CN103275997A - Saccharomyces cerevisiae strain for producing 7-dehydrocholesterol and construction method - Google Patents
Saccharomyces cerevisiae strain for producing 7-dehydrocholesterol and construction method Download PDFInfo
- Publication number
- CN103275997A CN103275997A CN2013102291543A CN201310229154A CN103275997A CN 103275997 A CN103275997 A CN 103275997A CN 2013102291543 A CN2013102291543 A CN 2013102291543A CN 201310229154 A CN201310229154 A CN 201310229154A CN 103275997 A CN103275997 A CN 103275997A
- Authority
- CN
- China
- Prior art keywords
- gene
- yeast
- carrier
- dehydrocholesterol
- ybe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention discloses a saccharomyces cerevisiae strain for producing 7-dehydrocholesterol and a construction method. The construction method comprises the steps as follows: 1), construction of carriers: a carrier SyBE_000923 is constructed and a carrier SyBE_000937 is constructed; 2), a saccharomyces cerevisiae strain SyBE_000954 is obtained; and 3), the carrier SyBE_000923 and the carrier SyBE_000937 are guided into the saccharomyces cerevisiae strain SyBE_000954, so that the saccharomyces cerevisiae strain for producing 7-dehydrocholesterol is obtained. According to the saccharomyces cerevisiae strain and the construction method, a synthetic biotechnology is utilized, so that the artificially synthesis of the 7-dehydrocholesterol is realized, not only can the defects of a chemical method be made up, but also the production process is environment-friendly and clean.
Description
Technical field
The present invention relates to a kind of Wine brewing yeast strain and construction process of the 7-of production dehydrocholesterol.
Background technology
7-dehydrocholesterol (7-DHC) is not only vitamins D
3Important as precursors, also be the preparation liquid crystal material of cholesteric phase raw material, all have a wide range of applications at aspects such as biomedicine, electromagnetic field detection, demonstrations.7-dehydrocholesterol consumption is huge, but its source and production problems can't satisfy current growing demand.Existing 7-dehydrocholesterol preparation method mainly is chemical synthesis---bromination/dehydrobromination method and redox null method.But because the chemical process long flow path, reactions steps is many, and yield is low, and by product is removed the process complexity, and energy consumption is high and easily environment is caused severe contamination, has greatly limited production and the application of 7-dehydrocholesterol.
At present, the synthetic 7-DHC of biological process is mainly based on enzymatic reaction.Donald Lewis is substrate with the squalene, add animal livers and extract the particulate enzyme, 37 ℃ of water bath with thermostatic control shaking table catalyzed reactions, and in reaction system, add 7-DHC reductase enzyme (DHCR7) inhibitor with the reduction reaction of blocking-up DHCR7, can obtain to accumulate more 7-DHC.Other investigators are substrate with the cholesterol, utilize 7 in the Cytochrome P450 that forms the molting hormone animal, 8-desaturase, two keys between the cholesterol C7,8 are sloughed form 7-DHC, the advantage of this method is that the substrate cholesterol is low with respect to the squalene cost, convenient sources, and be single step reaction, can improve transformation efficiency greatly.Christine Lang discloses the method for producing 7-DHC in the yeast in 2006.By expressing the gene from mouse and people's C-8 sterol isomerase, C-5 sterol desaturase and sterol C24-reductase enzyme, and ERG5 and ERG6 inactivation and tHMG1 gene crossed expressed, obtained to synthesize the yeast of 7-DHC.Also by raising the truncated gene of HMG1, inactivation ERG5 and ERG6, and the sterol C-24 reductase enzyme in introducing vertebrates source have realized producing 7-DHC to the people such as Hohmann Hans-Peter of Holland in yeast, and this technology is open in China in 2012 years.
The appearance of synthetic biology is at synthetic staple product, produce clean energy, safeguard that aspects such as human health have all obtained the achievement that attracts people's attention, and cause great concern.Utilize the complex functionality module of synthesising biological technique construction 7-dehydrocholesterol, the relation of fine setting module and yeast saccharomyces cerevisiae chassis cell, realize the synthetic of 7-dehydrocholesterol, not only can remedy the defective of chemical method, and the green cleaning of production process has very big advantage and vast market prospect.
Summary of the invention
The purpose of this invention is to provide a kind of sterol C-24 reductase gene.
Second purpose of the present invention provides a kind of sterol C-24 reductase gene encoded protein matter.
The 3rd purpose of the present invention provides a kind of construction process of Wine brewing yeast strain of the production 7-dehydrocholesterol that comprises sterol C-24 reductase gene.
The 4th purpose of the present invention provides a kind of Wine brewing yeast strain of the 7-of production dehydrocholesterol.
Technical scheme of the present invention is summarized as follows:
A kind of sterol C-24 reductase gene, it is the described nucleotide sequence of sequence table SEQ ID NO:9.
Above-mentioned a kind of sterol C-24 reductase gene encoded protein matter, described protein is the described aminoacid sequence of sequence table SEQ ID NO:10.
A kind of construction process of Wine brewing yeast strain of the production 7-dehydrocholesterol that comprises sterol C-24 reductase gene comprises the steps:
(1) structure of carrier
The structure of carrier S yBE_000923:
1. yeast constitutive promoter, tHMGR gene, terminator application limitations restriction endonuclease method are stitched together, must arrive the fragment that two ends comprise Xho I and BamH I restriction enzyme site, be connected among integrating vector pRS403, pRS405, pRS304 or the pRS305;
2. yeast constitutive promoter, ERG1 gene, terminator application limitations restriction endonuclease method are stitched together, must arrive the fragment that two ends comprise Apa I and two sites of Sal I, be connected to the carrier that 1. step obtains, obtain carrier S yBE_000923;
Described tHMGR gene is the described nucleotide sequence of sequence table SEQ ID NO:3; Described ERG1 gene is the described nucleotide sequence of sequence table SEQ ID NO:7;
The structure of carrier S yBE_000937:
Adopt the restriction enzyme enzyme method to be stitched together sterol C-24 reductase gene shown in yeast constitutive promoter, the SEQ ID NO:9, terminator, must arrive the fragment that two ends comprise Hind III and BamH I site, connect among episomal vector pYES2, pRS423 or the pRS425, obtain carrier S yBE_000937;
(2) acquisition of yeast strain SyBE_000954
Be the upstream and downstream primer with sequence shown in SEQ ID NO:11, the SEQ ID NO:12, yeast selectable marker gene LEU is template, by the pcr amplification technology homology arm before and after the native gene ERG5 sequence is introduced the LEU gene, PCR product transformed saccharomyces cerevisiae bacterial strain YML008C or W303a obtain improved yeast strain SyBE_000954; The ERG6 gene list that described yeast strain YML008C is yeast saccharomyces cerevisiae BY4742 strikes bacterial strain;
Described LEU gene is the described nucleotide sequence of sequence table SEQ ID NO:13;
(3) described carrier S yBE_000923, SyBE_000937 are imported among the Saccharomyces Cerevisiae in S yBE_000954, obtain producing the Wine brewing yeast strain of 7-dehydrocholesterol.
The Wine brewing yeast strain that a kind of saccharomycetic construction process of producing the 7-dehydrocholesterol makes up.
Described yeast constitutive promoter is preferably TDH3p, PGK1p or TDH1p.
Described terminator is preferably PGK1t or CYC1t.
The present invention utilizes the synthesising biological technology to realize the synthetic of 7-dehydrocholesterol, not only can remedy the defective of chemical method, and the green cleaning of production process.
Description of drawings
Fig. 1 is that carrier S yBE_000923 (pRS403-tHMGR-ERG20) makes up collection of illustrative plates.
Fig. 2 is that carrier S yBE_000937 (pYES2-DHCR24) makes up collection of illustrative plates.
Fig. 3 is 7-dehydrocholesterol biosynthetic pathway in the yeast.
Fig. 4 measures gas chromatogram for tunning.
Fig. 5 is 7-dehydrocholesterol mass spectrum in the tunning.
Fig. 6 is 7-dehydrocholesterol standard substance gas chromatograms.
Fig. 7 is 7-dehydrocholesterol standard quality spectrogram.
Embodiment
Specify all respects of the present invention and feature by the following examples and by reference to the accompanying drawings.It should be appreciated by those skilled in the art that these embodiment just are used for explanation, and do not limit the scope of the invention.Under the condition that does not deviate from claims scope, those skilled in the art can carry out various modifications and improvement to various aspects of the present invention, and these modifications and improvement also belong to protection scope of the present invention.For example, employed promotor and expression vector among the embodiment are replaced with in this area other promotors and expression vector commonly used, be those of ordinary skill in the art can understand and realize.
In addition, unless it should be noted that and specialize, below among the embodiment used various materials and reagent all be material and reagent commonly used in this area, can obtain by conventional commercial sources; Method therefor is and well known to a person skilled in the art ordinary method, wherein:
Carrier pRS403, pRS405, pRS304, pRS305, pYES2, pRS423, pRS425, pSB1A2, pUC18 are all available from the biological product collecting center (ATCC) of USS.
All available from the biological product collecting center (ATCC) of USS, intestinal bacteria DH-5 α is available from Beijing Bo Maide company for bacterial strain yeast saccharomyces cerevisiae BY4742, YML008C, W303a.
Reagent fast pfu enzyme is available from U.S. Fermentas company, deaminize yeast nitrogen, Dropout mix available from Beijing ancient cooking vessel state biotechnology limited liability company, glucose, KOH are available from the north day medical chemistry chemical reagent work, agar powder is available from the rich biochemical reagents company limited of Tianjin English, methyl alcohol is available from Concord company, normal hexane is available from Tianjin Da Mao chemical reagent factory, and 7-dehydrocholesterol standard substance, derivatization reagent pyridine, MSTFA are available from Sigma company.
Embodiment 1: the acquisition of 7-dehydrocholesterol biosynthetic pathway genes involved in the yeast
The acquisition of A, tHMGR gene (yeast brachymemma HMG-CoA reductase gene)
According to yeast HMG-CoA reductase gene sequences Design primer, SEQ ID NO:1tHMGR-U:5 '-GGAATTCGCAGGCACGTCTAGAATGGACCAATTGGT-3 ' and SEQ ID NO:2tHMGR-D:5 '-GCGACTAGTGTTAGGATTTAATGCAGGTGACGG-3 ', be masterplate with yeast saccharomyces cerevisiae BY4742 strain gene group, use fast pfu enzyme carry out PCR (95 ℃, 2min; 95 ℃, 20s, 63 ℃, 30s, 72 ℃, 2min, 30cycles; 72 ℃, 5min; 4 ℃ ,+∞) amplification obtains the 1578bp fragment.Be cloned into the pSB1A2 carrier, check order, confirm not undergo mutation.1578bp nucleotide fragments sequence is with shown in the SEQ ID NO:3, and the aminoacid sequence that its coding obtains is shown in the SEQ ID NO:4.
The acquisition of B, ERG1 gene (yeast squalene cyclooxygenase gene)
According to yeast ERG1 gene order design primer, SEQ ID NO:5ERG1-U:5 '-GGAGCTCATAAGTCGTCTCGAGATGTCTGCTGTTAACGTTGCAC-3 ' and SEQ ID NO:6ERG1-D:5 '-GCCGCGTCGACCTTAACCAATCAACTCACCAAACA-3 ', be masterplate with yeast saccharomyces cerevisiae BY4742 strain gene group, use fast pfu enzyme carry out PCR (95 ℃, 2min; 95 ℃, 20s, 65 ℃, 30s, 72 ℃, 2min, 30cycles; 72 ℃, 5min; 4 ℃ ,+∞) amplification obtains the 1491bp fragment, is cloned into the pUC18 carrier, checks order, and confirms not undergo mutation.The 1491bp nucleotide sequence is used shown in the SEQ ID NO:7, the aminoacid sequence SEQ ID NO:8 that its coding obtains.
Acquisition and the optimization of C, sterol C-24 reductase gene
By codon optimized, make the codon of sterol C-24 reductase gene have the yeast preference, and suitably evade restriction enzyme site commonly used.The majorizing sequence that produces is: SEQ ID NO:9, the aminoacid sequence of sterol C-24 reductase gene coded protein is SEQ ID NO:10.
Embodiment 2: the structure of carrier
The structure of A, carrier S yBE_000923 (the HMG-CoA synthase gene of brachymemma and ERG1 expression carrier)
1. yeast constitutive promoter TDH3p, tHMGR gene, terminator PGK1t application limitations restriction endonuclease method are stitched together, must arrive the fragment that two ends comprise Xho I and BamH I restriction enzyme site, be connected to integrating vector pRS403;
2. yeast constitutive promoter PGK1p, ERG1 gene, terminator PGK1t application limitations restriction endonuclease method are stitched together, must arrive the fragment that two ends comprise Apa I and two sites of Sal I, be connected to the carrier that 1. step obtains, obtain carrier S yBE_000923, see Fig. 1;
Described tHMGR gene is the described nucleotide sequence of sequence table SEQ ID NO:3; Described ERG1 gene is the described nucleotide sequence of sequence table SEQ ID NO:7.
Experiment showed, that other can obtain intimate carrier with carrier S yBE_000923 with the present embodiment steps A with the carrier pRS403 in integrating vector pRS405, pRS304 or the alternative present embodiment steps A of pRS305.
The structure of B, carrier S yBE_000937 (optimizing back sterol C-24 reductase gene expression vector):
Adopt the restriction enzyme enzyme method to be stitched together sterol C-24 reductase gene (DHCR24) shown in promotor TDH3p, the SEQ ID NO:9, terminator PGK1t, must arrive the fragment that two ends comprise Hind III and BamH I site, connect into episomal vector pYES2, obtain carrier S yBE_000937, see Fig. 2.
Experiment showed, with episomal vector pRS423 or pRS425 to substitute carrier pYES2 among the present embodiment step B, other can obtain intimate carrier with carrier S yBE_000937 with present embodiment step B.
The evaluation of C, expression vector
The above-mentioned expression vector that builds is transformed into respectively among the intestinal bacteria DH-5 α, and the upgrading grain carries out the evaluation that single, double enzyme is cut and checked order, and connect into the plasmid corresponding position to guarantee the purpose fragment, and base sequence is not undergone mutation.
Embodiment 3: the acquisition of yeast strain SyBE_000954
According to yeast LEU gene order design primer, SEQ ID NO:11LEU-U:5 '-TGCTATTCCAATAGACAATAAATACCTTTTAACATTAAGCAAGGATTTTCTTAACT TC-3 ' and SEQ ID NO:12LEU-D:5 '-TATGATTTATTGTCTGGACAAAGTTCTGTTTTTCCCCAATGTCTGCCCCTAAGAAG AT-3 ', be masterplate with the yeast saccharomyces cerevisiae BY4742 strain gene group that comprises selectable marker gene LEU, use fast pfu enzyme carry out PCR (95 ℃, 2min; 95 ℃, 20s, 62 ℃, 30s, 72 ℃, 70s, 30cycles; 72 ℃, 5min; 4 ℃ ,+∞) amplification obtains 1095bp fragment (nucleotide sequence shown in the sequence table SEQ ID NO:13).The PCR product adopts Lithium Acetate method transformed saccharomyces cerevisiae bacterial strain YML008C, utilizes SD-drop solid medium (yeast nitrogen that deaminizes, 6.7g/l; Glucose, 20g/l; Dropout mix, 0.2%; Solid is added 2% agar powder) screen, the transformant that obtains is transferred to and cultivates 24h in the liquid nutrient medium, extracts yeast plasmid or genome as template, carries out the PCR checking with the special primer of LEU, to get rid of false-positive interference.Confirm correct positive strain, plate streaking or glycerol stock are preserved.Improved yeast strain called after SyBE_000954.
Experiment showed, with Wine brewing yeast strain W303a to substitute Wine brewing yeast strain YML008C, can obtain the function Wine brewing yeast strain similar to SyBE_000954.
Embodiment 4: the acquisition of producing the Wine brewing yeast strain of 7-dehydrocholesterol
Adopt the Lithium Acetate method to carry out the yeast conversion of carrier S yBE_000923, SyBE_000937.Wherein integrative plasmid carries out linearizing in advance, and to be integrated into the corresponding site of Saccharomyces Cerevisiae in S yBE_000954 genome, free type plasmid then directly is transformed among the Saccharomyces Cerevisiae in S yBE_000954.Transform the back yeast and adopt SD-drop solid medium (yeast nitrogen that deaminizes, 6.7g/l; Glucose, 20g/l; Dropout mix, 0.2%; Solid is added 2% agar powder) screen, the transformant that obtains is transferred to and cultivates 24h in the liquid nutrient medium, extracts yeast plasmid or genome as template, carries out the PCR checking, to get rid of false-positive interference.Confirm correct positive strain, plate streaking or glycerol stock are preserved.
The MVA approach that utilizes yeast self to exist, key gene HMG-CoA reductase gene (HMGR) and squalene oxidase gene (ERG1) that this approach is related to raise, introduce sterol C-24 reductase gene simultaneously, obtain the Wine brewing yeast strain (route map is seen Fig. 3) that possesses production 7-dehydrocholesterol function.
Embodiment 5: the extraction of yeast fermentation product
Verify that correct positive transformant is inoculated into 3ml SD-drop liquid seed culture medium (yeast nitrogen that deaminizes, 6.7g/l; Glucose, 20g/l; Dropout mix, 0.2%) in, the cultivation of going down to posterity of 30 ℃, 220rpm is transferred to 50ml SD-Drop fermention medium (yeast nitrogen that deaminizes, 6.7g/l when treating seed culture to the third generation; Glucose, 20g/l; Dropout mix, 0.2%) in, making fermentation initial OD 600 is 0.2.30 ℃, 220rpm take out fermented liquid after cultivating 72h, and centrifugal 2min under the 1000rpm abandons supernatant liquor and stays layer precipitation, wash 2 times repeatedly after collecting cell, with liquid nitrogen freezing and grind; Take by weighing 200mg and grind the 1.5M KOH that the back cell adds the methyl alcohol preparation, in 85 ℃ of Water Tanks with Temp.-controlled, carry out saponification reaction 90min; Add the 1ml normal hexane then, vortex oscillation mixes, and centrifugal 5min under the 1000rpm gets the supernatant liquor vacuum lyophilization, is kept in the 1ml centrifuge tube under-40 ℃ standby.Add 50 μ l pyridines in centrifuge tube, the 80 trimethyl silicon based trifluoroacetamides of μ l N-methyl-N-(MSTFA) carry out derivative reaction 30min in 30 ℃ of Water Tanks with Temp.-controlled.
Embodiment 6: the detection of yeast fermentation product
The GC-TOF/MS testing conditions of A, product
The product that extracts is carried out gas-chromatography-flight time mass spectrum (GC-TOF/MS) analyzing and testing.Analysis condition is as follows: instrument be Waters company GC-TOF/MS (Waters Corp., USA); The silica gel capillary post is 30m * 0.25mm * 0.25 μ m DB-5MS, J﹠amp; W Scientific, Folsom.The ionization mode is electron impact ionization EI+, beam energy 70eV, ionization electric current 40 μ A.The scanning of the mass spectrum scope is at 50～800m/z, and ion source temperature is 250 ℃, and injector temperature is 260 ℃, and helium (99.9995%) is operated under the 91KPa constant voltage mode as carrier gas.Column temperature keeps 2min at 70 ℃, rises to 250 ℃ with the speed of 30 ℃/min, and the speed with 10 ℃/min is raised to 280 ℃ then, keeps 15min at 280 ℃; Speed with 5 ℃/min is raised to 290 ℃ again, keeps 5min at 290 ℃.
The qualitative and quantitative of B, tunning
The tunning that extracts is carried out analyzing and testing under these conditions, obtain gas phase figure and mass spectrum and see Fig. 4 and Fig. 5.With 7-dehydrocholesterol standard substance configuration concentration gradient, use GC drawing standard curve, obtain gas phase figure and mass spectrum and see Fig. 6 and Fig. 7.Function stem fermentation back is extracted the sample that obtains and is measured, and calculates output by the matched curve formula, and function stem 7-dehydrocholesterol output is the 5.5mg/g dry cell weight.
Claims (6)
1. a sterol C-24 reductase gene is characterized in that it is the described nucleotide sequence of sequence table SEQ ID NO:9.
2. a kind of sterol C-24 reductase gene encoded protein matter of claim 1 is characterized in that described protein is the described aminoacid sequence of sequence table SEQ ID NO:10.
3. the construction process of the Wine brewing yeast strain of a production 7-dehydrocholesterol that comprises sterol C-24 reductase gene is characterized in that comprising the steps:
(1) structure of carrier
The structure of carrier S yBE_000923:
1. yeast constitutive promoter, tHMGR gene, terminator application limitations restriction endonuclease method are stitched together, must arrive the fragment that two ends comprise Xho I and BamH I restriction enzyme site, be connected among integrating vector pRS403, pRS405, pRS304 or the pRS305;
2. yeast constitutive promoter, ERG1 gene, terminator application limitations restriction endonuclease method are stitched together, must arrive the fragment that two ends comprise Apa I and two sites of Sal I, be connected to the carrier that 1. step obtains, obtain carrier S yBE_000923;
Described tHMGR gene is the described nucleotide sequence of sequence table SEQ ID NO:3; Described ERG1 gene is the described nucleotide sequence of sequence table SEQ ID NO:7;
The structure of carrier S yBE_000937:
Adopt the restriction enzyme enzyme method to be stitched together sterol C-24 reductase gene shown in yeast constitutive promoter, the SEQ ID NO:9, terminator, must arrive the fragment that two ends comprise Hind III and BamH I site, connect among episomal vector pYES2, pRS423 or the pRS425, obtain carrier S yBE_000937;
(2) acquisition of yeast strain SyBE_000954
Be the upstream and downstream primer with sequence shown in SEQ ID NO:11, the SEQ ID NO:12, yeast selectable marker gene LEU is template, by the pcr amplification technology homology arm before and after the native gene ERG5 sequence is introduced the LEU gene, PCR product transformed saccharomyces cerevisiae bacterial strain YML008C or W303a obtain improved yeast strain SyBE_000954; The ERG6 gene list that described yeast strain YML008C is yeast saccharomyces cerevisiae BY4742 strikes bacterial strain;
Described LEU gene is the described nucleotide sequence of sequence table SEQ ID NO:13;
(3) described carrier S yBE_000923, SyBE_000937 are imported among the Saccharomyces Cerevisiae in S yBE_000954, obtain producing the Wine brewing yeast strain of 7-dehydrocholesterol.
4. claim 3 a kind of produces the Wine brewing yeast strain that the saccharomycetic construction process of 7-dehydrocholesterol makes up.
5. a kind of saccharomycetic construction process of producing the 7-dehydrocholesterol according to claim 3 is characterized in that described yeast constitutive promoter is TDH3p, PGK1p or TDH1p.
6. a kind of saccharomycetic construction process of producing the 7-dehydrocholesterol according to claim 3 is characterized in that described terminator is PGK1t or CYC1t.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013102291543A CN103275997A (en) | 2013-06-08 | 2013-06-08 | Saccharomyces cerevisiae strain for producing 7-dehydrocholesterol and construction method |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013102291543A CN103275997A (en) | 2013-06-08 | 2013-06-08 | Saccharomyces cerevisiae strain for producing 7-dehydrocholesterol and construction method |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103275997A true CN103275997A (en) | 2013-09-04 |
Family
ID=49058616
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2013102291543A Pending CN103275997A (en) | 2013-06-08 | 2013-06-08 | Saccharomyces cerevisiae strain for producing 7-dehydrocholesterol and construction method |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103275997A (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106754993A (en) * | 2017-02-17 | 2017-05-31 | 天津大学 | A kind of gene, recombinant Saccharomyces cerevisiae bacterial strain and its construction method and application |
| CN111205993A (en) * | 2020-01-22 | 2020-05-29 | 天津大学 | Recombinant yeast for producing ursolic acid and oleanolic acid as well as construction method and application thereof |
| CN112813129A (en) * | 2021-02-05 | 2021-05-18 | 江南大学 | Method for increasing 7-dehydrocholesterol yield in yeast by compartmentalization |
| CN112877230A (en) * | 2021-03-11 | 2021-06-01 | 江南大学 | Yeast with improved vitamin D3 yield |
| CN113025512A (en) * | 2021-05-24 | 2021-06-25 | 西宝生物科技（上海）股份有限公司 | Construction method and application of saccharomyces cerevisiae capable of dynamically regulating 7-deoxycholesterol and vitamin D3 |
| CN113151027A (en) * | 2021-03-25 | 2021-07-23 | 天津大学 | Recombinant saccharomyces cerevisiae strain for producing 7-dehydrocholesterol and construction method thereof |
| CN116790393A (en) * | 2023-06-21 | 2023-09-22 | 江南大学 | Method for synthesizing active VD3 by modifying saccharomyces cerevisiae and taking glucose as substrate |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110151509A1 (en) * | 2002-01-29 | 2011-06-23 | Organobalance Gmbh | Preparation of 7-dehydrocholesterol and/or the biosynthetic intermediates and/or secondary products thereof in transgenic organisms |
| CN102639696A (en) * | 2009-12-03 | 2012-08-15 | 帝斯曼知识产权资产管理有限公司 | Production of non-yeast sterols by yeast |
-
2013
- 2013-06-08 CN CN2013102291543A patent/CN103275997A/en active Pending
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110151509A1 (en) * | 2002-01-29 | 2011-06-23 | Organobalance Gmbh | Preparation of 7-dehydrocholesterol and/or the biosynthetic intermediates and/or secondary products thereof in transgenic organisms |
| CN102639696A (en) * | 2009-12-03 | 2012-08-15 | 帝斯曼知识产权资产管理有限公司 | Production of non-yeast sterols by yeast |
Non-Patent Citations (1)
| Title |
|---|
| NCBI: "delta（24）-sterol reductase precursor[homo sapiens]", 《NCBI：NP_055577.1》, 17 April 2013 (2013-04-17) * |
Cited By (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106754993A (en) * | 2017-02-17 | 2017-05-31 | 天津大学 | A kind of gene, recombinant Saccharomyces cerevisiae bacterial strain and its construction method and application |
| CN106754993B (en) * | 2017-02-17 | 2020-06-30 | 天津大学 | Gene, recombinant saccharomyces cerevisiae strain and construction method and application thereof |
| CN111205993A (en) * | 2020-01-22 | 2020-05-29 | 天津大学 | Recombinant yeast for producing ursolic acid and oleanolic acid as well as construction method and application thereof |
| CN111205993B (en) * | 2020-01-22 | 2021-11-02 | 天津大学 | Recombinant yeast for producing ursolic acid and oleanolic acid as well as construction method and application thereof |
| CN112813129A (en) * | 2021-02-05 | 2021-05-18 | 江南大学 | Method for increasing 7-dehydrocholesterol yield in yeast by compartmentalization |
| CN112813129B (en) * | 2021-02-05 | 2023-09-08 | 江南大学 | Method for improving yield of 7-dehydrocholesterol in saccharomycetes by utilizing compartmentalization |
| CN112877230A (en) * | 2021-03-11 | 2021-06-01 | 江南大学 | Yeast with improved vitamin D3 yield |
| CN113151027A (en) * | 2021-03-25 | 2021-07-23 | 天津大学 | Recombinant saccharomyces cerevisiae strain for producing 7-dehydrocholesterol and construction method thereof |
| CN113025512A (en) * | 2021-05-24 | 2021-06-25 | 西宝生物科技（上海）股份有限公司 | Construction method and application of saccharomyces cerevisiae capable of dynamically regulating 7-deoxycholesterol and vitamin D3 |
| CN116790393A (en) * | 2023-06-21 | 2023-09-22 | 江南大学 | Method for synthesizing active VD3 by modifying saccharomyces cerevisiae and taking glucose as substrate |
| CN116790393B (en) * | 2023-06-21 | 2024-05-31 | 江南大学 | Method for synthesizing active VD3 by modifying saccharomyces cerevisiae and taking glucose as substrate |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103275997A (en) | Saccharomyces cerevisiae strain for producing 7-dehydrocholesterol and construction method | |
| Li et al. | Co-culture of Clostridium thermocellum and Clostridium thermosaccharolyticum for enhancing hydrogen production via thermophilic fermentation of cornstalk waste | |
| Yokoi et al. | Microbial hydrogen production from sweet potato starch residue | |
| Cheng et al. | Coproduction of hydrogen and methane via anaerobic fermentation of cornstalk waste in continuous stirred tank reactor integrated with up-flow anaerobic sludge bed | |
| CN112813129B (en) | Method for improving yield of 7-dehydrocholesterol in saccharomycetes by utilizing compartmentalization | |
| CN103725624B (en) | A kind of can degraded utilizes the gene recombination yeast saccharomyces cerevisiae of kitchen castoff | |
| Joe et al. | Microalgal lipid production using the hydrolysates of rice straw pretreated with gamma irradiation and alkali solution | |
| WO2023173565A1 (en) | Method for simultaneously enhancing and inhibiting multiple key genes during synthesis of 7-dehydrocholesterol in saccharomyces cerevisiae | |
| Zhu et al. | Production of diosgenin from Dioscorea zingiberensis tubers through enzymatic saccharification and microbial transformation | |
| CN103243066A (en) | Bacterial strain for producing lycopene and application of bacterial strain | |
| CN106754993A (en) | A kind of gene, recombinant Saccharomyces cerevisiae bacterial strain and its construction method and application | |
| CN105861341A (en) | Debaryomyces hansenii bacterial strain and method for preparing 3-hydroxypropionic acid by fermenting debaryomyces hansenii bacterial strain | |
| CN105420135A (en) | Recombined saccharomyces cerevisiae bacterial strain of high-yield monoterpene geraniol and application of recombined saccharomyces cerevisiae bacterial strain | |
| CN110982865A (en) | Application of alkaline cyclodextrin glucosyltransferase in production of α -glucosyl hesperidin | |
| CN108929884A (en) | The method for synthesizing ganoderic acid by synthetic biology means heterologous organisms | |
| CN111484962B (en) | Genetic engineering bacterium for efficiently producing 5 alpha-androstane dione and application thereof | |
| CN112175848A (en) | Patchouli alcohol production yeast strain and construction method and application thereof | |
| CN105177078A (en) | Preparation method of hydroxyectoine | |
| CN104805027A (en) | Recombinant yarrowia lipolytica bacterial strain as well as construction method and application thereof | |
| CN111484961A (en) | Gene engineering bacterium for producing 5 α -androstanedione and application thereof | |
| CN102839130B (en) | Bacterial strain for producing gliotoxin and method for producing gliotoxin by adopting bacterial strain | |
| CN103146728B (en) | Microzyme for producing taxadiene and construction method thereof | |
| Gao et al. | Efficient ethanol production from inulin by two-stage aerate strategy | |
| CN116042730A (en) | Method for producing fuel ethanol by bioconversion of corn fiber | |
| CN115161208A (en) | Saccharomyces cerevisiae gene engineering bacteria and application thereof in producing cucurbitacin intermediate |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20130904 |