon18 adds that the sequence of 148bp is as follows:

gaggatccaa agtgggaatt ccctcggaag aacttggttc ttggaaaaac tctaggagaa 60

ggcgaatttg gaaaagtggt caaggcaacg gccttccatc tgaaaggcag agcagggtac 120

accacggtgg ccgtgaagat gctgaaagag aacgcctccc cgagtgagct tcgagacctg 180

ctgtcagagt tcaacgtcct gaagcaggtc aaccacccac atgtcatcaa attgtatggg 240

gcctgcagcc aggatggccc gctcctcctc atcgtggagt acgccaaata cggctccctg 300

cggggcttcc tccgcgagag ccgcaaagtg gggcctggct acctgggcag tggaggcagc 360

cgcaactcca gctccctgga ccacccggat gagcgggccc tcaccatggg cgacctcatc 420

tcatttgcct ggcagatctc acaggggatg cagtatctgg ccgagatgaa gctcgttcat 480

cgggacttgg cagccagaaa catcctggta gctgaggggc ggaagatgaa gatttcggat 540

ttcggcttgt cccgagatgt ttatgaagag gattcctacg tgaagaggag ccagggtcgg 600

attccagtta aatggatggc aattgaatcc ctttttgatc atatctacac cacgcaaagt 660

gatgtatggt cttttggtgt cctgctgtgg gagatcgtga ccctaggggg aaacccctat 720

cctgggattc ctcctgagcg gctcttcaac cttctgaaga ccggccaccg gatggagagg 780

ccagacaact gcagcgagga gatgtaccgc ctgatgctgc aatgctggaa gcaggagccg 840

gacaaaaggc cggtgtttgc ggacatcagc aaagacctgg agaagatgat ggttaagagg 900

agagactact tggaccttgc ggcgtccact ccatctgact ccctgattta tgacgacggc 960

ctctcagagg aggagacacc gctggtggac tgtaataatg cccccctccc tcgagccctc 1020

ccttccacat ggattgaaaa caaactctat gg 1052

(SEQ ID NO：6)

Preferably, primer pair 1 sequence is:

GCTGCATGAGAACAACTGGA (SEQ ID NO:1); With

CCTTGAGGTAGACGGTGAGC(SEQ ID NO：2)，

This primer pair is across Exon2 and Exon3.

Primer pair 2 sequence is:

GGCAATTGAATCCCTTTTTG (SEQ ID NO:3); With

CCGGTCTTCAGAAGGTTGAA(SEQ ID NO：4)，

Pair of primers is below across Exon16 and Exon17.

Detection method

The invention provides a kind of method detecting RET gene fusion.Particularly, comprise step: (1) detects the relative expression quantity of RET gene transcripts front portion in described sample to be tested, is designated as PA ₁, and detect the relative expression quantity at RET gene transcripts rear portion, be designated as PB ₁and the relative expression ratio both calculating, be designated as P value: the P value that sample does not occur to merge for the P value of testing sample and RET gene compares by (2), wherein, if the P value that sample does not occur to merge for the P value of testing sample and RET gene exists significant difference, then represent that the RET gene in sample to be tested exists fusion.In one particular embodiment of the present invention, in lung cancer sample 2LC, the ratio of PB1/PA1 is far longer than normal lung sample in contrast and PB1/PA1 ratio in the lung cancer sample merged does not occur RET gene, the determination be greater than in contrast does not have the PB1/PA1 ratio of the lung cancer sample of RET gene fusion yet, show that in this sample, the relative first half of RET gene latter half there occurs high expression level, namely has RET gene fusion to exist.Then respectively with identifying that the Auele Specific Primer of known RET gene fusion carries out PCR detection to this sample cDNA, find that this is fused to known KIF5B-RET gene fusion.

This detection method except can indicate known RET gene fusion (as CCDC6 known in lung cancer and-RET and, KIF5B and-RET two gene fusion) except, accurately can also indicate the RET gene fusion of the unknown.In another specific embodiment of the present invention, in lung cancer sample 3LC, PB1/PA1 ratio is be far longer than normal lung sample in contrast and PB1/PA1 ratio in the lung cancer sample merged does not occur RET gene, the determination be greater than in contrast does not have the PB1/PA1 ratio of the lung cancer sample of RET gene fusion yet, show that in this sample, the relative first half of RET gene latter half there occurs high expression level, namely has RET gene fusion to exist.Then respectively with identifying that the Auele Specific Primer of known RET gene fusion carries out PCR detection to this sample cDNA, not obtaining positive band, showing that the RET gene fusion of this sample is not known amalgamation mode; Then by 5 ' RACE and the new gene that have found with RET gene fusion in this sample that checks order.

Test kit

Present invention also offers a kind of test kit for detecting RET gene fusion, in a preference, comprising component:

Component 1 (primer pair 1):

Exon(2-3)-F：GCTGCATGAGAACAACTGGA(SEQ ID NO：1)；

Exon(2-3)-R：CCTTGAGGTAGACGGTGAGC(SEQ ID NO：2)。

Component 2 (primer pair 2):

Exon(16-17)-F：GGCAATTGAATCCCTTTTTG(SEQ ID NO：3)；

Exon(16-17)-R：CCGGTCTTCAGAAGGTTGAA(SEQ ID NO：4)。

Component 3: for the reagent that sample rna extracts and cDNA synthesizes.

Component 4: for the reagent of PCR.

Component 5: for the reagent of 5 ' RACE.

Component 6: for the reagent checked order.

Major advantage of the present invention is:

(1) the inventive method is simple and efficient, as long as obtain cDNA, then Real-Time PCR detects and immediately can obtain result;

(2) the inventive method is economical and practical, cheap, can greatly alleviate patient's economical load;

(3) the inventive method sensitivity is high, can detect when in sample, tumour ratio is extremely low;

(4) the present invention is except detecting known RET gene fusion, can also detect unknown RET gene fusion.

Below in conjunction with specific embodiment, set forth the present invention further.Should be understood that these embodiments are only not used in for illustration of the present invention to limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usual conveniently condition is as people such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) condition described in, or according to the condition that manufacturer advises.

Embodiment 1

The standard method of this area can be used to obtain for the tumor sample that detects and check sample: to cut sample from tumor tissues, freeze rapidly and degrade to prevent RNA in liquid nitrogen.

Use the DNA/RNA of Beijing Tian Gen biochemical technology company limited to extract test kit altogether, to specifications, carry out the extracting of RNA, obtain highly purified RNA; The Reverse Transcriptase kit of fermentas company is used to be cDNA by the RNA reverse transcription obtained.

Embodiment 2

In the present embodiment, the two pairs of primer sequences devised for integration region are as follows:

Primer pair 1 is

Exon (2-3)-F:GCTGCATGAGAACAACTGGA (SEQ ID NO:1), and

Exon(2-3)-R：CCTTGAGGTAGACGGTGAGC(SEQ ID NO：2)；

This primer pair is across Exon2 and Exon3.

Primer pair 2 is

Exon (16-17)-F:GGCAATTGAATCCCTTTTTG (SEQ ID NO:3), and

Exon(16-17)-R：CCGGTCTTCAGAAGGTTGAA(SEQ ID NO：4)；

Pair of primers is below across Exon16 and Exon17.

Pcr amplification please performs by the concrete annealing temperature of used two pairs of primers and the specific requirement of the Real-TimePCR instrument used.Use two pairs of above primers, Real-Time PCR instrument (model is Abi 7500fast) increases.Amplification condition is: 50 DEG C of 2min, 95 DEG C of 2min; 95 DEG C of 15s, 60 DEG C of 30s (40 circulations).

Embodiment 3

Process the Real-Time PCR result that embodiment 2 obtains, primer pair 1 relative expression quantity obtained that increases is designated as: PA1, and primer pair 2 relative expression quantity obtained that increases is designated as: PB1.The cDNA sample (or determining the tumour cDNA sample not having RET gene fusion) of normal lung tissue contrasts, and obtains the PB1/PA1 ratio on basis.The cDNA sample of the cDNA sample of lung cancer and normal lung tissue is mixed in the ratio of 7: 0,6: 1,5: 2,4: 3,3: 4,2: 5,1: 6,0.5: 6.5 and 0: 7 respectively, the accuracy detected by the method when simulation tumour ratio is respectively 70%, 60%, 50%, 40%, 30%, 20%, 10%, 5%, 0%.

As shown in Table 1, when tumour ratio is 0%, PB1/PA1 ratio is: 1.36, and this determines the basic ratio without RET gene fusion; And PB1/PA1 ratio is when tumour ratio is low to moderate 5%: 6.27, much larger than basic ratio 1.36, therefore, it is possible to indicate the existence of RET gene fusion well.

Table 1

* mixing sample is relative to the tumour ratio of initial 1LC (tumour ratio is 70%).

Embodiment 4 and embodiment 5

In example 4, part sample is analyzed by the method, find that PB1/PA1 ratio is 8.09 in lung cancer sample 2LC, and PB1/PA1 ratio is respectively 1.46 and 1.40 in normal lung sample 4NL and 5NL in contrast, determination in contrast does not have PB1/PA1 ratio in lung cancer sample 6LC and 7LC of RET gene fusion and is respectively 1.91 and 2.03.

Table 2

Result shows, in sample 2LC, the relative first half of RET gene latter half there occurs high expression level, namely has RET gene fusion to exist.Respectively with identifying that the Auele Specific Primer of CCDC6-RET and KIF5B-RET gene fusion (two RET gene fusion known in lung cancer) has carried out regular-PCR to the cDNA of sample 2LC and detected and order-checking qualification, find that this RET gene fusion is KIF5B-RET, after meromixis from RET gene Exon12 to KIF5B gene Exon15 (Fig. 2, Fig. 3).

The primer sequence detecting CCDC6-RET gene fusion is as follows:

F：GCTGGAGACCTACAAACTGA(SEQ ID NO：7)

R：CGTTGCCTTGACCACTTTTC(SEQ ID NO：8)

Detect the primer sequence of KIF5B-RET gene fusion:

F：GTGAAACGTTGCAAGCAGTTAG(SEQ ID NO：9)

R：CCTTGACCACTTTTCCAAATTC(SEQ ID NO：10)

In embodiment 5, this detection method accurately can also indicate the RET gene fusion of the unknown.

Table 3

As shown in table 3, in sample 3LC, PBI/PA1 ratio is 9.26, also much larger than 4NL, 5NL, 6LC, 7LC in contrast, namely shows that in this sample, the relative first half of RET gene latter half also high expression level occurs, and has RET gene fusion to exist.Common PCR reaction has been carried out by the primers designed of CCDC6-RET and KIF5B-RET, do not obtain positive band, show that the RET gene fusion in this sample is not known CCDC6-RET and KIF5B-RET gene fusion, and may be a new RET gene fusion.

With 5 ' RACE, new RET gene fusion is detected, shorthand method is as follows: using the RNA of extracting as template, according to 5 ' RACE test kit (being purchased from German Qiagen company) specification sheets, a design RET gene second half section specific reverse primer, then to specifications in step complete 5 ' RACE experiment, amplify the 5 ' sequence of holding, then PCR primer is checked order.

Found that a new RET gene fusion ELE1-RET, have found the Partner:ELE1 that of RET gene fusion in lung cancer is new thus, after the meromixis from RET gene Exon12 to ELE1 gene Exon9 (Fig. 4).Following use identifies that the Auele Specific Primer of ELE1-RET gene fusion carries out common PCR reaction to 3LC cDNA sample for a pair, obtains the specific amplified band of ELE1-RET gene fusion (Fig. 5).The primer sequence detecting ELE1-RET gene fusion is:

F:TGGAGAAGAGAGGCTGTATC (SEQ ID NO:11); With

R：TGCAGGCCCCATACAATTTG(SEQ ID NO：12)。

Embodiment 6

Test kit

Embodiment provides a kind of test kit, comprises component:

Component 1 (the first primer pair):

Exon(2-3)-F：GCTGCATGAGAACAACTGGA(SEQ ID NO：1)

Exon(2-3)-R：CCTTGAGGTAGACGGTGAGC(SEQ ID NO：2)

Component 2 (the second primer pair 2):

Exon(16-17)-F：GGCAATTGAATCCCTTTTTG(SEQ ID NO：3)

Exon(16-17)-R：CCGGTCTTCAGAAGGTTGAA(SEQ ID NO：4)

Component 3: for the reagent that sample rna extracts and cDNA synthesizes.

Component 4: for the reagent (comprising the reagent of Real-Time PCR and regular-PCR) of PCR.

Component 5: for the reagent of 5 ' RACE.

Component 6: for the reagent checked order.

The all documents mentioned in the present invention are quoted as a reference all in this application, are just quoted separately as a reference as each section of document.In addition should be understood that those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims limited range equally.

Claims (11)

1. the method that in the detection sample to be tested of nondiagnostic, whether RET gene merges, is characterized in that, comprise step:

(1) detect the relative expression quantity of RET gene transcripts front portion in described sample to be tested, be designated as PA ₁, and detect the relative expression quantity at RET gene transcripts rear portion, be designated as PB ₁, and the relative expression ratio both calculating, be designated as P value:

(2) the P value that sample the P value of testing sample and RET gene is not occurred to merge compares, and wherein, if the P value that sample does not occur to merge for the P value of testing sample and RET gene exists significant difference, then represents that the RET gene in sample to be tested exists fusion;

Wherein, the anterior corresponding cDNA sequence of described RET gene transcripts is: the cDNA sequence between the 1st exon of RET gene to the 7th exon;

And cDNA sequence corresponding to described RET gene transcripts rear portion is: the 12nd exon to the 19th exon 5 ' of RET gene holds the cDNA sequence between 148bp;

There is significant difference and be in the P value that sample do not occur to merge for the P value of described testing sample and RET base: the P value>=RET gene of testing sample does not occur to merge 2 times of the P value of sample, and described P value is PB ₁/ PA ₁.

2. the method for claim 1, is characterized in that, also comprises step: testing sample P value being existed to significant difference is analyzed, thus confirms the amalgamation mode of RET gene.

3. the method for claim 1, is characterized in that, described RET gene does not occur to merge sample and is: without the normal sample of tumor tissues, and/or do not have the tumor tissues sample of RET gene fusion.

4. the method for claim 1, it is characterized in that, step (1) comprises step: with cDNA sample for template, by the method for Real-Time PCR, respectively cDNA sequence corresponding to cDNA sequence corresponding to RET gene transcripts and RET gene transcripts rear portion is increased, obtain the relative expression quantity of RET gene transcripts front portion and the relative expression quantity at RET gene transcripts rear portion.

5. method as claimed in claim 4, is characterized in that, the anterior corresponding cDNA sequence of described RET gene transcripts is as shown in SEQ ID NO.:5.

6. method as claimed in claim 4, is characterized in that, cDNA sequence corresponding to described RET gene transcripts rear portion is as shown in SEQ ID NO.:6.

7. method as claimed in claim 4, is characterized in that, uses the primer pair of sequence as shown in SEQ ID NO.:1 and SEQID NO.:2, increases to the anterior corresponding cDNA sequence of RET gene transcripts; Use the primer pair of sequence as shown in SEQ ID NO.:3 and SEQ ID NO.:4, the cDNA sequence corresponding to RET gene transcripts rear portion increases.

8. a primer collection, is characterized in that, described primer collection at least comprises two pairs of primer pairs, and under suitable amplification condition, the first primer pair has the ability of the anterior corresponding cDNA sequence of amplification RET gene transcripts; Second primer pair has the ability of cDNA sequence corresponding to amplification RET gene transcripts rear portion; Wherein,

The anterior corresponding cDNA sequence of described RET gene transcripts is the cDNA sequence that a section between the 1st exon to the 7th exon is corresponding; And cDNA sequence corresponding to described RET gene transcripts rear portion is the 12nd exon to the 19th exon 5 ' holds one section between 148bp corresponding cDNA sequence,

Wherein, one section between the 1st exon of described RET gene to the 7th exon corresponding cDNA sequence is as shown in SEQ ID NO.:5; 12nd exon of described RET gene to the 19th exon 5 ' holds one section between 148bp corresponding cDNA sequence as shown in SEQ ID NO.:6.

9. primer collection as claimed in claim 8, it is characterized in that, the sequence of the first primer pair is as shown in SEQ IDNO.:1 and SEQ ID NO.:2; The sequence of the second primer pair is as shown in SEQ ID NO.:3 and SEQ ID NO.:4.

10. the test kit containing primer collection described in claim 8.

11. primer collections according to claim 8 or test kit according to claim 10 preparation detect RET gene in sample to be tested whether merge and/or confirm RET gene amalgamation mode detection kit in application.