CN103272233B - Application of MLL (mixed lineage leukemia) 1 antibody and expression inhibiter in preparing medicine for treating AML (acute myeloid leukemia) - Google Patents
Application of MLL (mixed lineage leukemia) 1 antibody and expression inhibiter in preparing medicine for treating AML (acute myeloid leukemia) Download PDFInfo
- Publication number
- CN103272233B CN103272233B CN201310238830.3A CN201310238830A CN103272233B CN 103272233 B CN103272233 B CN 103272233B CN 201310238830 A CN201310238830 A CN 201310238830A CN 103272233 B CN103272233 B CN 103272233B
- Authority
- CN
- China
- Prior art keywords
- mll1
- expression
- hoxa10
- cell
- aml
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Abstract
The invention discloses an application of an MLL1 antibody and an expression inhibiter in preparing a medicine for treating AML. Research results indicate that HOXA10 gene expression of an AML cell is regulated by MLL1 protein, MLL1-mediated HOXA10 expression change is a new prevention and treatment target of the AML, and HOXA10 expression can be reduced to treat the AML both through either application of MLL1 antibody processing to block MLL1 or MLL1 expression inhibition through the genetic engineering technology.
Description
Technical field
The invention belongs to medical technical field, relate to the medical usage of material.
Background technology
Acute leukemia is the Hematopoietic Malignancies of serious harm human health, accounts for the 6th of national each age group mortality of malignant tumors, accounts for child and 35 years old following crowd's mortality of malignant tumors the 1st.
Normal hematopoiesis process depends on the hematopoietic regulation factor at cell effectively activation and inactivation of different differential periods.Result of study shows, same to source capsule (HOX) gene is relevant with hematopoietic regulation.Hox gene family is the class gene of high conservative during evolution, be present in yeast to nearly all eukaryotic cell of the mankind, all contain the homology abnormal-shaped box of 1 approximately 180 nucleotide, can transcribe out approximately 60 amino acid whose homologous protein sections, its coded product is a class transcription factor.Recently studies have found that, HOXA10 gene orientation expression is in myelocyte, and in hematopoietic development process, has dual regulation effect, and it continued to express and contributes to maintain myelocytic high proliferation ability, stop myelocytic differentiation, finally cause acute myeloid leukaemia (AML).
Summary of the invention
In view of this, the object of the invention is to the expression and regulation mechanism in AML cell by research HOXA10, inquire into the probability of HOXA10 regulation and control as AML control novel targets, and then provide a kind of by the medicine of regulation and control HOXA10 expression treatment AML.
Structural analysis to HOXA10 promoter region shows, HOXA10 promoter region comprises 2 estrogen response elements (ERE): ERE1 and ERE2, and ERE is in the position of HOXA10 promoter region near transcriptional start site, and the expression of prompting HOXA10 may be relevant to the activation of estrogen receptor (ER).Separately there is bibliographical information, HOXA10 promoter CpG island is hypomethylation or methylation state not in AML patient, cause HOXA10 gene to continue expression, and HOXA10 promoter CpG island is methylation state in normal person, cause the low expression of HOXA10 gene or do not express, the expression of prompting HOXA10 may be to be methylated and modified regulation and control by its promoter CpG island.MLL(mixed lineage leukemia) albumen has the function of histone H 3 K4 specific methylation transferring enzyme (HMT), can methylate by specificity regulation and control histone H 3 K4, and methylating of H3K4 can cause Gene Promoter CpG Island hypomethylation.Document also reports, MLL protein family is as the auxiliary regulatory factor regulation and control estradiol (E of ER
2) mediation E
2the activation of sensitive gene.
For this reason, the present invention is first with the E of variable concentrations
2at different time point stimulation AML cell line HL-60, do reference with inirritative HL-60 cell, application RT-PCR and Western blot detect the difference of HOXA10 activity of gene expression, with clear and definite E
2the activation that HOXA10 is expressed, and at E
2under stimulation, knock out respectively ER α, ER β and MLLs(MLL1-4 with Antisense OligodeoxynucleotideTransfection Transfection technology) after detect again the variation of HOXA10mRNA and protein expression, determine that the activation of any ER is relevant with the expression of HOXA10, any MLL expresses and has regulating and controlling effect HOXA10; Then adopt chromatin co-immunoprecipitation (ChIP) experiment to detect E
2the interaction of ERE1 and ERE2 in stimulation front and back MLL and HOXA10 promoter, then detect E by Western-blot
2before and after stimulating, whether histone H 3 K4 methylation state passes through the expression of epigenetics approach regulation and control HOXA10 with clear and definite MLL; Finally use MLL1 antibody treatment AML cell, observe its impact on AML cell.Result shows: at E
250nmol/L6h stimulates lower HOXA10 to express obviously rising, after ER α and ER β Antisense OligodeoxynucleotideTransfection Transfection, HOXA10 expresses all decline, when MLL1 expression silencing, HOXA10 expresses obviously and reduces, MLL1 can be incorporated into ERE region in HOXA10 promoter and histone H 3 K4 methylation state at E
2after stimulation, before stimulation, use MLL1 antibody treatment blocking-up MLL1 to cause HOXA10 to express to AML cell and decline and cause AML apoptosis.Draw thus to draw a conclusion: the HOXA10 gene expression of AML cell is subject to MLL1 protein regulation, the change that the HOXA10 of MLL1 mediation expresses is the control novel targets of AML, application MLL1 antibody blocking MLL1 or all can reach the object that reduces HOXA10 and express and then treat AML by the expression that technique for gene engineering suppresses MLL1.
Thus, the present invention proposes following technical scheme:
The application of 1.MLL1 antibody in the medicine of preparation treatment AML.
The application of 2.MLL1 expression inhibitor in the medicine of preparation treatment AML.
Further, described MLL1 expression inhibitor is MLL1 antisense oligonucleotide.
Further, described MLL1 Antisensedigonucleotsequence sequence is as shown in SEQ ID No.5.
Beneficial effect of the present invention is: the invention provides MLL1 antibody and the MLL1 expression inhibitor new purposes in pharmaceutical field, improve the self-value of MLL1 antibody and MLL1 expression inhibitor, expand its range of application, for the treatment of AML provides new drug candidate, and provide a new direction for further investigation and the exploitation of AML medicine.
Accompanying drawing explanation
In order to make the object, technical solutions and advantages of the present invention clearer, below in conjunction with accompanying drawing, the present invention is described in further detail, wherein:
Fig. 1 is RT-PCR(A) and Western blot(B) HL-60 cell detected at variable concentrations E
2the expression of different time points HOXA10mRNA and albumen after stimulating.M:DL2000 standard; 1: non-stimulated contrast; 2-6: represent respectively 50nmol/L E
2stimulate 4h, 6h, 8h, 12h, 24h; 7-12: represent respectively 100nmol/L E
2stimulate 4h, 6h, 8h, 12h, 24h.A: compare P<0.01 with non-stimulated contrast; B: compare P<0.05 with non-stimulated contrast.
Fig. 2 is RT-PCR(A) with Western blot(B) detect HL-60 and THP-1 cell and knock out respectively the expression of HOXA10mRNA and albumen after ER α and ER β.M:DL2000 standard; 1-5: represent respectively HL-60 cell transfecting Scramble antisense contrast, HL-60+ER α, HL-60+ER α+E
2, HL-60+ER β, HL-60+ER β+E
2; 6-10: represent respectively THP-1 cell transfecting Scramble antisense contrast, THP-1+ER α, THP-1+ER α+E
2, THP-1+ER β, THP-1+ER β+E
2; Wherein+ER α represents to have knocked out ER α; + ER β represents to have knocked out ER β.B: contrast and compare P<0.05 with transfection Scramble antisense.
Fig. 3 is RT-PCR(A) with Western blot(B) detect HL-60 and THP-1 cell and knock out respectively the expression of HOXA10mRNA and albumen after MLL1, MLL2, MLL3 and MLL4.M:DL2000 standard; 1-6: represent that respectively HL-60 cell is without transfection negative control, HL-60 cell transfecting Scramble antisense contrast, HL-60+MLL1, HL-60+MLL2, HL-60+MLL3, HL-60+MLL4; 7-12: represent that respectively THP-1 cell is without transfection negative control, THP-1 cell transfecting Scramble antisense contrast, THP-1+MLL1, THP-1+MLL2, THP-1+MLL3, THP-1+MLL4; Wherein+MLL1～4 represent to have knocked out respectively MLL1～4.A: contrast and compare P<0.01 with transfection Scramble antisense; B: contrast and compare P<0.05 with transfection Scramble antisense.
Fig. 4 is that Western blot detects E
2stimulate the impact on histone H 3 K4 methylation state.1-2: represent that respectively HL-60 cell has E
2stimulating group and without E
2stimulating group; 3-4 represents that respectively THP-1 cell has E
2stimulating group and without E
2stimulating group.
Fig. 5 is that ChIP detects E
2the combination of ERE in MLL1 and HOXA10 promoter before and after stimulating.M:DL1000 standard; 1-4: represent respectively THP-1 cell E
2combination, the E of MLL1 and ERE1 before stimulating
2combination, the E of MLL1 and ERE1 after stimulating
2combination, the E of MLL1 and ERE2 before stimulating
2the combination of MLL1 and ERE2 after stimulating; 5-8: represent respectively HL-60 cell E
2combination, the E of MLL1 and ERE1 before stimulating
2combination, the E of MLL1 and ERE1 after stimulating
2combination, the E of MLL1 and ERE2 before stimulating
2the combination of MLL1 and ERE2 after stimulating.
Fig. 6 is the apoptosis rate of Flow cytometry HL-60 cell after variable concentrations MLL1 antibody treatment.1: non-processor contrast; 2-5: represent respectively 50 μ g/L, 100 μ g/L, 200 μ g/L, 400 μ g/L MLL1 antibody treatment; Left figure is apoptosis district, and right figure is full figure.
The specific embodiment
Hereinafter with reference to accompanying drawing, the preferred embodiments of the present invention are described in detail.
1 materials and methods
1.1 leukaemias cultivate and E
2stimulate
HL-60 cell and THP-1 cell (ATCC) cultural method are shown in document (Cindy Yen Okitsu and Chih-Lin Hsieh.DNA Methylation Dictates Histone H3K4Methylation.Mol.Cell.Biol.2007 (27): 2746-2757), with the E of 50nmol/L and 100nmol/L
2(Sigma) irritation cell respectively, and 0,4,6,8,12, the time point harvesting of 24h.
The extraction of 1.2RNA and RT-PCR detect
RNA extracting method is shown in document (Cindy Yen Okitsu and Chih-Lin Hsieh.DNA Methylation Dictates Histone H3K4Methylation.Mol.Cell.Biol.2007 (27): 2746-2757).The each PCR reaction primer of HOXA10 and Antisensedigonucleotsequence sequence are in table 1.
The each PCR reaction primer of table 1HOXA10 and Antisensedigonucleotsequence sequence
| Primer | Sequence (5 ' > 3 ') |
| RT-HOXA10-F | CCCTACACGAAGCACCAGACACT（SEQ?ID?No.1） |
| RT-HOXA10-R | GCGTCGCCTGGAGATTCATC（SEQ?ID?No.2） |
| β-Actin-F | AAGGCCAACCGCGAGAAGAT（SEQ?ID?No.3） |
| β-Actin-R | TCGGTGAGGATCTTCATGAG（SEQ?ID?No.4） |
| MLL1antisense | TGCCAGTCGTTCCTCTCCAC（SEQ?ID?No.5） |
| MLL2antisense | ACTCTGCCACTTCCCGCTCA（SEQ?ID?No.6） |
| MLL3antisense | CCATCTGTTCCTTCCACTCCC（SEQ?ID?No.7） |
| MLL4antisense | CCTTCTCTTCTCCCTCCTTGT（SEQ?ID?No.8） |
| ERαantisense | CATGGTCATGGTCAG（SEQ?ID?No.9） |
| ERβantisense | GAATGTCATAGCTGA（SEQ?ID?No.10） |
| Scramble?antisense | CGTTTGTCCCTCCAGCATCT（SEQ?ID?No.11） |
1.3 Antisense OligodeoxynucleotideTransfection Transfection
Carry out transfection in strict accordance with LipofectamineTM 20009 reagent (Invitrogen) description, within first 1 day, adjusting cell density with the RPMI 1640 containing 100mL/L hyclone of antibiotic-free in transfection is 1 × 10
6/ mL, is inoculated in 12 orifice plates, 1000 μ L/ holes, and transfection was changed to 500 μ L antibiotic-free serum-free RPMI1640 the same day, getting fluorescently-labeled antisense oligonucleotide chain 1.0 μ g is added in 50 μ L RPMI 1640 and mixes, separately getting LipofectamineTM 20002 μ L is added in 50 μ L RPMI 1640 and mixes, room temperature is placed after 5min, the RPMI 1640 that is mixed with respectively antisense oligonucleotide chain and LipofectamineTM 2000 is mixed to (antisense oligonucleotide chain and liposome ratio are 1.0 μ g: 2 μ L), room temperature is placed after 20min, said mixture is added in aforementioned 12 orifice plates, mix gently, after cultivating 6h, culture medium is changed to the RPMI1640 of 500 μ L containing 100mL/L hyclone, harvesting after continuation cultivation 24h.
1.4Western?blot
Cell is after each factor is processed, and collecting cell, adds protein lysate RIPA90 μ L/ hole, leaves standstill after 30min on ice, and 4 ℃, the centrifugal 30min of 12000r/min, get supernatant, with BCA method mensuration total protein concentration.Each sample is got 60 μ g albumen, electrophoresis in 12%SDS-PAGE gel, after finishing, electrophoresis turns pvdf membrane, respectively with HOXA10 antibody (dilution factor 1:200), GAPDH antibody (dilution factor 1:200), hatch, then with corresponding two anti-hatching, last applied chemistry luminescence reagent detects the content of each albumen.
1.5ChIP
Operate in strict accordance with ChIP test kit (Thermo) description: the first step: in vivo that DBP and DNA is crosslinked with formaldehyde; Second step: separate chromosome (matter), the DNA small fragment after shearing is combined with DBP; The 3rd step: be combined with DBP by specific antibody, separate complex by the sedimentation method, oppositely crosslinked operation discharges DNA digesting protein, carries out pcr amplification take the DNA that obtains as template.
2 results
2.1 at variable concentrations E
2hOXA10mRNA and the protein expression analysis of different time points after stimulating
Detect HL-60 cell at variable concentrations (50,100nmol/L) E with RT-PCR and Western blot
2the variation of different time points (0,4,6,8,12,24h) HOXA10mRNA expression activity after stimulating.As shown in Figure 1, HL-60 cell is at 50nmol/L E for result
26h and 8h stimulate the more non-stimulated matched group of expression of lower HOXA10 obviously to raise, at 100nmol/ L E
26h and 8h stimulate the expression of lower HOXA10 to be significantly improved equally.
2.2 Antisense OligodeoxynucleotideTransfection Transfection technology knock out respectively HOXA10mRNA and protein expression analysis after ER α and ER β
Detect after HL-60 and THP-1 cell knock out respectively ER α and ER β with Antisense OligodeoxynucleotideTransfection Transfection technology and having E with RT-PCR and Western blot
2stimulate and without E
2the variation of HOXA10mRNA expression activity in stimulation situation.As shown in Figure 2, HL-60 and THP-1 cell are knocking out E after ER α and ER β to result
2the HOXA10 of stimulating group expresses all and obviously declines, and shows E
2can be simultaneously and ER α and ER β in conjunction with and cause the expression rising of HOXA10.
2.3 Antisense OligodeoxynucleotideTransfection Transfection technology knock out respectively HOXA10mRNA and protein expression analysis after MLL1, MLL2, MLL3 and MLL4
Detect HL-60 and THP-1 cell and knock out respectively the variation of HOXA10mRNA expression activity after MLL1, MLL2, MLL3 and MLL4 with RT-PCR and Western blot.As shown in Figure 3, knocking out of MLL1 causes HOXA10 to express obviously decline to result, shows that MLL1 has regulating and controlling effect to the expression of HOXA10.
The interaction of ERE in 2.4MLL1 albumen and HOXA10 promoter
There iing E with ChIP detection HL-60 and THP-1 cell
2stimulate and without E
2the combination of ERE1 and ERE2 in MLL1 albumen and HOXA10 promoter in stimulation situation.Result as shown in Figure 4, E
2in stimulating group MLL1 albumen and HOXA10 promoter, the combination of ERE1 and ERE2 is all apparently higher than without E
2stimulating group, shows that the ER activation that estrogen relies on has recruitment effect to MLL1 albumen, promotes MLL1 protein binding on the ERE1 and ERE2 of HOXA10 promoter.
The fractional analysis of 2.5H3K4 histone methyl
Be Western blot with the antibody that methylates of H3K4, detecting HL-60 and THP-1 cell is having E
2stimulate and without E
2histone methylated state in stimulation situation.As shown in Figure 5, the histone methylated degree of the H3K4 of E2 stimulating group is apparently higher than without E for result
2stimulating group, shows that MLL1 may be the ERE1 by being attached to HOXA10 promoter and ERE2 goes up and cause the methylated approach of histone H 3 K4 to regulate and control the expression of HOXA10.
The apoptosis rate analysis of AML cell after 2.6 variable concentrations MLL1 antibody treatment
Apoptosis rate with Flow cytometry HL-60 cell after variable concentrations (50,100,200,400 μ g/L) MLL1 antibody treatment.Result as shown in Figure 6, causes HL-60 apoptosis after using MLL1 antibody treatment blocking-up MLL1 and HOXA10 to express, and apoptosis rate becomes positive correlation with the concentration for the treatment of of MLL1 antibody, shows that MLL1 antibody can be for the preparation of the medicine for the treatment of AML.
Finally explanation is, above embodiment is only unrestricted in order to technical scheme of the present invention to be described, although by with reference to above-described embodiment, invention has been described, but those of ordinary skill in the art is to be understood that, can make various changes to it in the form and details, and not depart from the spirit and scope of the present invention that appended claims limits.
Claims (1)
- The application of 1.MLL1 expression inhibitor in the medicine of preparation treatment acute myeloid leukaemia, described MLL1 expression inhibitor is the MLL1 antisense oligonucleotide of sequence as shown in SEQ ID No.5.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310238830.3A CN103272233B (en) | 2013-06-14 | 2013-06-14 | Application of MLL (mixed lineage leukemia) 1 antibody and expression inhibiter in preparing medicine for treating AML (acute myeloid leukemia) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310238830.3A CN103272233B (en) | 2013-06-14 | 2013-06-14 | Application of MLL (mixed lineage leukemia) 1 antibody and expression inhibiter in preparing medicine for treating AML (acute myeloid leukemia) |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103272233A CN103272233A (en) | 2013-09-04 |
| CN103272233B true CN103272233B (en) | 2014-06-18 |
Family
ID=49054852
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310238830.3A Expired - Fee Related CN103272233B (en) | 2013-06-14 | 2013-06-14 | Application of MLL (mixed lineage leukemia) 1 antibody and expression inhibiter in preparing medicine for treating AML (acute myeloid leukemia) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103272233B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105985434A (en) * | 2015-03-03 | 2016-10-05 | 南京鼓楼医院 | Phosphorylated HOXA10 monoclonal antibody and preparation and application thereof |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103189067A (en) * | 2010-06-16 | 2013-07-03 | 密执安大学评议会 | Inhibition of WDR5 interaction with its binding partners and therapeutic methods |
-
2013
- 2013-06-14 CN CN201310238830.3A patent/CN103272233B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103189067A (en) * | 2010-06-16 | 2013-07-03 | 密执安大学评议会 | Inhibition of WDR5 interaction with its binding partners and therapeutic methods |
Non-Patent Citations (2)
| Title |
|---|
| HOXA10 is a critical regulator for hermatopoietic stem cells and erythroid/megakaryocyte development;Magnusson M et al;《Blood》;20071231;第109卷(第9期);全文 * |
| Magnusson M et al.HOXA10 is a critical regulator for hermatopoietic stem cells and erythroid/megakaryocyte development.《Blood》.2007,第109卷(第9期),全文. |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103272233A (en) | 2013-09-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Zhou et al. | MicroRNA-340 suppresses osteosarcoma tumor growth and metastasis by directly targeting ROCK1 | |
| Pickard et al. | Regulation of apoptosis by long non-coding RNA GAS5 in breast cancer cells: implications for chemotherapy | |
| Zhu et al. | Long non-coding RNA ANRIL is up-regulated in bladder cancer and regulates bladder cancer cell proliferation and apoptosis through the intrinsic pathway | |
| Yang et al. | A lentiviral sponge for miRNA-21 diminishes aerobic glycolysis in bladder cancer T24 cells via the PTEN/PI3K/AKT/mTOR axis | |
| Wang et al. | BRAF‑activated long non‑coding RNA contributes to cell proliferation and activates autophagy in papillary thyroid carcinoma | |
| Qu et al. | MicroRNA-33b inhibits lung adenocarcinoma cell growth, invasion, and epithelial-mesenchymal transition by suppressing Wnt/β-catenin/ZEB1 signaling | |
| Lee et al. | SIRT2 ameliorates lipopolysaccharide-induced inflammation in macrophages | |
| Ma et al. | Silencing miR-21 sensitizes non-small cell lung cancer A549 cells to ionizing radiation through inhibition of PI3K/Akt | |
| Jiang et al. | TPX2 regulates tumor growth in human cervical carcinoma cells | |
| Zhang et al. | 17β-estradiol up-regulates miR-155 expression and reduces TP53INP1 expression in MCF-7 breast cancer cells | |
| Zhou et al. | microRNA-372 maintains oncogene characteristics by targeting TNFAIP1 and affects NFκB signaling in human gastric carcinoma cells | |
| Kim et al. | Anti-oncogenic activities of cyclin D1b siRNA on human bladder cancer cells via induction of apoptosis and suppression of cancer cell stemness and invasiveness | |
| Zhao et al. | miR-223 enhances the sensitivity of non-small cell lung cancer cells to erlotinib by targeting the insulin-like growth factor-1 receptor | |
| Liang et al. | MicroRNA-433 inhibits cervical cancer progression by directly targeting metadherin to regulate the AKT and β-catenin signalling pathways | |
| Xiao et al. | MicroRNA‑566 modulates vascular endothelial growth factor by targeting Von Hippel‑Landau in human glioblastoma in vitro and in vivo | |
| Liu et al. | miR-451: potential role as tumor suppressor of human hepatoma cell growth and invasion | |
| Wu et al. | Knockdown of lncRNA MIAT inhibits proliferation and cisplatin resistance in non‑small cell lung cancer cells by increasing miR‑184 expression | |
| Huang et al. | Krüppel-like factor 9 inhibits glioma cell proliferation and tumorigenicity via downregulation of miR-21 | |
| Zhang et al. | MicroRNA‑137 suppresses tumor growth in epithelial ovarian cancer in vitro and in vivo | |
| Wang et al. | MicroRNA‑21 increases cell viability and suppresses cellular apoptosis in non‑small cell lung cancer by regulating the PI3K/Akt signaling pathway Retraction in/10.3892/mmr. 2020.11758 | |
| Gao et al. | miR‑202 acts as a potential tumor suppressor in breast cancer | |
| Feng et al. | Lentiviral expression of anti-microRNAs targeting miR-27a inhibits proliferation and invasiveness of U87 glioma cells | |
| Cheng et al. | miRNA‑375 regulates the cell survival and apoptosis of human non‑small cell carcinoma by targeting HER2 | |
| Chen et al. | A regulatory circuitry comprising TP53, miR-29 family, and SETDB1 in non-small cell lung cancer | |
| Wang et al. | Downregulation of miR-377 contributes to IRX3 deregulation in hepatocellular carcinoma |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140618 Termination date: 20180614 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |