CN103255111A - Green fluorescent protein marked recombinant swine fever virus, its rescue method and application - Google Patents
Green fluorescent protein marked recombinant swine fever virus, its rescue method and application Download PDFInfo
- Publication number
- CN103255111A CN103255111A CN201310069486XA CN201310069486A CN103255111A CN 103255111 A CN103255111 A CN 103255111A CN 201310069486X A CN201310069486X A CN 201310069486XA CN 201310069486 A CN201310069486 A CN 201310069486A CN 103255111 A CN103255111 A CN 103255111A
- Authority
- CN
- China
- Prior art keywords
- green fluorescent
- fluorescent protein
- swine fever
- virus
- egfp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The invention discloses a green fluorescent protein marked recombinant swine fever virus, its rescue method and application. According to the invention, green fluorescent protein encoding gene is inserted between the 13th and the 14th amino acid of a classical swine fever virus infectious clone Npro protein coding region. By transfection into PK-15 cells and passage, the visual green fluorescent protein marked recombinant swine fever virus is rescued. The growth characteristics of the recombinant swine fever virus are same as that of its parental virus. After infection of PK-15 cells, the virus is directly visible by the use of fluorescence microscope. According to the modified neutralization test method (EGFP-NT) established by the recombinant swine fever virus, the existence of classical swine fever virus can be observed and the titer of neutralizing antibody in serum to be tested can be determined directly by the use of fluorescence microscope with no additional immunofluorescence test step. The method has the same specificity and sensitivity as the traditional neutralization immunofluorescence assay, but is more convenient and efficient, and can replace the neutralization immunofluorescence assay method for the use of serological test and epidemiological investigation of swine fever.
Description
Technical field
The present invention relates to the Pestivirus suis of recombinating, relate in particular to reorganization Pestivirus suis and the rescue method thereof of green fluorescent protein mark, the invention further relates to this application of green fluorescent protein mark reorganization Pestivirus suis in diagnosis swine fever or detection by quantitative serum swine fever NAT, belong to diagnosis or the detection range of Pestivirus suis.
Background technology
Swine fever (classical swine fever, CSF) be by Pestivirus suis (classical swine fever virus, CSFV) pig that causes a kind of with Gao Re and hemorrhage be the height contagious disease of feature, the popular of swine fever can cause heavy economic losses in worldwide.CSFV and bovine viral diarrhea virus (bovine viral diarrhea virus1, BVDV-1), BVDV-2, border disease virus (border disease virus, BDV) belong to flaviviridae pestivirus member (Moser C, Stettler P, Tratschin JD, et al.Cytopathogenic and noncytopathogenic RNA replicons of classical swine fever virus.J.Virol.1999,73:7787-7794.).The CSFV genome is wire sub-thread positive chain RNA, is about 12.3kb, contain a big open reading frame (open reading frame, ORF), about 3900 amino acid whose polyproteins of encoding.Polyprotein is processed to form 4 kinds of structural protein (C, E under virus and the effect of host cell proteins enzyme
Rns, E1 and E2) and 7 kinds of Nonstructural Protein (N
Pro, p7, NS2-3, NS4A, NS4B, NS5A and NS5B) (Moser C, Stettler P, Tratschin JD, et al.Cytopathogenic and noncytopathogenic RNA replicons of classical swine fever virus.J.Virol.1999,73:7787-7794.).
The CSFV reverse genetic learns a skill and was set up as far back as 1996, utilize infectious RNA transfection SK-6 or the PK-15 cell of in-vitro transcription to produce infectious virus (Meyers G, Thiel HJ, R ü menapf T.Classical swine fever virus:recovery of infectious viruses from cDNA constructs and generation of recombinant cytopathogenic defective interfering particles.J.Virol.1996,70:1588-1595.), afterwards with SK-6 or the PK-15 clone of full-length infectious clone's transfection expression t7 rna polymerase of CSFV, utilize the mode of transcribing in the cell to improve the reverse genetic technology of CSFV (van Gennip HG, van Rijn PA, Widjojoatmodjo MN, et al.Recovery of infectious classical swine fever virus (CSFV) from full-length genomic cDNA clones by a swine kidney cell line expressing bacteriophage T7RNA polymerase.J.Virol.Methods1999,78:117-128.).Recently, the inventor uses cytomegalovirus (cytomegalovirus, CMV) the full-length infectious clone's transfection PK-15 cell of the CSFV under the promotor control, utilize intracellular RNA polymerase II to start transcribing of infections clone, CSFV is saved in success, make more convenient (the Li C of reverse genetic technology of CSFV, Huang JH, Li YF, et al.Efficient and stable rescue of classical swine fever virus from cloned cDNA using an RNA polymerase II system.Arch.Virol.2012, doi:10.1007/s00705-012-1548-8).The mark CSFV that expresses the bacterium E.C. 2.3.1.28 once was used to quantitative examination (the Moser C of Pestivirus suis, Tratschin JD, Hofmann MA.A recombinant classical swine fever virus stably expresses a marker gene.J.Virol.1998,72:5318-5322.).Bibliographical information porcine reproductive and respiratory syndrome virus (porcine reproductive and respiratory syndrome virus, PRRSV) etc. the virus of multiple green fluorescent protein mark is successfully made up (Fang Y, Rowland RRR, Roof M, et al.A full-length cDNA infectious clone of North American type1porcine reproductive and respiratory syndrome virus:expression of green fluorescent protein in the Nsp2region.J.Virol.2006,80:11447-11455; Fang Y, Christopher-Hennings J, Brown E, et al.Development of genetic markers in the nonstructural protein2region of a US type1porcine reproductive and respiratory syndrome virus:implications for future recombinant marker vaccine development.J.Gen.Virol.2008,89:3086-3096; Kim DY, Calvert JG, Chang KO, et al.Expression and stability of foreign tags inserted into nsp2of porcine reproductive and respiratory syndrome virus (PRRSV) .Virus Res.2007,128:106-114.).
In order to control and eradicate swine fever, serosurvey is essential means.Enzyme linked immunosorbent assay (enzyme – linked immunosorbent assay, ELISA), in and immunofluorescent test (neutralization immunofluorescence test, NIFT) and in and the peroxidase joint-trial test that (neutralization peroxidase-linked assay NPLA) is the method for hog cholera antibody in the detection serum of using always.Multiple ELISA diagnostic method has been set up and wherein several commercializations, as IDEXX CSFV Antibody Test Kit and IDEXX CSF Sero Ab ELISA.Particularly IDEXX CSFV Antibody Test Kit is widely used in the serosurvey of vaccine evaluation and swine fever as a kind of reliable Serum Antibody Detection method.But because the cross reaction of hog cholera antibody and other pestivirus (BVDV and BDV) antibody has limited the specificity of ELISA diagnostic method, ELISA detects positive or suspicious serum sample often need further be verified by NIFT or NPLA.
Do not cause cytopathy behind the swine fever virus infection, NIFT commonly used measures the serum neutralizing antibody, NIFT Chang Zuowei serosurvey and the gold standard of setting up new serological diagnostic method.NPLA and NIFT are the reliable responsive instruments of swine fever diagnosis, and utilize a plurality of NPLA to carry out differential diagnosis to Pestivirus suis antibody, BVDV and BDV antibody.Yet after virus culture 72h, NIFT and NPLA often need a plurality of steps: cell fixing, the hatching of antibody, repeatedly washing continues 2-3h at least, usually time-consuming, require great effort.In addition, antibody costliness, antibody labeling cost are higher, have much room for improvement.If the EGFP gene is introduced the genome of CSFV and realized stably express, the detection of CSFV will be expected to realize visual, detect step and also can effectively simplify.
Summary of the invention
One of purpose of the present invention provides the reorganization Pestivirus suis of a strain green fluorescent protein mark;
Two of purpose of the present invention provides a kind of method that makes up the reorganization Pestivirus suis of described green fluorescent protein mark;
Three of purpose of the present invention is the reagent that the reorganization Pestivirus suis of described green fluorescent protein mark is applied to prepare diagnosis or detection Pestivirus suis or detection by quantitative swine fever NAT.
Above-mentioned purpose of the present invention is achieved through the following technical solutions:
Bibliographical information is arranged, bacterium E.C. 2.3.1.28 (CAT) is inserted Pestivirus suis N
ProCan obtain labeled virus between albumen the 4th amino acids and the 5th amino acids, and marker gene can stably express (Moser C, Tratschin JD, Hofmann MA.A recombinant classical swine fever virus stably expresses a marker gene.J.Virol.1998,72:5318-5322.).The inventor introduces Pestivirus suis N with the EGFP gene
ProBetween protein gene the 4th amino acids and the 5th amino acids, can only obtain transient expression, but fail to obtain the sudden change Pestivirus suis of the stable EGFP genetic marker that goes down to posterity.The inventor is surprised to find that by a large amount of experiments, and the EGFP gene is introduced swine fever virus infection sex clone N
ProBetween protein-coding region the 13rd amino acids and the 14th amino acids, the mutant Pestivirus suis that obtains can be stablized the also expression alien gene that goes down to posterity, thereby has finished the present invention.
The present invention at first provides the reorganization Pestivirus suis (EGFP-CSFV) of green fluorescent protein mark, comprising: Pestivirus suis and green fluorescent protein encoding gene; Wherein, the green fluorescent protein encoding gene is inserted into swine fever virus infection sex clone N
ProBetween the 13rd of protein-coding region and the 14th amino acids.
Mechanism's preservation that the present invention submits to patent to approve the reorganization Pestivirus suis (EGFP-CSFV) of the green fluorescent protein mark of rescue, its microbial preservation is numbered: CGMCC NO.7219; The preservation time is: on February 1st, 2013; The classification called after of this reorganization Pestivirus suis: the reorganization Pestivirus suis of expressing green fluorescent protein; Depositary institution: Chinese microbial preservation management committee common micro-organisms center; Preservation address: No. 3, No. 1 institute in North Star West Road, Chaoyang District, BeiJing, China, Institute of Microorganism, Academia Sinica.
Another object of the present invention provides a kind of method of saving the reorganization Pestivirus suis (EGFP-CSFV) of described green fluorescent protein mark, may further comprise the steps:
(1) green fluorescent protein (EGFP) encoding gene is inserted into Pestivirus suis N
ProBetween the 13rd of protein-coding region and the 14th amino acids, obtain to carry the full-length infectious cloned plasmids of green fluorescent protein encoding gene; (2) will carry the full-length infectious cloned plasmids direct transfection PK-15 cell of green fluorescent protein encoding gene, rescue obtains the reorganization Pestivirus suis of green fluorescent protein mark.
When breeding, Pestivirus suis generally do not cause cytopathy in permissive cell.Generally speaking, in order to save Pestivirus suis, cells transfected need continue to pass the three generations, is called " blind passage ", detects existence and the titre of virus then by immunological method.The present invention has realized visual to the rescue process of EGFP-CSFV virus, can be by the generation of fluorescent microscope Real Time Observation virus and the variation of virus quantity.Bibliographical information is arranged, EGFP is introduced the NSP2 gene of PRRSV, mutant virus instability (the Kim DY that produces, Calvert JG, Chang KO, et al.Expression and stability of foreign tags inserted into nsp2of porcine reproductive and respiratory syndrome virus (PRRSV) .Virus Res.2007,128:106-114.).Yet the present invention introduces EGFP in the CSFV Npro protein gene (between Npro albumen 13 amino acids and 14 amino acids), has obtained stable mutant virus.Npro albumen has function (the R ü menapf T that suppresses Interferon, rabbit generation and oneself's cutting, Stark R, Heimann M, et al.N-terminal protease of pestiviruses:identification of putative catalytic residues by site-directed mutagenesis.J.Virol.1998,72:2544-2547; Stark R, Meyers G, R ü menapf T, et al.Processing of pestivirus polyprotein:cleavage site between autoprotease and nucleocapsid protein of classical swine fever virus.J.Virol.1993,67:7088-7095; Wiskerchen M, Belzer SK, Collett MS.Pestivirus gene expression:the first protein product of the bovine viral diarrhea virus large open reading frame, p20, possesses proteolytic activity.J.Virol.1991,65:4508-4514.), and result of the present invention shows that the insertion of EGFP does not influence copying of virus.In addition, N
ProBe Nonstructural Protein, existence or generation that but can indicator virus may be because Pestivirus suis produces a polyprotein earlier by analysis, produce 4 kinds of structural protein and 7 kinds of Nonstructural Proteins then under the effect of virus or host protein enzyme.Among the present invention, utilize the EGFP fluorescence of fluorescent microscope direct viewing EGFP-CSFV identical with the virus titer of IFA method mensuration; EGFP-CSFV with the present invention's rescue replaces the neutralization test method (being EGFP-NT) of swine fever parental virus foundation can directly detect hog cholera antibody in the serum, can measure the serum neutralization rapidly and accurately and tire.
The IDEXX hog cholera antibody ELISA is the blocking-up ELISA that sets up in conjunction with envelope antigen by the swine fever virus resistant E2 albumen neutralizing monoclonal antibody of peroxidase labelling and the competition of the neutralizing antibody in the serum.According to existing report, NPLA detects serum with the standard of NAT 〉=25 as the judgement positive.Although the serum that EGFP-NT and NIFT and IDEXX hog cholera antibody ELISA detect has very high coincidence rate, but detect suspicious sample for the IDEXX hog cholera antibody ELISA and be neutralized test test positive or feminine gender, the susceptibility that shows neutralization test is higher than ELISA, consistent (Blome S, the Meindl-of reports such as this result and Blome
A, Loeffen W, et al.Assessment of classical swine fever diagnostics and vaccine performance.Rev.Sci.Tech.2006,25:1025-1038.).In the quantitative analysis of NAT, EGFP-NT and NIFT coincidence rate can arrive 93.8%.So, the neutralization test detection method of setting up with the reorganization Pestivirus suis (EGFP-CSFV) of the green fluorescent protein mark of the present invention rescue (EGFP-NT) can substitute NIFT, save the step behind the virus culture 72h, simplified traditional NIFT detection method greatly.
Polyinfection usually takes place in the terrain swinery, as the polyinfection of CSFV and PCV2, TGEV and PRV, CSFV and PrV, CSFV, PrV and swine streptococcus.Experimental result of the present invention shows that CSFV can not be neutralized by other viral antibody, and the detection of the hog cholera antibody of EGFP-NT is high special.The NPLA method is commonly used to verify serum and differential diagnosis CSFV antibody and other artiodactyl pestivirus antibody of ELISA test positive.With the reorganization Pestivirus suis (EGFP-CSFV) of the green fluorescent protein mark of the present invention rescue set up in and detection method (EGFP-NT) can use the fluorescent microscope direct viewing, the result judges convenience.Behind virus culture 72h, compare with NIFT with NPLA, EGFP-NT does not need the additional experiments step, directly detects the existence of CSFV under fluorescent microscope, thereby determines tiring of neutralizing antibody fast.
Mixture is caught blocking-up ELISA(complex – trapping-blocking ELISA, and CTB-ELISA) the serum antibody blocking-up rate of Ce Dinging changes bigger in NAT＜100 of NPLA mensuration o'clock; When in and antibody titer 100 the time, the blocking-up rate is stabilized in higher level.The present invention analyzes with hog cholera immune and 144 parts of dependencys to serum blocking-up rate and NAT of serum of attacking poison, and the result shows, the hog cholera antibody blocking-up rate of porcine blood serum to be checked and in it with the being proportionate property of logarithm of antibody titer.Experimental result shows, the neutralization test detection method of setting up with the reorganization Pestivirus suis (EGFP-CSFV) of the green fluorescent protein mark of the present invention's rescue (EGFP-NT) is to detect the reliable method of serum neutralizing antibody, and time saving and energy saving.
In a word, the present invention introduces Pestivirus suis N with green fluorescent protein (EGFP) encoding gene
ProBetween the 13rd of protein-coding region and the 14th amino acids, by transfection, go down to posterity, rescue obtains the reorganization Pestivirus suis of green fluorescent protein mark, (indirect immunofluorescence assay IFA) detects the reorganization Pestivirus suis EGFP-CSFV that confirms visual green fluorescent protein mark with IDEXX swine fever antigen ELISA and successfully constructs by direct viewing EGFP fluorescence, indirect immunofluorescence assay.Directly visual by fluorescent microscope behind this recombinant virus-infected cell, and its growth characteristics are consistent with parental virus.The neutralization test detection method of setting up with the reorganization Pestivirus suis of green fluorescent protein mark of the present invention (EGFP-NT) can directly be determined existence and definite serum NAT of Pestivirus suis with fluorescence microscope, the operation steps that does not need immunofluorescence, at least reduce 2h than NIFT, it is more convenient to detect, and can obtain the result consistent with NIFT, and can keep the advantage of traditional NT high specific and hypersensitivity, therefore alternative traditional NIFT becomes the more convenient detection method for swine fever serosurvey and epidemiology survey.
Description of drawings
The visual observation of the reorganization Pestivirus suis EGFP-CSFV of Fig. 1 green fluorescent protein mark; A: fluorescence microscope; B: the transmission microscopy light field is observed.
Fluorescent microscope direct viewing and the immunofluorescent test detected result of the reorganization Pestivirus suis EGFP-CSFV of Fig. 2 green fluorescent protein mark.
The stability analysis of Fig. 3 EGFP gene in the reorganization Pestivirus suis EGFP-CSFV of green fluorescent protein mark genome.
The one step growth analysis of the reorganization Pestivirus suis EGFP-CSFV of Fig. 4 green fluorescent protein mark.
Fig. 5 EGFP-NT detects the relation of NAT and IDEXX hog cholera antibody ELISA detection serum blocking-up rate.
Embodiment
Further describe the present invention below in conjunction with specific embodiment, advantage of the present invention and characteristics will be more clear along with description.But these embodiment only are exemplary, scope of the present invention are not constituted any restriction.It will be understood by those skilled in the art that and down can make amendment or replace the details of technical solution of the present invention and form without departing from the spirit and scope of the present invention, but these modifications and replacing all fall within the scope of protection of the present invention.
1 experiment material
1.1 cell and virus
The strong arsenic bloom door of PK-15 cell and Pestivirus suis strain (Shimen, hereinafter referred to as wt-CSFV) by preserving in inventor laboratory, respectively with Dulbecco ' the s Modified Eagles Medium(DMEM that contains 8% foetal calf serum and 2% foetal calf serum (no BVDV and mycoplasma)) be incubated at 37 ℃, 5%CO2 incubator.
1.2 serum
Serum sample is attacked experiment pig (the Sun Y of poison subsequently with the strain of the strong arsenic bloom door of swine fever through adenovirus/Alphavirus replicon chimeric vector swine Fever Vaccine or hog cholera lapinised virus strain immunity from this laboratory, Tian DY, Li S, et al.Comprehensive evaluation of the adenovirus/alphavirus-replicon chimeric vector-based vaccine rAdV-SFV-E2against classical swine fever.Vaccine2013,31:538-544; Sun Y, Liu DF, Wang YF, et al.Generation and efficacy evaluation of a recombinant adenovirus expressing the E2protein of classical swine fever virus.Res.Vet.Sci.2010,88:77-82.); Terrain porcine blood serum to be checked, comprise porcine pseudorabies virus (pseudorabies virus, PrV) the two positive serums of positive serum, porcine reproductive and respiratory syndrome virus (PRRSV) positive serum, PrV and CSFV, PRRSV and the two positive serums of CSFV, preserve by inventor laboratory, transmissible gastro-enteritis virus (porcine transmissible gastroenteritis virus, TGEV) presented by Feng Li researcher by positive serum.
The structure of the reorganization Pestivirus suis (EGFP-CSFV) of embodiment 1 green fluorescent protein mark
1.1 the structure of full-length infectious cloned plasmids pEGFP-CSFV
With the full-length infectious clone of CSFV crossdrift strain pBRCISM(Li C, Huang JH, Li YF, et al.Efficient and stable rescue of classical swine fever virus from cloned cDNA using an RNA polymerase II system.Arch.Virol.2012 doi:10.1007/s00705-012-1548-548) is the full-length infectious cloned plasmids pEGFP-CSFV of fundamental construction.The EGFP gene is inserted into Pestivirus suis N by merging round pcr
ProThe 13rd and the 14th amino acids between, the primer is as follows:
N
pro-412eGFP-1S:CACCTCGAGATGCTATGTGG(SEQ ID No.1)；
N
pro-412eGFP-1R:CTCGCCCTTGCTCACCATGTTTGTTTTGTATAAAAGTTC(SEQ ID No.2)；
N
pro-412eGFP-2S:AACTTTTATACAAAACAAACATGGTGAGCAAGGGCGAGGAG(SEQ ID No.3)；
N
pro-412eGFP-2R:CCCATTGGTTTTTGTTTCTTGTACAGCTCGTCCATG(SEQID No.4)；
N
pro-412eGFP-3S:GACGAGCTGTACAAGAAACAAAAACCAATGGGAGTG(SEQ ID No.5)；
N
pro-412eGFP-3R:AACTCTAGAGGGGCCCTATGG（SEQ ID No.6）。
The PCR product is cloned into pBRCISM-5 ' (Li C by restriction enzyme XhoI and XbaI, Huang JH, Li YF, et al.Efficient and stable rescue of classical swine fever virus from cloned cDNA using an RNA polymerase II system.Arch.Virol.2012), form pBRCISM-5 ' EGFP.SalI and the BamHI fragment of pBRCISM-5 ' EGFP are inserted among the pBRCISM-3 ', obtained full-length infectious cloned plasmids pEGFP-CSFV.
1.2 rescue and the evaluation of the reorganization Pestivirus suis (EGFP-CSFV) of green fluorescent protein mark
The PK-15 cell that the plasmid pEGFP-CSFV2 μ g transfection of purifying is covered with individual layer carries out three passages (once going down to posterity in per 2 days) afterwards to the 4th generation (F4) (can directly carry out the Real Time Observation that virus produces with fluorescent microscope at any time in the cell cultivation process), and virus is once gathered in the crops in freeze thawing.Extract viral RNA according to RNeasy Mini Kit specification sheets, handling the back reverse transcription with DNase I is cDNA, as template pcr amplification EGFP and NS5B gene, with fluorescence quantitative PCR detection virogene copy number.Whether there is sudden change by sequence verification PCR product.With E2 monoclonal antibody specific 6E10(Peng WP, Hou Q, Xia ZH, et al.Identification of a conserved linear B-cell epitope at the N-terminus of the E2glycoprotein of Classical swine fever virus by phage-displayed random peptide library.Virus Res.2008,135:267-272.) carry out IFA and detect, confirm the expression of EGFP-CSFV E2 albumen, detect EGFP-CSFV E with IDEXX swine fever antigen detection kit simultaneously
RnsThe expression of albumen.
Observe under the fluorescent microscope and find that F1 and F2 are for only seeing a few fluorescigenic cell, F3 is for visible several fluorescigenic cell masses, be covered with fluorophore (Fig. 1) to F4 for whole bottle cell, show the reorganization Pestivirus suis (EGFP-CSFV) that obtains the green fluorescent protein mark.
Detect EGFP-CSFV F4 for the OD of virus with IDEXX swine fever antigen detection kit
450Value is 1.168, positive control 0.703, negative control 0.085, sample〉0.385 be judged to the positive, so IDEXX swine fever antigen detected result is judged to the positive.IFA detects EGFP-CSFV antigen and hog cholera antibody 6E10 specific reaction, and the result is consistent with parental virus.The cell that direct viewing EGFP-CSFV infects, its fluorescence is more special, and the fluorescence of comparing IFA does not have any background (Fig. 2).RNA with fluorescence quantitative PCR detection EGFP-CSFV can reach every microlitre 6.82 * 10
6Copy number is by RT-PCR can successfully increase Pestivirus suis NS5B gene and EGFP gene.
The stability analysis experiment of experimental example 2EGFP gene in reorganization Pestivirus suis (EGFP-CSFV) genome of green fluorescent protein mark
Reorganization Pestivirus suis (EGFP-CSFV) F4 of the green fluorescent protein mark that embodiment 1 is saved is for continuing passage to F8 generation, per generation virus reach and observe EGFP fluorescence before of future generation.Results F4, F5, F6, F7, F8 detect virus antigen for viral liquid with IDEXX swine fever antigen test kit, extract viral RNA simultaneously, detect whether stable existence of EGFP gene with RT-PCR.The viral liquid of each generation is inoculated in the PK-15 cell that 96 well culture plates are cultivated, observes the EGFP specific fluorescence behind the 48h earlier, use cold dehydrated alcohol fixed cell afterwards, carry out the IFA detection with the anti-mouse two of swine fever monoclonal antibody and TRITC or FITC mark is anti-.
The cell that EGFP-CSFV infects is from the F4 F8 that goes down to posterity, and every Dai Jun can be observed fluorescence.Detect F4-F8 virus with IDEXX swine fever antigen detection kit, per generation virus all be positive; IFA detects the visible specificity fluorescent group of F4-F8 virus; Can from the EGFP-CSFV viral RNA, amplify the EGFP gene specifically by RT-PCR, but from the parental virus gene, not increase to EGFP gene (Fig. 3).These results show: EGFP-CSFV can continue to go down to posterity, the EGFP gene also can stable existence in the genome of Pestivirus suis and can correctly express.
The one step growth of the reorganization Pestivirus suis (EGFP-CSFV) of experimental example 3 green fluorescent protein marks is measured
The reorganization Pestivirus suis EGFP-CSFV of the green fluorescent protein mark that embodiment 1 is saved and parental virus wt-CSFV are the PK-15 cell that 1 dose inoculation grows to individual layer with infection multiplicity (MOI), 2h is made in sense, keep liquid, 37 ℃ of cultivations with PBS washing back adding.After infection 24,36,48,60 and 72h results virus, viral liquid is done continuous 10 times of dilutions respectively, be inoculated in the PK-15 cell that grows to individual layer respectively, change 2% behind the infection 2h and keep liquid, direct viewing EGFP fluorescence behind the 48h detects with IFA afterwards, uses the Reed-Muench method and calculates its TCID
50, draw viral growth curves.
Measurement result shows that the EGFP-CSFV that embodiment 1 saves has similar growth characteristics to parental virus, and 72h after infection, virus titer all can reach 10
6.5TCID
50/ mL(Fig. 4), this explanation EGFP inserts Pestivirus suis N
ProThe 13rd and the 14th amino acids between do not influence the growth of Pestivirus suis.In addition, it is consistent directly observing the titre of the EGFP-CSFV of EGFP and IFA mensuration, shows that visual Pestivirus suis EGFP-CSFV can substitute parental virus and directly determine its virus titer.
Experimental example 4 is based on the contrast experiment of neutralization test (EGFP-NT) Yu the traditional neutralization test (NIFT) of EGFP-CSFV
With experiment immunization or attack 88 parts of hog cholera antibody negative serums and 30 parts of (totally 118 parts) (IDEXX hog cholera antibody detection kit are determined antibody blocking rate≤30%) of terrain negative serum of poison, experiment immunization or attack the poison 74 parts and 22 parts terrain positive serums of hog cholera antibody positive serum (totally 96 parts) (IDEXX hog cholera antibody detection kit is determined antibody blocking rate 〉=40%), carry out EGFP-NT and NIFT simultaneously respectively.
Detect preceding with 56 ℃ of deactivation 30min of serum sample to be checked.Neutralization test is carried out at 96 orifice plates.Serum sample is pressed 1:4,1:8,1:16,1:32,1:64,1:128,1:256,1:512 dilution, with 100TCID
50(EGFP-CSFV or wt-CSFV) mixes, and hatches 1h for 37 ℃ then.Serum-virus mixture is added in the 96 orifice plate cells of individual layer, cultivate 1h, and then cultivate 72h.For EGFP-CSFV, directly (Nikon TE200 Japan) observes virus, and definite serum neutralization is tired then under fluorescent microscope.For wt-CSFV, cell washing 3 times is then with the fixing 20min of cold dehydrated alcohol, after fixing cell is air-dry, hatch 1h for HQ0637 ℃ with the E2 monoclonal antibody, wash 3 times, use the fluorescently-labeled sheep anti-mouse igg of FITC (Sigma – Aldrich, St.Louis then, USA) hatch 45min for 37 ℃, after washing 3 times with PBS, cover cell with 90% glycerol, under fluorescent microscope, observe.Serum neutralization tire with in and the dilution expression reciprocal of highest serum of 50% viral growth.Each neutralization test is all established the contrast of positive and negative serum, and neutralization test finishes the back virus titer is carried out repetition measurement.
The qualitative analysis: the neutralization test detection method EGFP-NT that sets up with the reorganization Pestivirus suis (EGFP-CSFV) of the green fluorescent protein mark of the present invention rescue and traditional NIFT detect in 118 parts of negative serums negative entirely, NAT＜25; 96 parts of 89 parts of positive serum detections are positive, wherein 71 parts of serum NATs are between 40-512,18 parts of NATs〉512,7 parts of positive serum of IDEXX hog cholera antibody test kit detection are neutralized test and detect negative, EGFP-NT and NIFT coincidence rate are 100% (214/214), with IDEXX hog cholera antibody detection kit coincidence rate be 96.7%(207/214) (table 1).
88 parts of negative serums of quantitative analysis results: EGFP-NT and NIFT detection wherein have 87 parts of identical NAT, and 65 parts have identical NAT in 74 parts of positive serums of detection, and coincidence rate is 93.8%(152/162).The NAT coincidence rate that EGFP-NT and NIFT detect terrain serum is 96.2%(50/52) (table 2).This experiment is analyzed separately the suspicious specimen of 11 parts of antibody blocking rate 30%-40%, wherein 9 parts positive, 2 parts are negative.
Above result shows: the neutralization test detection method EGFP-NT that sets up with the reorganization Pestivirus suis (EGFP-CSFV) of the green fluorescent protein mark of the present invention rescue and traditional NIFT be basically identical as a result, and the two is all more responsive than ELISA.
Many kinds of serum diagnosis methods of table 1 detect the coincidence rate analysis of swine fever specific antibody
Table 2EGFP-NT and NIFT detect the analysis of NAT coincidence rate
Annotate: the positive: NAT 〉=25; Negative: NAT＜25.
The specificity analyses experiment of experimental example 5EGFP-NT
Get the two positive serums of PrV positive serum, PRRSV positive serum, PrV and CSFV, PRRSV and the two positive serums of CSFV, each 3 parts of the two positive serums of TGEV and CSFV with the parallel detection with NIFT of EGFP-NT, calculate the two coincidence rate.
Each 3 parts of PrV antibody positive serum and PRRSV antibody positive serum, detect through EGFP-NT and NIFT, tire all＜4, and 3 parts of CSFV and PrV antibody positive serum, NAT〉512,3 parts of CSFV and PRRSV antibody positive serum NAT be respectively 96,128,256.3 parts of CSFV and TGEV antibody positive serum, swine fever specific antibody titres is 384,512,512.The result shows, the neutralization test detection method EGFP-NT that sets up with the reorganization Pestivirus suis (EGFP-CSFV) of the green fluorescent protein mark of the present invention's rescue and the specificity consistent (table 3) of traditional NIFT.
Table 3EGFP-NT and NIFT detect the comparison of swine fever neutralizing antibody in the different porcine blood serum
Experimental example 6EGFP-NT detects the relation of NAT and IDEXX hog cholera antibody ELISA detection serum blocking-up rate
144 parts of swine Fever Vaccine immunity are attacked NAT and the antibody blocking rate of malicious porcine blood serum correspondence and carry out correlation analysis, the result shows, the hog cholera antibody blocking-up rate of porcine blood serum to be checked with in it with the logarithm (LnND of antibody titer
50) being proportionate property (Fig. 5).
＜110〉Harbin Veterinary Medicine Inst., China Academy of Agriculture
＜120〉the reorganization Pestivirus suis of green fluorescent protein mark and rescue methods and applications thereof
<130> DQXL_0028
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 20
<212> DNA
<213> artifical sequence
<400> 1
cacctcgaga tgctatgtgg 20
<210> 2
<211> 39
<212> DNA
<213> artifical sequence
<400> 2
ctcgcccttg ctcaccatgt ttgttttgta taaaagttc 39
<210> 3
<211> 41
<212> DNA
<213> artifical sequence
<400> 3
aacttttata caaaacaaac atggtgagca agggcgagga g 41
<210> 4
<211> 36
<212> DNA
<213> artifical sequence
<400> 4
cccattggtt tttgtttctt gtacagctcg tccatg 36
<210> 5
<211> 36
<212> DNA
<213> artifical sequence
<400> 5
gacgagctgt acaagaaaca aaaaccaatg ggagtg 36
<210> 6
<211> 21
<212> DNA
<213> artifical sequence
<400> 6
aactctagag gggccctatg g 21
Claims (7)
1. the reorganization Pestivirus suis of a green fluorescent protein mark is characterized in that: comprise Pestivirus suis and green fluorescent protein encoding gene.
2. according to the reorganization Pestivirus suis of the described green fluorescent protein mark of claim 1, it is characterized in that: the green fluorescent protein encoding gene is inserted into swine fever virus infection sex clone N
ProBetween the 13rd of protein-coding region and the 14th amino acids.
3. according to the reorganization Pestivirus suis of claim 1 or 2 described green fluorescent protein marks, it is characterized in that: its microbial preservation is numbered: CGMCC NO.7219.
4. method of saving the reorganization Pestivirus suis of any one described green fluorescent protein mark of claim 1-3 may further comprise the steps:
(1) the green fluorescent protein encoding gene is inserted into Pestivirus suis N
ProBetween the 13rd of protein-coding region and the 14th amino acids, obtain to carry the full-length infectious cloned plasmids of green fluorescent protein encoding gene;
(2) will carry the full-length infectious cloned plasmids transfection PK-15 cell of green fluorescent protein encoding gene, the reorganization Pestivirus suis of saving out the green fluorescent protein mark.
5. it is characterized in that in accordance with the method for claim 4: the full-length infectious cloned plasmids direct transfection PK-15 cell that will carry the green fluorescent protein encoding gene.
6. the purposes of the reorganization Pestivirus suis of the described green fluorescent protein mark of claim 1-3 in the reagent of preparation diagnosis swine fever.
7. the purposes of the reorganization Pestivirus suis of the described green fluorescent protein mark of claim 1-3 in the reagent of preparation detection by quantitative swine fever NAT.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310069486.XA CN103255111B (en) | 2013-03-05 | 2013-03-05 | Green fluorescent protein marked recombinant swine fever virus, its rescue method and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310069486.XA CN103255111B (en) | 2013-03-05 | 2013-03-05 | Green fluorescent protein marked recombinant swine fever virus, its rescue method and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103255111A true CN103255111A (en) | 2013-08-21 |
| CN103255111B CN103255111B (en) | 2015-02-11 |
Family
ID=48959327
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310069486.XA Active CN103255111B (en) | 2013-03-05 | 2013-03-05 | Green fluorescent protein marked recombinant swine fever virus, its rescue method and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103255111B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104017779A (en) * | 2014-06-09 | 2014-09-03 | 中国农业科学院哈尔滨兽医研究所 | Recombinant hog cholera virus for expressing firefly luciferase gene and application of recombinant hog cholera virus |
| CN105861453A (en) * | 2016-04-01 | 2016-08-17 | 中国农业科学院哈尔滨兽医研究所 | Marked Pestivirus suis C strain expressing enhanced green fluorescent protein and construction method and application thereof |
| CN113917139A (en) * | 2021-10-18 | 2022-01-11 | 扬州大学 | Detection method of serum 4 type avian adenovirus neutralizing antibody based on recombinant fluorescent virus |
| CN113999822A (en) * | 2021-12-30 | 2022-02-01 | 北京赛尔富森生物科技有限公司 | Recombinant virus and application thereof in mumps virus neutralizing antibody detection |
-
2013
- 2013-03-05 CN CN201310069486.XA patent/CN103255111B/en active Active
Non-Patent Citations (3)
| Title |
|---|
| EFFICIENT AND STABLE RESCUE OF CLASSICAL SWINE FEVER VIRUS FROM: "Efficient and stable rescue of classical swine fever virus from cloned cDNA using an RNA polymerase II system", 《EFFICIENT AND STABLE RESCUE OF CLASSICAL SWINE FEVER VIRUS FROM CLONED CDNA USING AN RNA POLYMERASE II SYSTEM》 * |
| NICOLAS RUGGLI, ET AL.: "Npro of classical swine fever virus is an antagonist of double-stranded RNA-mediated apoptosis and IFN-a/h induction", 《VIROLOGY》 * |
| 刘大飞,等: "反向遗传学技术在猪瘟病毒研究中的应用", 《生物工程学报》 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104017779A (en) * | 2014-06-09 | 2014-09-03 | 中国农业科学院哈尔滨兽医研究所 | Recombinant hog cholera virus for expressing firefly luciferase gene and application of recombinant hog cholera virus |
| CN105861453A (en) * | 2016-04-01 | 2016-08-17 | 中国农业科学院哈尔滨兽医研究所 | Marked Pestivirus suis C strain expressing enhanced green fluorescent protein and construction method and application thereof |
| CN113917139A (en) * | 2021-10-18 | 2022-01-11 | 扬州大学 | Detection method of serum 4 type avian adenovirus neutralizing antibody based on recombinant fluorescent virus |
| CN113999822A (en) * | 2021-12-30 | 2022-02-01 | 北京赛尔富森生物科技有限公司 | Recombinant virus and application thereof in mumps virus neutralizing antibody detection |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103255111B (en) | 2015-02-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Graff et al. | Mutations within potential glycosylation sites in the capsid protein of hepatitis E virus prevent the formation of infectious virus particles | |
| CN102317449B (en) | Recombinant classical swine fever virus (CSFV) comprising a modified E2 protein and methods for generating said recombinant CSFV | |
| CN103760365B (en) | A kind of BAS-ELISA kit detecting CSFV Erns and E2 antigen | |
| CN105331636A (en) | Recombination cell line for stable expression of classical swine fever virus E2 and application thereof | |
| CN103751774A (en) | Recombinant cell line for stably expressing classical swine fever virus E2 protein, and applications of the same in preparation of subunit vaccines and diagnosis reagents of classical swine fever | |
| CN102614507B (en) | Type O foot-and-mouth disease virus molecular marker vaccine and preparation method thereof | |
| Lin et al. | Yeast expressed classical swine fever E2 subunit vaccine candidate provides complete protection against lethal challenge infection and prevents horizontal virus transmission | |
| Aebischer et al. | Two newly developed Erns-based ELISAs allow the differentiation of Classical Swine Fever virus-infected from marker-vaccinated animals and the discrimination of pestivirus antibodies | |
| Tignon et al. | Classical swine fever: comparison of oronasal immunisation with CP7E2alf marker and C-strain vaccines in domestic pigs | |
| Córdoba et al. | Three amino acid mutations (F51L, T59A, and S390L) in the capsid protein of the hepatitis E virus collectively contribute to virus attenuation | |
| CN103751773A (en) | Recombinant BHK cell line for stably expressing classical swine fever virus E0-E1-E2 protein, and applications of the same in preparation of vaccines and diagnosis reagents of classical swine fever | |
| CN103338785B (en) | Bvdv vaccine | |
| CN103255111B (en) | Green fluorescent protein marked recombinant swine fever virus, its rescue method and application | |
| CN105440132A (en) | Monoclonal antibody against porcine epidemic diarrhea virus N protein and application thereof | |
| Lin et al. | Yeast-expressed classical swine fever virus glycoprotein E2 induces a protective immune response | |
| Sakoda et al. | Development and evaluation of indirect enzyme-linked immunosorbent assay for a screening test to detect antibodies against classical swine fever virus | |
| CN107723281B (en) | Recombinant hog cholera lapinized virus vaccine strain for expressing porcine circovirus type 2 Cap protein and application thereof | |
| Han et al. | Development of a marker vaccine candidate against classical swine fever based on the live attenuated vaccine C-strain | |
| Holinka et al. | Development of a live attenuated antigenic marker classical swine fever vaccine | |
| Wehrle et al. | Chimeric pestiviruses: candidates for live-attenuated classical swine fever marker vaccines | |
| US8133495B2 (en) | Live attenuated antigenically marked classical swine fever virus | |
| CN102183644A (en) | Indirect capripox antibody enzyme-linked immuno sorbent assay (ELISA) diagnostic kit and preparation method | |
| CN113174407A (en) | Screening method for stably expressing CSFV complete structural protein CHO-K1 cell line | |
| Yi et al. | Construction and efficacy of a new live chimeric C-strain vaccine with DIVA characteristics against classical swine fever | |
| CN116218912A (en) | ELISA kit for diagnosing APPV antibody by using mammalian cell line for stably expressing APPV E2 protein |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |