CN103276055B - TAQMAN probe real-time fluorescent quantitative PCR method treating tree shrew IL-2 constructed plasmid as standard substance - Google Patents
TAQMAN probe real-time fluorescent quantitative PCR method treating tree shrew IL-2 constructed plasmid as standard substance Download PDFInfo
- Publication number
- CN103276055B CN103276055B CN201310104794.1A CN201310104794A CN103276055B CN 103276055 B CN103276055 B CN 103276055B CN 201310104794 A CN201310104794 A CN 201310104794A CN 103276055 B CN103276055 B CN 103276055B
- Authority
- CN
- China
- Prior art keywords
- concentration
- probe
- primer
- plasmid
- tree shrew
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Abstract
A TAQMAN probe real-time fluorescent quantitative PCR method treating a tree shrew IL-2 constructed plasmid as a standard substance comprises the following steps: designing a TAQMAN primer and a probe by treating a tree shrew IL-2 gene as a target, designing experiments for finding the primer annealing temperature, the primer concentration and the probe concentration under an optimal condition, purifying the tree shrew IL-2, calculating to obtain the fragment copy number of the IL-2 gene, carrying out 10-time gradient dilution by using the calculated tree shrew IL-2 plasmid to prepare positive plasmids having copy numbers of 10<5>-10<9> copies, establishing a standard curve, and detecting the sensitivity.
Description
Technical field
The invention belongs to biology field, relate to a kind of with the tree shrew IL-2 plasmid of clone for standard substance, what set up on this basis take TAQMAN as the real-time fluorescence quantitative PCR detection method of probe.
Background technology
Bai Xi born of the same parents Jie Su ?2(Interleukin ?2, IL-2) primarily of the class Th1 cytokines that activated lymphocyte produces, it can promote T cell, NK cell, the differentiation and maturation of B cell and activate its biological activity, induction LAK (LAK), and by lymphokine and natural killer cells destroy tumour cell, can also promote that many lymphokines are as Interferon, rabbit, the synthesis of tumour necrosis factor etc. and release and antibody tormation, thus enhancing body immunologic function greatly, antitumor, toxinicide, in the treatment of immunomodulatory and infectious diseases, there is vital role.IL-2 also can be used as the treatment of immunological adjuvant for some lymphoproliferative disease and cancer, and IL-2 antagonist can be used to suppress organ transplant rejection.In physianthropy, recombinant il-2 is applied widely in raising immune disease-resistance function, anti-infective and Therapeutic cancer etc.
Tree shrew (tree shrew, Tupaia belangeri) is that one way of life climbs the meiofauna of Shrew class at the Mammalia of subtropical and tropical zones, and form exactly likes squirrel, is the close relative of primate.Because tree shrew has small, economy is easy to get, and easily raises and train, fecundity is strong, feeding and management cost is low, to advantages such as human virus's susceptibles, usually for substituting or reduce the use of some non-human primate, so be used as the disease animal model of primates order (comprising the mankind) very early.Recent study finds, is used widely in the research of the diseases such as hepatitis C, hepatitis B, hand-foot-mouth disease, liver cancer, diabetes, tumour.
Hepatitis C, caused by hepatitis C virus (HCV) infects, primarily of blood/body fluid communication, accounts for 70% of post-transfusion hepatitis.HCV infection causes the major cause of chronic hepatopathy in worldwide.WHO estimates that the whole world has 1.7 hundred million people to infect hepatitis C virus.But up to the present also not relevant vaccine and the medicine of effectively curing, trace it to its cause and be do not have desirable small animal model.Cause its chronic infection mechanism unclear, result in HCV vaccine development and clinical treatment have difficulty in taking a step.
There are some researches show that tree shrew not only can be infected by hepatitis C virus (HCV) in vivo, and the primary hepatocyte of tree shrew also can be infected in vitro, also after having research to confirm the effective HCV infection of tree shrew, chronic hepatitis, fatty degeneration of liver, hepatic fibrosis, cirrhotic nodule and tumour can be developed into, show that tree shrew can be used as animal pattern in order to study hepatitis C pathogenesis, the Novel experimental animal of prophylactic treatment and new drug development.Also have research to confirm, middle remote earsh Shrew can infect EV71, and successfully can set up diabetes model, and this is that the research studying HCV chronic infection mechanism, hand foot mouth disease and pathogenesis of diabetes mellitus provides good research platform.
Have expert to confirm, in chronic and heavy hepatitis C infection person serum, IL-2 level obviously rises, and the weight of ascensional range and the state of an illness and course of disease length have substantial connection.In brothers' mouth infant serum, IL-2 level is significantly lower than normal youngster's group, and the mechanism causing infant IL-2 level to reduce may be that infant cellular immune level is suppressed event.In type 1 diabetes infant serum, IL-2 level apparently higher than normal group, and is negative correlation with the reflection C peptide (CP) of islet function, Regular Insulin.But at present report is rarely had to the research of tree shrew IL-2 aspect, cause the evaluation index lacked tree shrew animal model immune cell factor aspect.
Summary of the invention
In view of the vacancy of prior art, the object of the invention is to set up tree shrew specificity IL-2 gene real time fluorescent quantitative TAQMAN PCR detection method, it is the tree shrew IL-2 total length coding gene sequence determined is template, design Auele Specific Primer and probe, and preparation standard product and typical curve, setting up in mRNA level in-site the method that real-time fluorescence quantitative PCR detects tree shrew IL-2, laying the foundation for studying its immune adjusting mechanism in tree shrew disease model from now on.Set up a kind of good stability, reproducible, highly sensitive tree shrew IL-2 detection method, from cytokine aspect, confirm that tree shrew is as the suitable small animal model of hepatitis C, hand foot mouth disease and diabetes study further.For HCV, EV71 infectionization mechanism, pharmacological agent and vaccine research provide foundation, and lay a good foundation for the research of the pathogeny of diabetes and pharmacological agent etc.
In order to reach above-mentioned purpose of the present invention, the present invention takes fluorescent quantitation TAQMAN round pcr, and according to tree shrew IL-2cDNA sequence, design Auele Specific Primer and probe, establish the typical curve for detecting tree shrew IL-2 gene expression amount, and detect its susceptibility.
Technical scheme provided by the invention is as follows:
The plasmid that tree shrew IL-2 builds is a TAQMAN probe for real-time fluorescence quantifying PCR method for standard substance, and step is as follows:
(1) with tree shrew IL-2 total length encoding gene segment for target, design TAQMAN PCR primer and probe;
(2) contrived experiment obtains the annealing temperature of primer, primer concentration, concentration and probe concentration plasmid of purifying calculates IL-2 gene fragment copy number;
(3) with the tree shrew IL-2 plasmid calculated, with 10 times of gradient dilutions, preparation copy number is 10
5~ 10
9copies positive plasmid Criterion curve;
(4) repeatability of present method, stability and susceptibility is verified.
Described tree shrew IL-2 oligonucleotide primer and probe are:
IL-2FP:5'–TGCTCTCCAGGATGCTCAC–3'，
IL-2RP:5'–AGCACTTTCTCCAGAGGTTTG–3'，
IL-2Probe:5'(FAM)–ATTTTATACACCCAGAAAGGCCACAG–(TAMRA)3'。
Step (2) described experiment is:
A. the determination of annealing temperature
According to this primer and probe feature design respectively annealing temperature 55 DEG C, 56 DEG C, 57 DEG C, 58 DEG C determine its optimum annealing temperature, with PMD-19T IL-2 plasmid for template application PCR instrument carries out gradient amplification: dreamMix Taq enzyme 25ul, dH
2o20ul, Tupaia-IL-2FP/RP be 2ul, template 1ul separately, mixes; 95 DEG C of 3min; 95 DEG C of 30s, 55 ~ 58 DEG C of 30s, 72 DEG C of 45s, 35 circulations; 72 DEG C of 10min; Amplified production detects in 2.5% agarose gel electrophoresis; Known by electrophoresis result: the amplified fragments that can obtain 106bp under different annealing temperature, the most clear with deposition condition under 57 DEG C of conditions, pillar location is correct in non-specific amplification, and therefore this detection system determines Tm=57 DEG C;
B. the determination of primer concentration:
Minimum with the template concentrations that can detect under the same terms, amplified production band is single, clear is Primer selection standard; With the IL-2TAQMAN PCR upstream and downstream primer concentration of 100nm, 200nm and 300nm3 different concns, be template with same concentration IL-2 recombinant plasmid respectively, be divided into 3 reactant series, carry out RT-PCR amplification simultaneously; Reaction system is that 1ul, DEPC process water 8.5ul, template 2ul mix separately for 25uL:Realtime PCR Master Mix12.5ul, Tupaia-IL-2FP/RP; Loop parameter is: 95 DEG C of 3min; 95 DEG C of 30s, 57 DEG C of 30s, 72 DEG C of 1min, 35 circulations; 72 DEG C of 10min amplifications; 4 DEG C for subsequent use; Amplified production detects in 2.5% agarose gel electrophoresis; Electrophoresis showed under different primers concentration: primer 2 00nm is minimum concentration, this concentration can increase object fragment well;
C. the determination of concentration and probe concentration:
, fluorescent signal ratio (Rn) activity minimum with cycle threshold (Ct) under same template concentration is probe choice criteria to the maximum; Adopt 2um, 5um, 10um3 concentration and probe concentration, be template with same concentration IL-2 recombinant plasmid respectively, carry out TAQMAN PCR detection; Reaction system is 25ul:2 × One Step RT-PCRBuffer II 12.5ul, Takara Ex Taq HS0.5ul, Primer Script RT Enzyme Mix II 0.5ul, Tupaia-IL-2FP/RP 0.5ul, Probe solution 1ul, template 2ul, Easy dilusion7.5ul separately, mixes; Loop parameter is: 95 DEG C of 3min; 95 DEG C of 10s, 57 DEG C of 30s, 40 circulations; 72 DEG C of 5min; 4 DEG C save backup; Observe amplification curve and examining report, by different probe concentration amplification curve and the display of Ct value, this detection system Ct value under 2um condition is minimum, and the maximum amplification curve of Rn is good.
Step (2) surveys its plasmid A260/A280(1.8 ~ 2.0) according to following formulae discovery copy number:
Copy number (copies/m)=mass concentration (ug/ul) × A Shi constant/plasmid molecule amount, wherein, A Shi constant is 6.02 × 10
23; Molecular weight (the 649) × recombinant plasmid total length (bp) of plasmid molecule amount=mono-base pair.
Being established as the plasmid of known copy number according to 1 × 10 of step (3) typical curve
5~ 1 × 10
9copy number concentration carries out 10 times of gradient dilutions, obtain the PMD-19T IL-2 positive plasmid concentration samples of 5 different molecular weights, carry out TAQMAN pcr analysis respectively, quantitation curves is drawn out according to the logarithmic value of the molecule number of sample in reaction result and the corresponding relation of Ct value thereof, its slope=-3.149, intercept=46.568, R2=0.998, obtaining this detection system linear equation is Ct=-3.149log(copynumber)+46.568.
A kind of TAQMAN fluorescence probe quantitative PCR method that is standard substance with tree shrew IL-2 plasmid, comprise with tree shrew IL-2 gene for target, design TAQMAN PCR primer and probe, contrived experiment finds annealing temperature, primer concentration, the concentration and probe concentration of primer under optimal conditions, purification tree shrew IL-2 plasmid calculates IL-2 gene fragment copy number, with the tree shrew IL-2 plasmid 10 times of gradient dilutions calculated, preparation copy number is 10
5~ 10
9copies positive plasmid Criterion curve, and detect its susceptibility.
Wherein, tree shrew IL-2 oligonucleotide primer and probe are:
IL-2FP:5'–TGCTCTCCAGGATGCTCAC–3'
IL-2RP:5'–AGCACTTTCTCCAGAGGTTTG–3'
IL-2Probe:5'(FAM)–ATTTTATACACCCAGAAAGGCCACAG–(TAMRA)3'
The method comprises:
(1) determination of detection system annealing temperature
(2) determination of detection system concentration and probe concentration and primer concentration
(3) 10 are configured
5~ 10
9the IL-2 plasmid of copy number, establishes the typical curve of this detection system as template
(4) the IL-2 plasmid 10 times of gradient dilutions 10 respectively determining concentration are utilized
9, 10
8, 10
7, 10
6, 10
5, 10
4, 10
3, 10
2, 10
1, 10
0copies, obtains kinetic curve, detects the susceptibility of this detection system
And detect its repeatability, stability and susceptibility (5)
The foundation of the TAQMAN fluorescence probe quantitative PCR method that the present invention is standard substance with tree shrew specificity IL-2 plasmid, the step summary that it comprises is:
A for target, designs suitable primer and probe by Primer Premier5.0 software with tree shrew IL-2 total length encoding gene segment in this fragment.
B contrived experiment obtains the annealing temperature of the primer under optimal conditions, primer concentration, concentration and probe concentration plasmid of purifying calculates IL-2 gene fragment copy number.
C is with the tree shrew IL-2 plasmid calculated, and with 10 times of gradient dilutions, preparation copy number is 10
5~ 10
9copies positive plasmid Criterion curve.
D verifies the repeatability of present method, stability and susceptibility.
Accompanying drawing explanation
Below in conjunction with accompanying drawing, set forth the present invention further with embodiments of the invention.Should be appreciated that these embodiments only for illustration of the present invention instead of limit the scope of the invention.
Fig. 1 is IL-2 gene fragment amplification electrophoresis detection result under different annealing temperature.
Fig. 2 is IL-2 gene fragment amplification electrophoresis detection result under different primers concentration.
Fig. 3 is different probe concentration amplification curve and Ct value.
Fig. 4 is with 10
5~ 10
9copies is the amplification curve that template is set up.
Fig. 5 is with 10
5~ 10
9copies is typical curve and the linear relationship of template foundation.
Fig. 6 is the amplification curve detecting its method susceptibility.
[embodiment]:
Embodiment 1: the foundation of the TAQMAN fluorescence probe quantitative PCR method being standard substance with tree shrew IL-2 plasmid:
The experimental technique of unreceipted actual conditions in embodiment, usual conveniently condition is as people such as Sambrook, molecular cloning: laboratory (New York:Cold Spring Harbor Laboratory Press, 1989) or the people such as Peng Xiuling, genetically engineered experimental technique, condition described in (science tech publishing house), or according to the condition that manufacturer advises.
The determination of 1PCR amplification and annealing temperature
According to this primer and probe feature design respectively annealing temperature 55 DEG C, 56 DEG C, 57 DEG C, 58 DEG C determine its optimum annealing temperature.Adopt following reaction system and condition, with PMD-19T IL-2 plasmid for template application PCR instrument carries out gradient amplification: dream Mix Taq enzyme 25ul, dH
2o20ul, Tupaia-IL-2FP/RP be 2ul, template 1ul separately, mixes.95 DEG C of 3min; 95 DEG C of 30s, 55 ~ 58 DEG C of 30s, 72 DEG C of 45s, 35 circulations; 72 DEG C of 10min.Amplified production detects in 2.5% agarose gel electrophoresis.Known by electrophoresis result: the amplified fragments that can obtain 106bp under different annealing temperature, the most clear with deposition condition under 57 DEG C of conditions, pillar location is correct in non-specific amplification, and therefore this detection system is determined Tm=57 DEG C (Fig. 1).
The determination of 2 primers and concentration and probe concentration:
2.1 primer concentrations: minimum with the template concentrations that can detect under the same terms, amplified production band is single, clear is Primer selection standard.With the IL-2TAQMANPCR upstream and downstream primer concentration of 100nm, 200nm and 300nm3 different concns, be template with same concentration IL-2 recombinant plasmid respectively, be divided into 3 reactant series, carry out RT-PCR amplification simultaneously.Reaction system is that 1ul, DEPC process water 8.5ul, template 2ul mix separately for 25uL:Realtime PCR Master Mix12.5ul, Tupaia-IL-2FP/RP.Loop parameter is: 95 DEG C of 3min; 95 DEG C of 30s, 57 DEG C of 30s, 72 DEG C of 1min, 35 circulations; 72 DEG C of 10min amplifications; 4 DEG C for subsequent use.Amplified production detects in 2.5% agarose gel electrophoresis.Electrophoresis showed under different primers concentration: primer 2 00nm is minimum concentration, this concentration can increase object fragment (Fig. 2) well.
2.2 concentration and probe concentration:, fluorescent signal ratio (Rn) activity minimum with cycle threshold (Ct) under same template concentration is probe choice criteria to the maximum.Adopt 2um, 5um, 10um3 concentration and probe concentration, be template with same concentration IL-2 recombinant plasmid respectively, carry out TAQMAN PCR detection.Reaction system is 25ul:2 × One StepRT-PCR Buffer II 12.5ul, Takara Ex Taq HS0.5ul, Primer Script RT Enzyme Mix II 0.5ul, Tupaia-IL-2FP/RP 0.5ul, Probe solution 1ul, template 2ul, Easy dilusion7.5ul separately, mixes.Loop parameter is: 95 DEG C of 3min; 95 DEG C of 10s, 57 DEG C of 30s, 40 circulations; 72 DEG C of 5min; 4 DEG C save backup.Observe amplification curve and examining report.By different probe concentration amplification curve and the display of Ct value, this detection system Ct value under 2um condition is minimum, the maximum amplification curve of Rn good (Fig. 3).
3 plasmid copy numbers measure:
Survey its plasmid A260/A280(1.8 ~ 2.0) according to following formulae discovery copy number:
Copy number (copies/m)=mass concentration (ug/ul) × A Shi constant/plasmid molecule amount.A Shi constant is 6.02 × 10
23; Molecular weight (the 649) × recombinant plasmid total length (bp) of plasmid molecule amount=mono-base pair.The foundation of 4TAQMAN PCR typical curve
By the plasmid of known copy number according to 1 × 10
5~ 1 × 10
9copy number concentration carries out 10 times of gradient dilutions, obtain the PMD-19T IL-2 positive plasmid concentration samples of 5 different molecular weights, carry out TAQMAN pcr analysis respectively, obtain amplification curve (Fig. 4) according to the logarithmic value of the molecule number of sample in reaction result and the corresponding relation of Ct value thereof, and draw out quantitation curves.Known detection system typical curve amplification curve standard from the graph, linear relationship is good, its slope=-3.149, intercept=46.568, R2=0.998.Can obtain this detection system linear equation is Ct=-3.149log(copynumber)+46.568(Fig. 5)
The evaluation of 5 detection system susceptibilitys
The standard recombinant plasmid calculated is done 10 times of gradient dilutions, and copy number is respectively 10
9, 10
8, 10
7, 10
6, 10
5, 10
4, 10
3, 10
2, 10
1, 10
0copies, obtains kinetic curve, with Ct value >35 circulation for lower limit detects the susceptibility of this system.Can 10 be detected by amplification curve known detection system
2copy number rank (Fig. 6).
Claims (1)
1. the plasmid that tree shrew IL-2 builds is a TAQMAN probe for real-time fluorescence quantifying PCR method for standard substance, and it is characterized in that, step is as follows:
(1) with tree shrew IL-2 total length encoding gene segment for target, design TAQMAN PCR primer and probe; (2) contrived experiment obtains the annealing temperature of primer, primer concentration, concentration and probe concentration plasmid of purifying calculates IL-2 gene fragment copy number;
(3) with the tree shrew IL-2 plasmid calculated, with 10 times of gradient dilutions, preparation copy number is 10
5~ 10
9copies positive plasmid Criterion curve;
(4) repeatability of present method, stability and susceptibility is verified;
Tree shrew IL-2 oligonucleotide primer described in step (1) and probe are:
IL-2FP: 5' –TGCTCTCCAGGATGCTCAC–3'，
IL-2 RP: 5' –AGCACTTTCTCCAGAGGTTTG –3'，
IL-2 Probe: 5' FAM–ATTTTATACACCCAGAAAGGCCACAG –TAMRA 3' ；
Step (2) described experiment is:
A. the determination of annealing temperature
According to this primer and probe feature design respectively annealing temperature 55 DEG C, 56 DEG C, 57 DEG C, 58 DEG C determine its optimum annealing temperature, with PMD-19T IL-2 plasmid for template application PCR instrument carries out gradient amplification: dream Mix Taq enzyme 25 μ L, dH
2o 20 μ L, IL-2 FP/IL-2 RP be 2 μ L, template 1 μ L separately, mixes; 95 DEG C of 3min; 95 DEG C of 30s, 55 ~ 58 DEG C of 30s, 72 DEG C of 45s, 35 circulations; 72 DEG C of 10min; Amplified production detects in 2.5% agarose gel electrophoresis; Known by electrophoresis result: the amplified fragments that can obtain 106bp under different annealing temperature, the most clear with deposition condition under 57 DEG C of conditions, pillar location is correct in non-specific amplification, and therefore this detection system determines Tm=57 DEG C;
B. the determination of primer concentration:
Minimum with the template concentrations that can detect under the same terms, amplified production band is single, clear is Primer selection standard; With the IL-2 TAQMAN PCR upstream and downstream primer concentration of 100nM, 200nM and 300nM 3 different concns, be template with same concentration IL-2 recombinant plasmid respectively, be divided into 3 reactant series, carry out RT-PCR amplification simultaneously; Reaction system is that 1 μ L, DEPC process water 8.5 μ L, template 2 μ L mix separately for 25 μ L:Realtime PCR Master Mix 12.5 μ L, IL-2 FP/IL-2 RP; Cycle index is 35,95 DEG C of 3min; 95 DEG C of 30s, 57 DEG C of 30s, 72 DEG C of 1min, 35 circulations; 72 DEG C of 10min amplifications; 4 DEG C for subsequent use; Amplified production detects in 2.5% agarose gel electrophoresis; Electrophoresis showed under different primers concentration: primer 2 00nM is minimum concentration, this concentration can increase object fragment well;
C. the determination of concentration and probe concentration:
, fluorescent signal minimum with cycle threshold Ct under same template concentration is probe choice criteria to the maximum than Rn activity; Adopt 2 μMs, 5 μMs, 10 μMs 3 concentration and probe concentration, be template with same concentration IL-2 recombinant plasmid respectively, carry out TAQMAN PCR detection; Reaction system is 25 μ L:2 × One Step RT-PCR Buffer II 12.5 μ L, Takara Ex Taq HS 0.5 μ L, Primer Script RT Enzyme Mix II 0.5 μ L, IL-2 FP/ IL-2 RP 0.5 μ L, Probe solution 1 μ L, template 2 μ L, Easy dilusion 7.5 μ L separately, mixes; Loop parameter is: 95 DEG C of 3min; 95 DEG C of 10s, 57 DEG C of 30s, 40 circulations; 72 DEG C of 5min; 4 DEG C save backup; Observe amplification curve and examining report, by different probe concentration amplification curve and the display of Ct value, this detection system Ct value under 2 μMs of conditions is minimum, and the maximum amplification curve of Rn is good;
Being established as the plasmid of known copy number according to 1 × 10 of step (3) described typical curve
5~ 1 × 10
9copy number concentration carries out 10 times of gradient dilutions, obtain 5 different PMD-19T IL-2 positive plasmid concentration samples, carry out TAQMAN pcr analysis respectively, quantitation curves is drawn out according to the logarithmic value of the molecule number of sample in reaction result and the corresponding relation of Ct value thereof, its slope=-3.149, intercept=46.568, R2=0.998, obtaining this detection system linear equation is Ct=-3.149log(copynumber)+46.568.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310104794.1A CN103276055B (en) | 2013-03-28 | 2013-03-28 | TAQMAN probe real-time fluorescent quantitative PCR method treating tree shrew IL-2 constructed plasmid as standard substance |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310104794.1A CN103276055B (en) | 2013-03-28 | 2013-03-28 | TAQMAN probe real-time fluorescent quantitative PCR method treating tree shrew IL-2 constructed plasmid as standard substance |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103276055A CN103276055A (en) | 2013-09-04 |
| CN103276055B true CN103276055B (en) | 2015-02-18 |
Family
ID=49058671
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310104794.1A Active CN103276055B (en) | 2013-03-28 | 2013-03-28 | TAQMAN probe real-time fluorescent quantitative PCR method treating tree shrew IL-2 constructed plasmid as standard substance |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103276055B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106047870B (en) * | 2016-06-16 | 2019-01-08 | 中国医学科学院医学生物学研究所 | Tree shrew MHC-DRB1*1101 gene order and its application |
| CN108373971A (en) * | 2017-03-11 | 2018-08-07 | 南京科维思生物科技股份有限公司 | Method and apparatus for carrying out real-time digital PCR |
| CN107312856B (en) * | 2017-07-24 | 2020-10-27 | 广州医科大学附属第一医院 | Primer pair, probe, kit and method for detecting common infection-related cytokines of tree shrew by fluorescent quantitative PCR (polymerase chain reaction) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101235415A (en) * | 2007-01-30 | 2008-08-06 | 中山大学达安基因股份有限公司 | Method for detecting gene simple point mutation by using TaqMan probe quantitative polymerase chain reaction technique |
| CN101691602A (en) * | 2008-12-22 | 2010-04-07 | 昆明理工大学 | Taqman fluorescence probe quantitative PCR method adopting plasmid constructed by tree shrew CD81 gene as standard substance |
-
2013
- 2013-03-28 CN CN201310104794.1A patent/CN103276055B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101235415A (en) * | 2007-01-30 | 2008-08-06 | 中山大学达安基因股份有限公司 | Method for detecting gene simple point mutation by using TaqMan probe quantitative polymerase chain reaction technique |
| CN101691602A (en) * | 2008-12-22 | 2010-04-07 | 昆明理工大学 | Taqman fluorescence probe quantitative PCR method adopting plasmid constructed by tree shrew CD81 gene as standard substance |
Non-Patent Citations (1)
| Title |
|---|
| 丙型肝炎病毒感染者血清细胞因子的检测;范学工等;《中华实验和临床病毒学杂志》;20000630;第14卷(第2期);145-147 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103276055A (en) | 2013-09-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tsai et al. | Detection of type 2‐like T‐helper cells in hepatitis C virus infection: implications for hepatitis C virus chronicity | |
| Park et al. | Immune responses to HCV and other hepatitis viruses | |
| Jiang et al. | Th1 and Th2 immune response in chronic hepatitis B patients during a long-term treatment with adefovir dipivoxil | |
| Egli et al. | The impact of the interferon-lambda family on the innate and adaptive immune response to viral infections | |
| CN103276055B (en) | TAQMAN probe real-time fluorescent quantitative PCR method treating tree shrew IL-2 constructed plasmid as standard substance | |
| Tramuto et al. | Prevalence of occult hepatitis B virus infection in a cohort of HIV-positive patients resident in Sicily, Italy | |
| Saleha et al. | Prevalence of hepatitis C virus genotypes in district Bannu, Khyber Pakhtunkhwa, Pakistan | |
| Ye et al. | CD56+ T cells inhibit hepatitis C virus replication in human hepatocytes | |
| Tian et al. | Increased interleukin-32, interleukin-1, and interferon-γ levels in serum from hepatitis B patients and in HBV-stimulated peripheral blood mononuclear cells from healthy volunteers | |
| Kayesh et al. | Interferon-β response is impaired by hepatitis B virus infection in Tupaia belangeri | |
| Zou et al. | Praziquantel facilitates IFN-γ-producing CD8+ T cells (Tc1) and IL-17-producing CD8+ T cells (Tc17) responses to DNA vaccination in mice | |
| Liu et al. | Innate immune recognition of hepatitis B virus | |
| Ribeiro et al. | Cytokines profile in patients with acute and chronic hepatitis B infection | |
| Li et al. | Interferon-stimulated gene 15 conjugation stimulates hepatitis B virus production independent of type I interferon signaling pathway in vitro | |
| Ribeiro et al. | Cytokine, genotype, and viral load profile in the acute and chronic hepatitis B | |
| Sausen et al. | Hepatitis B and Hepatitis D Viruses: a Comprehensive Update with an immunological focus | |
| Zhou et al. | Different antiviral effects of IFNα and IFNβ in an HBV mouse model | |
| Fan et al. | Molecular characterization of the type I IFN receptor in two woodchuck species and detection of its expression in liver samples from woodchucks infected with woodchuck hepatitis virus (WHV) | |
| Wieland et al. | Simultaneous detection of hepatitis C virus and interferon stimulated gene expression in infected human liver: 193 | |
| Hamdi et al. | Transcriptional response of MxA, PKR and SOCS3 to interferon-based therapy in HCV genotype 4-infected patients and contribution of p53 to host antiviral response | |
| Liang et al. | A mouse model for studying the clearance of hepatitis B virus in vivo using a luciferase reporter | |
| CN103146838B (en) | Real-time fluorescent quantitative PCR (polymerase chain reaction) method of TAQMAN probe with standard plasmids built by tree shrew IL-6 (interleukin 6) | |
| Chen et al. | Hepatitis B Virus Might Be Sensed by STING-Dependent DNA Sensors and Attenuates the Response of STING-Dependent DNA Sensing Pathway in Humans with Acute and Chronic Hepatitis B Virus Infection | |
| Imaizumi et al. | Retinoic acid-inducible gene-I (RIG-I) and diseases | |
| Lu et al. | Molecular characterization of woodchuck type I interferons and their expression by woodchuck peripheral blood lymphocytes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |