CN103290011A - Maternal serum/plasma miRNA (Micro Ribonucleic Acid) mark mir-29c related to fetal congenital heart diseases and application thereof - Google Patents
Maternal serum/plasma miRNA (Micro Ribonucleic Acid) mark mir-29c related to fetal congenital heart diseases and application thereof Download PDFInfo
- Publication number
- CN103290011A CN103290011A CN2013101887408A CN201310188740A CN103290011A CN 103290011 A CN103290011 A CN 103290011A CN 2013101887408 A CN2013101887408 A CN 2013101887408A CN 201310188740 A CN201310188740 A CN 201310188740A CN 103290011 A CN103290011 A CN 103290011A
- Authority
- CN
- China
- Prior art keywords
- mir
- mark
- congenital heart
- probe
- serum
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention belongs to the field of genetic engineering and reproductive medicine, and discloses a maternal serum/plasma miRNA (Micro Ribonucleic Acid) mark mir-29c related to fetal congenital heart diseases and an application thereof. The mark is mi-29c which can better separate case groups of fetal congenital heart diseases from a healthy control group and has a good assistant effect on early diagnosis of fetal congenital heart diseases.
Description
Invention field
The invention belongs to medical field and genetically engineered, relate to the maternal serum relevant with fetal congenital heart disease/blood plasma miRNA mark mir-29c and application thereof.
Background technology
Congenital heart disease (congenital heart disease, CHD) refer to the structure deformity of heart and intrathoracic great vessels and may cause functional unusual, it is modal a kind of in fetus and the newborn infant's defective.Annual have 5 ‰-8 ‰ newborn infant to suffer from CHD approximately, and this incidence is 6 times of chromosome abnormalty, 4 times of neural tube defect.Nearly 50% is in a bad way in the CHD infant, after birth, need to accept surgical intervention for several times, even and many times having under the condition of surgical intervention, the newborn infant who dies from CHD still accounts for 40% of newborn infant's general mortality rate, wherein 20% dies from birth back first month.Therefore, early diagnosis, getting up early intervention, timely rational therapy are the keys that reduces the CHD M ﹠ M, are the great problem in science that needs to be resolved hurrily.
The mode of early diagnosis CHD mainly is the fetal ultrasound cardiogram at present.According to statistics, susceptibility and the specificity of this method diagnosis CHD can reach 85%(95%CI respectively, 78-90%), and 99%(95%CI, 98-100%).Although these data show that the level of the super diagnosis of heart CHD is very high, this method still is subjected to many-sided restriction.Those who are investigated's obese degree, the resolving power of ultrasonic device, examiner's technology and experience etc. all may have influence on the net result of inspection.Therefore, we need more clearly and effectively biomarker of discovery badly, and CHD is made auxiliary early diagnosis, and this will help early intervention, getting up early treatment, the incidence of minimizing CHD, the survival rate of raising infant.
MiRNA is the focus in molecular biology research field in recent years, and it is the small molecules non-coding RNA of generation naturally in the class organism, and its maturity state is about 19-23 Nucleotide, has high conservative.MiRNA controls the generation of albumen by participating in its specific target expression of gene of adjusting, regulates the growth sequential, thereby participates in the propagation of cell, differentiation, and metabolism and apoptosis play a significant role in body growth growth and disease generating process.Since finding that lin-4 and let-7 participate in the growth of regulation and control nematode sequential, increasing miRNAs be it is found that the relation of miRNAs and disease has also become focus and the emphasis of research.In recent years, have been found that miRNAs by reverse feedback expression of gene and mammary cancer, lung cancer, cancer of the stomach, diabetes, the morbidity of heart trouble etc. is closely related.
Biomarker refers to the biomolecules that physiology and the pathological state of body can be made a distinction.Screen the biomarker that can be used for CHD early discovery, early diagnosis and can improve the clinical therapeutic efficacy of CHD infant greatly.Latest data shows that heart tissue has its specific miRNAs, be that the expression level of these miRNAs and the normal cell of homologue exist significant difference, and distinctive miRNAs unconventionality expression is expected to become the biomarker for the CHD early diagnosis, has shown fine potential applicability in clinical practice.
Recent study confirms, miRNAs can stable existence in blood serum, and content enriches, is easy to detection by quantitative, has significant disease specific.These characteristics all make uses qualitative and quantitative miRNA molecular engineering, will more effective as biomarker than traditional marking method with serum miRNA, for the frontier has been opened up in biomarker technology and medical diagnosis on disease.
Also do not come to a conclusion about the source of serum at present, some investigator thinks that the miRNA in the tumour patient blood serum derives from target tissue, but its expression changes and the consistence of target tissue is still waiting to inquire into; Also have the investigator to think that miRNA can be enriched to by selectivity among " microparticles (MPs) " or " exosomes ", the mode that is come off with " microvesicles microvesicle " by cell is secreting outside initiatively.Suggestion with common recognition is, the miRNA express spectra in tissue/cell source and the miRNA express spectra in blood serum source are two different systems, and the express spectra of the two is also not quite identical, and there is cognation in the two also not have reported in literature.Not necessarily at the identical regulating and controlling effect of identical period performance, the miRNA that expresses in the tissue/cell not necessarily has same expression amount in blood serum in the expression of specific miRNA in the miRNA express spectra of different sources.Present situation in view of the comparatively stable biomarker that also is not used at present the auxiliary early diagnosis of CHD, with the biomarker of female serum as screening CHD, and the corresponding auxiliary early diagnosis kit of development, have the prospect of scientific research value widely and clinical application.
Summary of the invention
The objective of the invention is at above-mentioned technical problem, propose a kind of female serum mark relevant with CHD.
Another object of the present invention provides primer or the probe of above-mentioned miRNA mark.
A further object of the invention provides the application in the auxiliary early diagnosis of preparation CHD of above-mentioned miRNA mark and primer or probe thereof.
Further object of the present invention provides the auxiliary early diagnosis kit of CHD.
The inventor by separate and the pregnant woman of CHD fetus is nourished in research and pregnant woman's control serum/blood plasma of nourishing normal fetus of being complementary in week pregnant with it in miRNAs, and develop the CHD auxiliary diagnostic box that to be convenient to clinical application, for examination and the early diagnosis of CHD provides the data support, for the intervention of CHD provides possibility.The inventor at first sets up sample storehouse and the database of unified standard: (SOP) gathers standard compliant blood sample according to Standard operation procedure SOP, demography data and clinical data that systematic collection is complete.The pregnant woman who nourishes healthy fetus who then selects to nourish pregnant woman's case of CHD fetus and be complementary in week pregnant with it contrasts, use RT-PCR, Realtime PCR method, SOLiD sequencing technologies etc. detect case and contrast pregnant week of 22-28 female serum express spectra and content, analyze general character and the characteristic of female serum between CHD case and normal healthy controls, screening differential expression miRNAs further verifies.MiRNAs to female blood serum differential expression of having screened carries out quantitative analysis in the large sample crowd, determine the special female serum s of CHD.Special female serum exploitation miRNAs according to CHD case and normal healthy controls assists early diagnosis kit at last.This diagnostic kit comprises these female serum s and correspondent probe thereof, and reagent such as damping fluid, Taq enzyme.
The objective of the invention is to realize by following technical proposal:
A kind of maternal serum relevant with fetal congenital heart disease/blood plasma miRNA mark, this mark are mir-29c:UAGCACCAUUUGAAAUCGGUUA(SEQ ID No.1).
Primer or the probe of described maternal serum/blood plasma miRNA mark.The primer that these are independent or probe can be bought by the commercial channel and obtain, also can be designed syntheticly after understanding the sequence of these miRNA voluntarily by the technician, be method well known to those skilled in the art according to the method for known miRNA sequences Design synthetic primer or probe.
The probe of described serum mark, this probe are Assay ID:000587.(probe Assay is all available from American AB I company)
The application in preparation fetal congenital heart disease auxiliary diagnostic box of described maternal serum/blood plasma miRNA mark and primer thereof or probe.
A kind of fetal congenital heart disease auxiliary diagnostic box, this test kit is for detection of mir-29c in maternal serum/blood plasma.
Described diagnostic kit, this test kit contain primer or the probe of mir-29c in maternal serum/blood plasma miRNA.Especially, this probe is Assay ID:000587.
Described diagnostic kit is characterized in that this test kit can also comprise enzyme and reagent that detection reaction is commonly used.Specifically can determine that these technology all can adopt the technology of existing detection serum according to the detection technique that adopts.
Beneficial effect of the present invention
Serum s is a kind of new bio mark, be different from the traditional biological mark, not only stable, Wicresoft, be easy to detect, and quantitatively accurately, to improve susceptibility and the specificity of medical diagnosis on disease greatly, the successful exploitation of such microRNA biomarker helps the auxiliary diagnosis of CHD.The present invention finds the miRNAs of unconventionality expression relevant with CHD in maternal serum/blood plasma by the method for SOLiD order-checking and real time fluorescent quantitative, discloses its preciousness in fetus CHD early diagnosis and is worth.The present invention has obtained the miRNAs mark in the special female blood serum of fetus CHD morbidity, and develops the auxiliary diagnostic box that is made of itself and primer thereof or probe, for clinical diagnosis, intervention etc. provides huge facility.This diagnostic kit biggest advantage is simple to operate, the result is accurately objective reliable, can well CHD case group and normal healthy controls group differentiation be opened, and only need to carry out by sample of blood, drawn, need not other tissue samples, improve possibility and the feasibility of clinical application greatly, instructed practice, dropped into practice.
Description of drawings
Fig. 1, show the box figure of expression of mir-29c nourish pregnant woman's case of CHD fetus and to nourish pregnant woman's contrast of healthy fetus.
Among the figure: CHD: case group, Control: control group.
Fig. 2 shows the ROC curve of mir-29c in case group and control group.
Embodiment
The invention will be further elaborated by the following examples.
1. test materials: miVana PARIS kit, Taqman MicroRNAreverse transcription kit, Taqman gene expression mix, Taqman MicroRNA assay-hsa-mir-29c(Assay ID:000587), taqman MicroRNA assay-cel-mir-39(Assay ID:000200) all available from American AB I company.The ripe body of synthetic cel-mir-39 is available from Invitrogen company (sequence is: UCACCGGGUGUAAAUCAGCUUG(SEQ ID No.2)).
2. the arrangement of sample collection and sample data: the inventor collected the pregnant all pregnant woman's of a large amount of 22-28 peripheral blood sample (the blood sample collection, packing, the preservation condition that are used for research are all consistent) so far from Nanjing Women and Children Healthcare Hospital in beginning in 2011.The arrangement sample data, the contriver has therefrom selected the experiment sample of 60 routine samples as follow-up SOLiD order-checking and real-time fluorescence quantitative PCR checking according to the unified standard of prior formulation:
(1) be pregnant woman's case of CHD through the fetus excusing from death cardiogram fetus of clarifying a diagnosis;
(2) not accepting any intervention before the blood sampling handles;
(3) will with the pregnant woman who nourishes healthy fetus of the pregnant week coupling of case in contrast.
3. extract the mirVana PARIS kit that total RNA(uses ABI company):
1) get 400 μ l serum, add isopyknic 2* sex change liquid, mixing leaves standstill 5min on ice with mixed solution immediately, and it is 10 that the back adds 5 μ l concentration
-4The synthetic cel-mir-39(of pmol/ μ l joins outward, with the expression amount of stdn purpose miRNA);
2) adding with the isopyknic acid-phenol of above-mentioned mixed solution is chloroform: concussion 30-60s mixing, under the room temperature with the centrifugal 5min of 12000g/min, water phase separated and organic phase;
3) with the upper water phase transition in new centrifuge tube, note volume;
4) in above-mentioned centrifuge tube, add 1.25 times of volume 100% ethanol, thoroughly mixing;
5) prepare centrifugal post and collection tube by sample size;
6) draw the above-mentioned lysate/alcohol mixeding liquid of 700 μ l in centrifugal post, the centrifugal 1min of room temperature passes through Filter column (1000g/min) (if mixeding liquid volume is greater than 700 μ l until mixed solution, then the filtrate after centrifugal is outwelled, add remaining mixed solution in same Filter column, continue centrifugal);
7) outwell filtrate after centrifugal, add 700 μ l miRNA Wash Solution1 in Filter column, the centrifugal 1min of 10000g/min discards the filtrate in the collection tube under the room temperature;
8) drawing 500 μ l Wash Solution2/3(Wash Solution2/3 is titles of a kind of elutriant in the test kit) in each Filter column, the centrifugal 1min of room temperature 10000g/min discards filtrate;
9) repeating step 8;
10) after filtrate discarded, with the centrifugal 1min of Filter column room temperature, 10000g/min removed residual liquid; 11) all Filter columns are transferred in the new collection tube, added the elutriant of 20 μ l preheatings, the centrifugal 1min of 10000g collects total RNA, places stand-by on ice or-80 ℃ of preservations.
4. order-checking of future generation detects and (chooses from above-mentioned qualified 60 routine samples that 3 examples are nourished pregnant woman's case of CHD fetus and the SOLiD order-checking is carried out in pregnant woman's contrast that 3 examples are nourished healthy fetus, and acquisition correlated results): the total RNA of difference equivalent is used for the microRNA library construction.Total RNA separates through 15%PAGE sex change gel electrophoresis, length range is cut glue at the microRNA of 17～24nt to be reclaimed, microRNA behind the purifying is connected the amplification by RT-PCR through 5 ' joint respectively with 3 ' joint, form the cDNA library of microRNA, is directly used in order-checking of future generation.Order-checking of future generation adopts the SOLiD sequenator to finish in Southeast China University's molecule and biomolecular electronics laboratory.SOLiD order-checking obtains the 35nt sequence, by remove joint, go inferior quality, depollute, process such as statistical series length distribution finishes elementary analysis.The sequence that elementary analysis the is obtained note of classifying, each component that can obtain to comprise in the sample and expression amount information.People's miRNA sequence is compared in remaining microRNA sequence and the miRNA database (Sanger miRBase14.0 database), obtains the information such as content, the distribution of the first some base and expression abundance of known miRNA in the sample.
5. according to the SOLiD sequencing result, select mir-22, mir-29c, mir-21, mir-221, mir-375, let-7a, mir-26a, mir-24, mir-27b, mir-19b, the probe (probe I D is respectively Taqman MicroRNA assay-has-mir-22 (Assay ID:000398), Taqman MicroRNA assay-has-mir-29c(Assay ID:000587) of 11 miRNAs design reverse transcriptions such as mir-15b and qRT-PCR, Taqman MicroRNA assay-has-mir-21(Assay ID:000397); Taqman MicroRNA assay-has-mir-221(Assay ID:000524), Taqman MicroRNA assay-has-mir-375 (Assay ID:000564), Taqman MicroRNA assay-has-let-7a(Assay ID:000377), Taqman MicroRNA assay-has-mir-26a(Assay ID:000405), Taqman MicroRNA assay-has-mir-24 (Assay ID:000402), Taqman MicroRNA
Assay-has-mir-27b (Assay ID:000409), Taqman MicroRNA assay-hsa-mir-19b(Assay ID:000396), Taqman MicroRNA assay-has-mir-15b (Assay ID:000390), Taqman MicroRNA assay-cel-mir-39(Assay ID:000200), all available from American AB I company)." pregnant woman's case of nourishing the CHD fetus " group and " pregnant woman's contrast of nourishing healthy fetus " single individuality of the female serum of group are carried out the real-time fluorescence quantitative PCR detection of miRNA.Carry out qRT-PCR with probe method and detect, each sample continuous detecting 3 times to the strict Quality Control of whole experiment, and adopts blind method, occurs to avoid bias.
6. probe method: the reverse transcription test kit (Taqman MicroRNAreverse transcription kit+Taqman gene expression master mix+Taqman MicroRNA assay-hsa-mir-29c+taqman MicroRNA assay-cel-mir-39) that uses ABI company
1) obtains cDNA by the RNA reverse transcription reaction.The reverse transcription system of probe method comprises: dNTP mix0.15 μ l, and RT enzyme 1 μ l, 10*RT Buffer1.5 μ l, RNA Inhibitor0.19 μ l, the reverse transcriptase primer of DEPC water 4.16 μ l and 3 μ l mir-19 adds total RNA that 5 μ l extract in advance again.The reverse transcription reaction thermal cycling is 16 ℃ and hatches 30min, hatches 30min for 42 ℃, hatches 5min for 85 ℃, hatches 10min for 4 ℃;
2) q-PCR: the reaction system of the q-PCR of probe method comprises: cDNA1 μ l, the probe 1 μ l of mir-29c, taqman gene expression master mix10 μ l and DEPC water 8 μ l.Reactions steps is 95 ℃, and 5min carries out a circulation → 95 ℃, 15s, and 60 ℃, 1min carry out 45 circulations, uses the operation of ABI Prism7500 quantitative real time PCR Instrument.
7. data processing and analysis
7.1 the demography of sample and Clinical symptoms use student t check to analyze.
7.2SOLiD order-checking: the relative expression quantity (H2) of case group purpose miRNA carries out probe method qRT-PCR confirmatory experiment with the ratio of the relative expression quantity (H1) of control group purpose miRNA greater than 2.(the H2/H1=3.375 of hsa-mir-29c wherein.）
7.3 probe method qRT-PCR proof test data analysis:
1) we use equation 2
-△ △ CtThe relative expression quantity of representing two groups of sample serum miRNAs, wherein △ △ Ct=△ C
T Case-△ C
The T contrast-△ C
Tcel-mir-39, we add the mature rna of cel-mir-39 of synthetic as reference when each sample extraction RNA, calculate the relative expression quantity of miRNAs in female blood serum.Above data, namely Ct value (amplification cycles number) all the detection software worn of available fluorescent quantitation detector read out.Final data all carries out statistical study with SPSS17.0.
2) found that mir-29c expresses and is higher than control group in the normal healthy controls of 27 routine CHD cases and 27 example couplings in female serum of CHD case group, this result has remarkable statistical significance and (sees Table 1, Fig. 1).
3) diagnosis efficiency of the fetus CHD of female blood serum mir-29c is drawn ROC curve (Receiver Operating Curve) and is calculated AUC(Area Under the ROC Curve) (see figure 2).Demonstration mir-29c opens normal healthy controls group and CHD case component with 76.7% AUC, and the sensitivity of best stagnation point is 63%, specific degree: 88.9%.
The checking result of table 1 in 27 routine case groups and 27 routine control groups
* Mann-Whitney check; # △ CT=C
The T case-C
T joins outward
Claims (9)
1. the maternal serum relevant with fetal congenital heart disease/blood plasma miRNA mark, this mark is mir-29c.
2. primer or the probe of the described maternal serum of claim 1/blood plasma miRNA mark.
3. the probe of the described serum mark of claim 2 is characterized in that this probe is Assay ID:000587.
4. the application of the described maternal serum of claim 1/blood plasma miRNA mark in preparation fetal congenital heart disease auxiliary diagnostic box.
5. the primer of the described maternal serum of claim 2/blood plasma miRNA mark or the probe application in preparation fetal congenital heart disease auxiliary diagnostic box.
6. the application of the probe of the described maternal serum of claim 3/blood plasma miRNA mark in preparation fetal congenital heart disease auxiliary diagnostic box.
7. a fetal congenital heart disease auxiliary diagnostic box is characterized in that this test kit is for detection of mir-29c in maternal serum/blood plasma.
8. diagnostic kit according to claim 7 is characterized in that this test kit contains primer or the probe of mir-29c in maternal serum/blood plasma miRNA.
9. diagnostic kit according to claim 8 is characterized in that this test kit contains the probe of the described maternal serum of claim 3/blood plasma miRNA mark.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310188740.8A CN103290011B (en) | 2013-05-16 | 2013-05-16 | The maternal serum relevant to fetal congenital heart disease/blood plasma miRNA mark mir-29c and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310188740.8A CN103290011B (en) | 2013-05-16 | 2013-05-16 | The maternal serum relevant to fetal congenital heart disease/blood plasma miRNA mark mir-29c and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103290011A true CN103290011A (en) | 2013-09-11 |
| CN103290011B CN103290011B (en) | 2015-09-16 |
Family
ID=49091542
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310188740.8A Expired - Fee Related CN103290011B (en) | 2013-05-16 | 2013-05-16 | The maternal serum relevant to fetal congenital heart disease/blood plasma miRNA mark mir-29c and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103290011B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109182506A (en) * | 2018-10-08 | 2019-01-11 | 南京市儿童医院 | One kind serum/plasma excretion body miRNA marker relevant to atrial septum type congenital heart disease and its application |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009018493A1 (en) * | 2007-07-31 | 2009-02-05 | The Board Of Regents Of The University Of Texas System | A micro-rna family that modulates fibrosis and uses thereof |
| WO2010144485A1 (en) * | 2009-06-08 | 2010-12-16 | Miragen Therapeutics | CHEMICAL MODIFICATION MOTIFS FOR miRNA INHIBITORS AND MIMETICS |
| CN102481310A (en) * | 2009-05-20 | 2012-05-30 | 得克萨斯系统大学董事会 | Identification Of Micro-rnas Involved In Post-myocardial Infarction Remodeling And Heart Failure |
-
2013
- 2013-05-16 CN CN201310188740.8A patent/CN103290011B/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009018493A1 (en) * | 2007-07-31 | 2009-02-05 | The Board Of Regents Of The University Of Texas System | A micro-rna family that modulates fibrosis and uses thereof |
| CN101883576A (en) * | 2007-07-31 | 2010-11-10 | 得克萨斯系统大学董事会 | Micro-rna family of that modulates fibrosis and uses thereof |
| CN102481310A (en) * | 2009-05-20 | 2012-05-30 | 得克萨斯系统大学董事会 | Identification Of Micro-rnas Involved In Post-myocardial Infarction Remodeling And Heart Failure |
| WO2010144485A1 (en) * | 2009-06-08 | 2010-12-16 | Miragen Therapeutics | CHEMICAL MODIFICATION MOTIFS FOR miRNA INHIBITORS AND MIMETICS |
Non-Patent Citations (2)
| Title |
|---|
| EVA VAN ROOIJ ET AL.: "Dysregulation of microRNAs after myocardial infarction reveals a role of miR-29 in cardiac fibrosis", 《PNAS》 * |
| 陈伟丹等: "循环miR-19a 作为先天性心脏病相关肺动脉高压的标志物", 《中国分子心脏病学杂志》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109182506A (en) * | 2018-10-08 | 2019-01-11 | 南京市儿童医院 | One kind serum/plasma excretion body miRNA marker relevant to atrial septum type congenital heart disease and its application |
| CN109182506B (en) * | 2018-10-08 | 2021-10-08 | 南京市儿童医院 | Serum/plasma exosome miRNA marker related to atrial septal congenital heart disease and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103290011B (en) | 2015-09-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106148537B (en) | One kind serum relevant to diabetes B or blood plasma miRNA marker and its application | |
| CN104152452B (en) | A kind of blood miRNA marker relevant to hepatocarcinoma and application thereof | |
| CN106011303B (en) | One kind serum relevant to children obesity or blood plasma miRNA marker and its application | |
| CN106119393B (en) | Plasma miRNA marker related to esophageal squamous carcinoma auxiliary diagnosis and application thereof | |
| CN102031261A (en) | Serum/plasma miRNA (micro Ribonucleic Acid) marker relevant to gestational diabetes and application thereof | |
| CN109295218A (en) | Circular rna marker hsa_circ_0001788 and its application | |
| CN109609633A (en) | One kind serum miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application | |
| CN102358900A (en) | Plasma micro-ribonucleic acid (miRNA) marker related with human Hirschsprung's disease and application of miRNA marker | |
| CN106119385B (en) | A kind of miRNA molecule marker hsa-miR-149-3p of diagnosed type 2 diabetic and its application | |
| CN108441552A (en) | A kind of and the relevant serum/plasma miRNA marker of intrahepatic cholestasis of pregnancy auxiliary diagnosis and its application | |
| CN103205430A (en) | Related serum microribonucleic acid marker for human severe preeclampsia and application of marker | |
| CN107557472B (en) | Glioma diagnosis marker circ9:135881633|135883078 and application | |
| CN106191055A (en) | A kind of non-small cell lung carcinoma marker, detectable and test kit | |
| CN101633925B (en) | Seminal plasma micro ribonucleic acid marker related to spermatogenesis deficiency and application thereof | |
| CN103290116B (en) | A kind of maternal serum relevant to fetal congenital heart disease/blood plasma miRNA mark and application thereof | |
| CN109609634A (en) | One kind circulation miRNA marker relevant to carcinoma of endometrium auxiliary diagnosis and its application | |
| CN103290011B (en) | The maternal serum relevant to fetal congenital heart disease/blood plasma miRNA mark mir-29c and application thereof | |
| CN109593852B (en) | Serum miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof | |
| CN106987633A (en) | A kind of primer and kit for detecting colorectal cancer serum secretion type lncRNAs | |
| CN103290013B (en) | The maternal serum relevant to fetal congenital heart disease/blood plasma miRNA mark mir-19b and application thereof | |
| CN103290010B (en) | The maternal serum relevant to fetal congenital heart disease/blood plasma miRNA mark mir-375 and application thereof | |
| CN103290012B (en) | The maternal serum relevant to fetal congenital heart disease/blood plasma miRNA mark mir-22 and application thereof | |
| CN109593851A (en) | One kind blood plasma miRNA marker relevant to Computer-aided Diagnosis of Breast Cancer and its application | |
| CN105400882A (en) | Serum miRNA markers suitable for diagnosis of ossification of posterior longitudinal ligament and application thereof | |
| CN109536612B (en) | Plasma miRNA marker related to nasopharyngeal carcinoma auxiliary diagnosis and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20150916 Termination date: 20160516 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |