CN103251951A - Application of P2X2 receptor agonist or opening agent in preparation of anti-depression or anti-anxiety drugs - Google Patents
Application of P2X2 receptor agonist or opening agent in preparation of anti-depression or anti-anxiety drugs Download PDFInfo
- Publication number
- CN103251951A CN103251951A CN2013100166905A CN201310016690A CN103251951A CN 103251951 A CN103251951 A CN 103251951A CN 2013100166905 A CN2013100166905 A CN 2013100166905A CN 201310016690 A CN201310016690 A CN 201310016690A CN 103251951 A CN103251951 A CN 103251951A
- Authority
- CN
- China
- Prior art keywords
- receptor
- atp
- depression
- mice
- agonist
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Abstract
The invention discloses an application of a P2X2 receptor agonist or a P2X2 receptor opening agent in preparation of anti-depression or anti-anxiety drugs. According to the present invention, experiment research results confirm that: the P2X2 receptor agonist or the P2X2 receptor opening agent has an anti-depression and/or anti-anxiety effect, such that the P2X2 receptor agonist or the P2X2 receptor opening agent can be used for preparing anti-depression or anti-anxiety drugs, and can be adopted to screen prevention and treatment target points of anti-depression and/or anti-anxiety drugs and screen early stage pre-warning and clinical diagnostic reagents of depression and/or anxiety so as to provide broad application prospects.
Description
Technical field:
The invention belongs to field of medical biotechnology, be specifically related to the agonist of P2X2 receptor or open agent in preparation antidepressant and/or anxiolytic drugs application and the P2X2 receptor in the application as the target spot of screening prevention and treatment depression and/or anti anxiety agent thing.
Background technology:
The depression serious harm human life with healthy.Depression (Depression) refer to depressed, retardation of thinking and with interest lower, the sluggish symptom of degradation psychomotor activity serve as a class mood disorders syndrome that mainly shows under the initiative.Sickness rate is very high, and is about 15～17%, and is the trend that rises year by year in recent years especially; Estimate that according to World Health Organization (WHO) to the year two thousand twenty, depression will become the first place reason that disables, and be the 21 century mankind's main killer (Murray, 1997).Depression has originally caused huge burden per capita to society, family and patient, and serious harm human life with healthy.Therefore, the control of depression is a great public health problem.
The treatment of depression faces severe challenge.The treatment of depression mainly relies on Drug therapy; Though a lot of effectively antidepressants have been arranged at present clinically, but still can not satisfy the demand for the treatment of.Particularly existing antidepressants ubiquity serious problem: 1, onset is slow, and the 3-6 that generally takes medicine could improve clinical symptoms after week, more need take medicine for a long time and will cure; Generally patient is difficult to adhere to drug effect with regard to abandoning cure, and this also is the main cause of present treating depression clinical effectiveness difference.2, there are a lot of side effect; 3, expensive; 4,35% patients with depression is reactionless to present Drug therapy at least in addition.
Though anxiety neurosis and depression medically are being divided into two kinds of mental sickness, both often merge existence clinically, are difficult to sometimes differentiate, therefore a lot of scholars advise the two combined treatment.
Adenosine triphosphate (adenosine-triphosphate) be adenosine triphyosphate again, abbreviates ATP as.ATP is formed skeleton symbol C by adenosine and three phosphates
10H
8N
4O
2NH
2(OH)
2(PO
3H)
3H, chemical name are 5'-triphosphoric acid-9-β-D-ribofuranosyl adenine, perhaps 5'-triphosphoric acid-9-β-D-ribofuranosyl-adenine.It is a kind of organic compound that contains energy-rich phosphate bond, and its a large amount of chemical energy just are stored in the energy-rich phosphate bond.
ATP is the direct sources of most of cell activities energy, and nucleotide also is intracellular important molecule simultaneously.Found that some neurons can discharge ATP in 1972, and propose the concept of " purinergic nerve ", ATP is more meaningful than intracellular effect in the extracellular in prompting.Now the existing ATP signal path of testing in a large number outside molecule, cell and system level Shanghai Stock Exchange clear-cells is in physiological effect, and on various organs difference cell sensings the ATP signal path placed critical positions.More and more evidences shows that ATP not only is indispensable, also is important signaling molecule at iuntercellular in cell.
The nucleotide ATP receptor of cell surface is called P2 receptor (Purinergic receptor subtype2), and P represents that they can be activated by purine, and numeral 2 is to make it to be different from adenosine receptor P1(now to be A1, A2A, A2B, A3).As other mediator, the receptor that ATP activates has P2Y(8 hypotype of metabotropic receptor family) and P2X(7 hypotype of ionotropic receptor family).Metabolic P2Y receptor passes through the G-albumen coupling to the interior second message,second messenger's path of cell, and the P2X receptor comprises the current duct of inherent ion, ATP makes the passage conformational change in conjunction with activation energy, activate the P2X receptor, open passage, ion is current, changes local ion concentration and cell membrane potential performance signal transfer function.ATP is degraded into ADP, AMP and adenosine rapidly under the catalysis of relevant enzyme in addition, and they also can be by P2Y receptor and adenosine receptor performance physiological action.
Mammal P2X receptor has 7 hypotypes, is respectively P2X1-7, and length is from 379(P2X6) the individual aminoacid of individual aminoacid to 595 (P2X7).Each hypotype contains two and strides the hydrophobic fragment of film (TM1 and TM2), the sulfurous key ectodomain of being made up of 10 cysteine residues between the hydrophobic region.As simple ligand-gated ion channel, the P2X receptor contains relatively simply folding, N-terminal and C-terminal in the born of the same parents, most of molecular composition born of the same parents outer shroud.Existing a plurality of evidence proof P2X forms the trimer duct.TM1 and TM2 participate in forming the duct, but the group in duct will partly be the TM2 composition.
The P2X receptor is distributed widely on the neuron and glial cell in the nervous system, and they are by regulating and balance ATP, adenosine and nucleotide discharge and effectiveness is transmitted in synapse, thereby controls the local circuit activity.There are abundant P2X2, P2X4, P2X6 to express at neuron; In some synapses, ATP is a kind of quick neurotransmitter, and it also can discharge altogether with other mediator simultaneously.On glial cell, as astrocyte, oligodendrocyte and microglia, find a large amount of P2 receptors, participate in neuron-glial cell and interact.Studies show that in the central nervous system effect of extracellular ATP has as neurotransmitter and regulates neural snap; Simultaneously the effect of long time journey is arranged also: can be used as growth-stimulating factor and trophic factors promote neuron and glial cell by the P2 receptor propagation, growth and death.In addition, purine signal and P2 receptor thereof participate in also that central nervous system's different pathological changes as: central nervous system injury, neurodegenerative diseases (diseases such as Alzheimer, parkinson, Huntingdon, lateral spinal sclerosis), nerve immunity and dysautonomia inflammation, epilepsy, mental sickness (depression, anxiety, schizophrenia, ethanol and drug dependence), neurogenic pain and migraine etc.
At present clinical practice aspect P2 receptor stimulating agent ATP is mainly used in the auxiliary treatment of syndrome behind the craniocerebral trauma and sequela thereof, and the disease of heart aspect such as arrhythmia.
ATP is widely distributed at body, and routine dose uses and has no side effect.
Summary of the invention:
First purpose of the present invention provides the agonist of P2X2 receptor or opens the application of agent in preparation depression and/or anti anxiety agent thing.
The present invention finds by drug effect and pharmacological experiment:
P2 receptor stimulating agent ATP and derivant ATP γ s(adenosine 5'-[γ-sulfo-thereof] triphosphoric acid four lithium salts) can effectively improve the experiment mice depressive state.For detecting the antidepressant effect of ATP and ATP γ s, the inventor gives mice tricorn perfusion ATP and ATP γ s, after 10 minutes, carries out the forced swimming experiment, measures the motionless time of swimming in the 4min.Compare with matched group, 25 μ M ATP and 50 μ MATP γ s can significantly reduce the dead time of mice swimming, and give the antidepressant effect that P2 wide spectrum antagonist suramin can block ATP and ATP γ s, show the antidepressant effect that has of ATP and derivant ATP γ s thereof, its antidepressant effect needs the p2 receptor.
Further detect the antidepressant effect of P2 receptor stimulating agent ATP and derivant ATP γ s thereof: the inventor detects ATP and ATP γ s antidepressant effect at society's failure (social defeated) depression model.The C57BL6/J mice is exposed to different CD1 mices after 10 minutes every day, with the poly (methyl methacrylate) plate of zona pellucida pore C57BL6/J and CD1 mice is separated and gets along, and accepts 24 hours high pressure, threat.Modeling success after continuous 10 days gives the recovery of having a rest in 3 days.Tricorn is implanted the microdialysis pump, gives 7 days ATP and ATP γ s continuously.The depressive state of ATP and ATP γ s group mice can significantly improve the depressive state of depressed mice.Above result shows that further ATP and ATP γ s have the antidepressant effect.
In order to compare the effect of ATP and traditional antidepressants, the inventor detects the antidepressant effect of ATP and imipramine at society's failure depression model, find lumbar injection ATP treatment 7 days or 28 days, ATP can significantly increase the social time of contact of mice, improve depressive state, and imipramine needs 28 days ability to improve the depressive state of mice.Show that ATP has quick antidepressant effect, be better than positive control medicine imipramine.
On the chronic unpredictable stress depression model of mice (CMS), through the modeling in 3 weeks, mice is in sucrose solution consumption experiment, and the sucrose solution consumption reduces, and the hair cleannes also obviously descend.Lumbar injection ATP is once the cleannes that can improve mice week and increase the sucrose solution preference.And after the treatment of 3 weeks, return to normal level substantially.Above result proves that further P2 agonist ATP has quick antidepressant effect on another kind of depression model and detection method.
For determining that ATP and derivant ATP γ s thereof bring into play antidepressant effect by any P2 receptor subtype, the inventor adopts pharmacological method to carry out examination in the forced swimming experiment.Found that and give the antidepressant effect that P2X wide spectrum antagonist isoPPADS can block ATP in the brain, and P2Y agonist ADP(adenosine diphosphate (ADP)), UTP(uridine triphosphate adenosine) can not reduce the dead time of mice in forced swimming experiment, show that ATP may be by activating P2X performance antidepressant effect.The P2X receptor has the 1-7 type, the wide spectrum antagonist BBG of P2X4/5/6/7, and P2X1 antagonist NF449, P2X3 antagonist AF-353 can not block the antidepressant effect of ATP, and prompting P2X2 receptor may be as the target spot of ATP antidepressant effect.Cu
2+(10 μ M) can work in coordination with the ATP(4 μ M of low concentration) activation P2X2 receptor, perfusion Cu in the brain
2++ ATP can produce quick antidepressant effect, and low concentration ATP and Cu
2+Can not reduce the dead time of mice, prompting ATP and derivant thereof are by P2X2 receptor performance antidepressant effect.The inventor further uses RNA perturbation technique checking P2X2 receptor whether to be ATP and derivant antidepressant effect target spot thereof, give the inboard prefrontal cortex micro-injection of animal brain P2X2 disturbance RNA molecule adeno-associated virus after, carry out the forced swimming experiment.Found that in matched group adenosine triphosphate can significantly reduce the mice dead time, has obvious antidepressant effect; And in the P2X2shRNA group, P2X2shRNA reduces P2X2 to express, blocking-up adenosine triphosphate antidepressant effectiveness.Above result shows that ATP and derivant thereof are by P2X2 receptor performance antidepressant effect.
Therefore the agonist of P2X2 receptor or open agent and can in preparation depression and/or anti anxiety agent thing, use.
The agonist of described P2X2 receptor or open agent and be preferably at the chemical compound or the polypeptide that activate the design of P2X2 receptor, further preferred described is ATP or derivatives thereof ATP γ s at the chemical compound that activates the design of P2X2 receptor.
Second purpose of the present invention provides the P2X2 receptor in the application that prevents and treat the target spot of depression and/or anti anxiety agent thing as screening.
The 3rd purpose of the present invention provides the P2X2 receptor at the biomarker as screening depression and/or anxiety neurosis, or screening depression and/or the early warning of anxiety neurosis and the application in the reagent for clinical diagnosis.
The 4th purpose of the present invention provides a kind of depression and/or anti anxiety agent thing, it is characterized in that, contain effective dose the P2X2 receptor agonist or open agent and acceptable carrier pharmaceutically.
The agonist of described P2X2 receptor or open agent at the chemical compound or the polypeptide that activate the design of P2X2 receptor, further preferred described is ATP or derivatives thereof ATP γ s at the chemical compound that activates the design of P2X2 receptor.
Described depression and/or anti anxiety agent thing, its dosage form can be liquid dosage form or solid dosage forms.
Described liquid dosage form can be injection, solution, suspensoid, Emulsion or aerosol.
Described solid dosage forms is tablet, capsule, pill, injectable powder, slow releasing preparation or various particulate delivery system.
The present invention studies confirm that by experiment: the agonist of P2X2 receptor or open agent and have antidepressant and/or angst resistance effect, therefore can or open agent for the preparation of depression and/or anti anxiety agent thing with the agonist of P2X2 receptor, and with target spot and screening depression and/or anxiety neurosis early warning and the reagent for clinical diagnosis of P2X2 receptor as screening prevention and treatment depression and/or anti anxiety agent thing, be with a wide range of applications.
The agonist ATP of P2X2 receptor of the present invention and ATP γ s poisonous side effect of medicine are little, and effect is lasting, and is cheap.
Description of drawings:
Fig. 1 gives to detect forced swimming result of experiment figure behind ATP, ATP γ s and the wide spectrum blocker suramin for C57BL/6J mice tricorn in the embodiment of the invention 1;
Fig. 2 gives the experimental result picture of the social depressed experiment of failure (administration detected after 7 days) behind ATP, the ATP γ s for C57BL/6J mice tricorn in the embodiment of the invention 1;
Fig. 3 is the experimental result picture of the depressed experiment of social failure behind C57BL/6J mouse peritoneal injection ATP and the imipramine in the embodiment of the invention 1 (administration 7, detect after 28 days);
Fig. 4 is the experimental result picture of the hair scoring experiment of C57BL/6J mice CMS depression model and lumbar injection ATP treatment in the embodiment of the invention 1;
Fig. 5 is the experimental result picture of the sucrose solution consumption experiment of C57BL/6J mice CMS depression model and lumbar injection ATP treatment in the embodiment of the invention 1;
Fig. 6 detects forced swimming result of experiment figure for giving in the C57BL/6J mouse brain in the embodiment of the invention 1 behind the P2X wide spectrum blocker isoPPADS;
Fig. 7 is for giving P2Y wide spectrum agonist ADP(adenosine diphosphate (ADP) in the C57BL/6J mouse brain in the embodiment of the invention 1) back detection forced swimming result of experiment figure;
Fig. 8 is for giving P2Y wide spectrum agonist UTP(uridine triphosphate adenosine in the C57BL/6J mouse brain in the embodiment of the invention 1) back detection forced swimming result of experiment figure;
Fig. 9 is for giving P2X in the C57BL/6J mouse brain in the embodiment of the invention 1
4567Detect forced swimming result of experiment figure behind the wide spectrum blocker BBG;
Figure 10 is for giving P2X in the C57BL/6J mouse brain in the embodiment of the invention 1
1Detect forced swimming result of experiment figure behind the blocker NF449;
Figure 11 is for giving P2X in the C57BL/6J mouse brain in the embodiment of the invention 1
3Detect forced swimming result of experiment figure behind the blocker AF-353;
Figure 12 is for giving P2X2 agonist ATP+Cu in the C57BL/6J mouse brain in the embodiment of the invention 1
2+Forced swimming result of experiment figure is detected in the back.
Figure 13 is the interior mPFC injection of C57BL/6J mouse brain disturbance RNA molecule adeno-associated virus network for location in the embodiment of the invention 1.
Figure 14 detects forced swimming result of experiment figure after the P2X2shRNA mouse peritoneal injection adenosine triphosphate in the embodiment of the invention 1.
The specific embodiment:
Following examples are that the present invention is further described, rather than limitation of the present invention.
Embodiment 1:
P2 receptor stimulating agent ATP and derivant ATP γ s antidepressant thereof and drug effect antianxity/pharmacological experiment research
1, forced swimming experiment (FST): Porsolt equals to propose in 1977 the forced swimming model, find that different medicines is different to the change of forced swimming dead time in the FST test, antidepressants can effectively reduce the dead time, and this model is one of method the most commonly used of screening antidepressants.What we adopted is the FST experiment of improvement, concrete steps are: with single uncovered clear glass cylinder (the high 45cm of cylinder that puts into of mice, diameter 19cm, water temperature 23-25 ℃) free swimming 6 minutes, the time of trip motionless (Immobility) in 4 minutes behind mensuration and the calculating mice is with this index as the medicine antidepressant effect.The motionless standard of mice trip is the little health of curling up of experimental mouse, is floating state, surfaces in the nostril.Effectively antidepressant drug can make the dead time of experimental mouse swimming shorten.
Laboratory animal: SPF level bull C57BL/6J mice (18 ± 2 grams, 3 monthly ages) is provided by Nanfang Medical Univ's Experimental Animal Center.Experimental animal feeding is in the environment (turning on light at 7 o'clock in the morning/turned off the light at 7 o'clock in afternoon) of light and shade conversion in 12/12 hour, the drinking-water of freely ingesting.
In the experiment of C57BL/6J mice forced swimming, animal is divided into 6 groups at random, 10 every group.Each treated animal tricorn operation implant perfusion cannula, after raising recovery on the 7th, 6 treated animals carry out following processing respectively: use the micro-administration system to give 1,2,3 group of perfusion control solvent (artificial cerebrospinal fluid, 5ul, 1ul/min), suramin (1.5mM, the 5ul of 4,5,6 groups of injections, 1ul/min), remaining needle treated that medicinal liquid fully absorbed in 5 minutes; Give again the 1st, 4 group of intracerebral injection control solvent (artificial cerebrospinal fluid, 5ul, 1ul/min); 2nd, 5 groups of intracerebral injection ATP(25 μ M, 5ul, 1ul/min); 3rd, 6 intracerebral injections, 50 μ M ATP derivant ATP γ s(50 μ M, 5ul, 1ul/min); After each group injection finishes, carry out the forced swimming experiment behind the 10min.
Experimental result: as shown in Figure 1, ATP and derivant ATP γ s thereof all can significantly shorten the trip dead time of mice, and give the antidepressant effect that P2 wide spectrum antagonist suramin can block ATP and ATP γ s.Show that ATP and derivant ATP γ s thereof have clear and definite antidepressant effect.
The ATP of this experiment, suramin, ATP γ s are with the artificial cerebrospinal fluid dissolving, perhaps are dissolved in the artificial cerebrospinal fluid under cosolvent DMSO hydrotropy.
2, society's failure depression model (social defeated) experiment:
The C57BL/6J mice is put into the little mouse cage of the strong CD1 of aggressivity, expose 10 minutes every day, continuous 10 days.After 10 minutes contact, with there being the pore lamina of septum pellucidum that the C57BL/6J mice is separated with the CD1 mice, make the C57BL/6J mice in 24 hours, continue to accept stimulation, obtain the mice of society's failure depression model.Control mice then with separate with the strain mice and live, but change object every day.After the modeling in 10 days, the single cage of C57BL/6J mice was raised three days, the mice of society failure depression model and the control mice tricorn of performing the operation is respectively implanted the microdialysis pump, give artificial cerebrospinal fluid respectively, ATP (2.5mM, flow velocity 0.5ul/h) and derivant ATP γ s (5mM, flow velocity 0.5ul/h), successive administration 7 days.Administration finishes back 24 hours, will be by detecting the C57BL/6J mice to assailant's contact and escaping and weigh level of depression.Experiment is carried out under dark surrounds, the C57BL/6J mice is placed in the new environment that has transparent ventilative little cage on one side, detect them the active situation in 2.5 minutes (result is not as putting into shown in the CD1 mice among Fig. 2), put into the strong CD1 mice of aggressivity (result puts into shown in the CD1 mice as Fig. 2's) at ensuing 2.5 minutes.Use the software analysis mice in contact area and other regional times.Use 70% ethanol to remove abnormal smells from the patient between each experiment.
And in relatively ATP and traditional antidepressants effect are tested, according to the method described above, after the modeling in 10 days, obtain mice and the control mice of society's failure depression model, respectively intraperitoneal injection of saline (0.15ml), ATP(125mg/kg, 0.15ml) and imipramine (20mg/kg, 0.15ml), contrast and be the lumbar injection artificial cerebrospinal fluid, once a day, respectively at administration after 7 days, finish administration after 28 days, administration finishes to carry out level of depression in back 24 hours and detects.
Laboratory animal: SPF level bull C57BL/6J mice (18 ± 2 grams, 3 monthly ages) provided by Nanfang Medical Univ's Experimental Animal Center, experimental animal feeding is in the environment (turning on light at 7 o'clock in the morning/turned off the light at 7 o'clock in afternoon) of light and shade conversion in 12/12 hour, the drinking-water of freely ingesting.
Experimental result: shown in Fig. 2 and 3, the artificial cerebrospinal fluid group is compared obvious minimizing (P＜0.05) with normal saline group mice in the contact area time with matched group, and the modeling success is described.Perfusion ATP and ATP γ can increase mice in s7 days in the time of contact area in the brain.In relatively ATP and traditional antidepressants effect are tested, administration 7 days, normal saline and imipramine group mice depressive state do not change, and ATP can significantly increase depressed mice in contact area time (P＜0.05).Administration 28 days, imipramine and adenosine triphosphate can both be improved the depressive state of mice.Above result shows that adenosine triphosphate has long-term antidepressant effect, and drug effect is faster than imipramine.
The ATP of this experiment, ATP γ s, imipramine are with the artificial cerebrospinal fluid dissolving, perhaps are dissolved in the normal saline.
3, the chronic unpredictable stress depression model of mice (CMS) experiment
The single cage of animal is raised and is adapted to 2 days, carries out sucrose solution consumption experiment then.Experiment beginning first day, the drinking-water bottle is replaced with two A and B bottles that have the 50ml of plug and water drinking tube and puts into A position and B position respectively, and every day the tracer liquid consumption, to eliminate the systematic error that drinking-water bottle position preference causes.1st, 2 days, A bottle and B be bottled to go into common drinking water (wt/wt).3rd, 4 days, A bottle and B be bottled to go into 1% sucrose solution (s/s).The 5th day, A is bottled to go into 1% sucrose solution, and the B bottle is common drinking water (s/w).Use percentage ratio (Vol A/[Vol A+Vol B]) detect every mice to the preference of sucrose solution.Detect once weekly.The hair scoring is tested: detect weekly by the hair methods of marking of having set up and once weigh depressive state.Score from the hair situation of following 7 different parts respectively: head, neck, back, abdominal part, tail, fore paw and rear solid end.Each regional hair is washed and dressed and neatly must be divided into 1, and blowzy hair must be divided into 0. accumulative total total points and weigh the mice depressive state.In ensuing 3 weeks, mice is divided into matched group, normal saline group and ATP processed group at random according to the experiment of sucrose solution preference and hair scoring.Press method for building up, 6 weeks of CMS Therapy lasted, slightly stress be formed by a series of, comprise: constraint (4 hours), forced swimming (5 minutes), food and water deprivation (24 hours), cage tilt (45 °, 3 times, 12 hours/each) in frozen water, day and night put upside down (1 this), flash lamp (12 hours), dirty cage (2 times, 14 hours/each).After these steps repeat to continue for 3 weeks, the modeling success.(125mg/kg, 0.15ml i.p.), normal saline (0.15ml), every day 1 time, treated for 3 weeks to give lumbar injection ATP then respectively.Matched group list cage is raised, and does not give any stimulation, gives normal saline (0.15ml) lumbar injection when treatment.
Laboratory animal: SPF level bull C57 BL/6J mice (18 ± 2 grams, 3 monthly ages) provided by Nanfang Medical Univ's Experimental Animal Center, experimental animal feeding is in the environment (turning on light at 7 o'clock in the morning/turned off the light at 7 o'clock in afternoon) of light and shade conversion in 12/12 hour, the drinking-water of freely ingesting.
Experimental result: the often modeling in 3 weeks, mice hair cleannes are starkly lower than normal control group (Fig. 4), and sucrose solution consumption is obviously decline (Fig. 5) also; Show make the CMS model after, mice is in depressive state.Behind continuous 3 all intraperitoneal injection of saline and the ATP, ATP can reverse depressive state due to the CMS.ATP group sucrose solution preference and hair condition be significantly better than the normal saline group, and be time dependence, and through after the treatment of 3 weeks, return to normal level substantially.Above result shows that from another kind of depression model and detection method adenosine triphosphate has antidepressant effect, and has characteristics such as rapid-action, few side effects.
4, the P2X2 receptor is as the screening experiment of antidepressant novel targets
Laboratory animal: SPF level bull C57 BL/6J mice (18 ± 2 grams, 3 monthly ages) provided by Nanfang Medical Univ's Experimental Animal Center, experimental animal feeding is in the environment (turning on light at 7 o'clock in the morning/turned off the light at 7 o'clock in afternoon) of light and shade conversion in 12/12 hour, the drinking-water of freely ingesting.
Experimental technique: the micro-administration sleeve pipe is implanted in each treated animal brain prefrontal cortex operation, after raising recovery on the 7th, use the micro-administration system to carry out single or twice each P2 receptor blocking agent of intracerebral injection, agonist or solvent control group, carry out the forced swimming experiment behind the 10min.
Experimental result: after operation drug delivery implant sleeve pipe was had a rest 7 days, utilize the micro-administration system to give P2X wide spectrum antagonist isoPPADS (50uM, 1ul, 0.2ul/min), dissolve with artificial cerebrospinal fluid) or control solvent (artificial cerebrospinal fluid, 1ul, 0.2ul/min), let the acupuncture needle remain at a certain point 5 minutes, give ATP(25uM more respectively, 1ul, 0.2ul/min) or control solvent (artificial cerebrospinal fluid, 1ul, 0.2ul/min), carry out the forced swimming experiment after 10 minutes, found that to give the antidepressant effect that P2X wide spectrum antagonist isoPPADS can block ATP in the brain, increase the mice dead time (Fig. 6); And at the P2Y agonist ADP(of mice prefrontal cortex perfusion variable concentrations adenosine diphosphate (ADP), 10,25,50,125uM, 1ul, 0.2ul/min), UTP(uridine triphosphate adenosine, 10,25,50,125uM, 1ul, 0.2ul/min) can not reduce the dead time of mice in forced swimming experiment (Fig. 7,8, ADP and UTP dissolve with artificial cerebrospinal fluid, contrast is the solvent artificial cerebrospinal fluid), show that ATP brings into play antidepressant effect by activating P2X, rather than the P2Y receptor.The P2X receptor has the 1-7 type, give wide spectrum antagonist BBG (10uM, 1ul, the 0.2ul/min of mice prefrontal cortex perfusion P2X4/5/6/7, dissolve with artificial cerebrospinal fluid), P2X1 antagonist NF449 (1uM, 1ul, 0.2ul/min, dissolve with artificial cerebrospinal fluid), P2X3 antagonist AF-353(100nM, 1ul, 0.2ul/min, with the inferior maple dissolving of dimethyl, with the one thousandth concentration dilution in artificial cerebrospinal fluid) or control solvent (the inferior maple of artificial cerebrospinal fluid+millesimal dimethyl, 1ul, 0.2ul/min), remaining needle treated that medicinal liquid absorbed in 5 minutes, give ATP(25uM again, 1ul, 0.2ul/min, dissolve with artificial cerebrospinal fluid) or control solvent (artificial cerebrospinal fluid, 1ul, 0.2ul/min), forced swimming experiment after 10 minutes, found that wide spectrum antagonist BBG(Fig. 9 of P2X4/5/6/7), P2X1 antagonist NF449(Figure 10), P2X3 antagonist AF-353(Figure 11) all can not block the antidepressant effect of ATP, prompting P2X
2Receptor may be as the target spot of ATP antidepressant effect.Cu
2+(10 μ M, 1ul 0.2ul/min) can work in coordination with the ATP(4 μ M of low concentration, and 1ul 0.2ul/min) activates the P2X2 receptor, perfusion Cu in the brain
2++ ATP (4 μ M, 1ul 0.2ul/min) can produce quick antidepressant effect (Figure 12), and separately low concentration ATP (4 μ M, 1ul, 0.2ul/min) and Cu
2+(10 μ M, 1ul 0.2ul/min) can not reduce dead time of mice.Above result shows that ATP and derivant thereof are to pass through P2X
2Receptor performance antidepressant effect.
5, use RNA perturbation technique checking P2X2 receptor as the experiment of antidepressant novel targets
Laboratory animal: SPF level bull C57BL/6J mice (18 ± 2 grams, 3 monthly ages) provided by Nanfang Medical Univ's Experimental Animal Center, experimental animal feeding is in the environment (turning on light at 7 o'clock in the morning/turned off the light at 7 o'clock in afternoon) of light and shade conversion in 12/12 hour, the drinking-water of freely ingesting.
Experimental technique: inboard prefrontal cortex (the bilateral mPFC of each treated animal brain, coordinate AP1.75, ML ± 0.75, DV2.65,15 ° of angles) micro-injection disturbance RNA molecule adeno-associated virus (vshRNA) is (0.4ul/4 minute, raise 0.25 millimeter, injected 0.4ul/4 minute again, remaining needle is 5 minutes after finishing), after raising expressing viral on the 14th, recovering, lumbar injection adenosine triphosphate (125mg/kg, 0.15 milliliter) and normal saline (0.15 milliliter) carry out the forced swimming experiment behind the 30min.P2X2 gene RefSeq ID is NM_153400; Source of species is mice; The shRNA sequence information is: 1, GCAGGGAAATTCAGTCTCAT2, CCAAAGGTTTGGCCCAACTTT; Gland relevant viral vector prepares siRNA(vshRNA) bearer type be pAKD.CMV.bGlobin.eGFP.H1.shRNA, serotype is AAV8.
Experimental result: mice was accepted the adeno-associated virus injection after 14 days, and a large amount of neurons of shRNA viral infection make its mPFC expressing green fluorescent protein, used laser co-focusing to observe and found that vshRNA mainly is expressed in mPFC(Figure 13 of mice).Lumbar injection adenosine triphosphate (125mg/kg, 0.15 milliliter) and normal saline (0.15 milliliter) carry out the forced swimming experiment behind the 30min.Found that contrast vshRNA group (the matched group injection be the virus packets quilt unordered shRNA in contrast) in, adenosine triphosphate can significantly reduce the mice dead time, has obvious antidepressant effect; And at P2X2shRNA 1., P2X2shRNA 2., during 1.+2. P2X2shRNA organizes, 2. 1. P2X2shRNA strike low P2X2 with P2X2shRNA and express (the shRNA sequence of 1. and 2. representing usefulness is respectively above-mentioned 1, GCAGGGAAATTCAGTCTCAT and 2, CCAAAGGTTTGGCCCAACTTT), blocking-up adenosine triphosphate antidepressant effectiveness (Figure 14).This result proves that the P2X2 receptor is as adenosine triphosphate antidepressant effect target spot.
More than experimental results show that P2X
2The agonist of receptor or open agent ATP and derivant ATP γ s has antidepressant and/or angst resistance effect, and have characteristics such as rapid-action, few side effects, P2X of the present invention
2The drug regimen toxic and side effects of the agonist of receptor is little, and effect is lasting, and is cheap.P2X
2Receptor can be used as the target spot of screening prevention and treatment depression novel drugs, and the P2X2 receptor is as depression/anxiety neurosis biomarker and as the application that detects target spot research and development depression/anxiety neurosis early warning, reagent for clinical diagnosis (box)
Last institute should be noted that; above embodiment is only in order to illustrate technical scheme of the present invention but not limiting the scope of the invention; although with reference to preferred embodiment the present invention has been done detailed description; those of ordinary skill in the art is to be understood that; can make amendment or be equal to replacement technical scheme of the present invention, and not break away from essence and the scope of technical solution of the present invention.
Claims (10)
1.P2X2 the agonist of receptor or open the application of agent in preparation depression and/or anti anxiety agent thing.
2. application according to claim 1 is characterized in that, the agonist of described P2X2 receptor or open agent at the chemical compound or the polypeptide that activate the design of P2X2 receptor.
3. application according to claim 2 is characterized in that, described is ATP or derivatives thereof ATP γ s at the chemical compound that activates the design of P2X2 receptor.
4.P2X2 receptor is in the application that prevents and treat the target spot of depression and/or anti anxiety agent thing as screening.
5.P2X2 receptor is at the biomarker as screening depression and/or anxiety neurosis, or screening depression and/or the early warning of anxiety neurosis and the application in the reagent for clinical diagnosis.
6. a depression and/or anti anxiety agent thing is characterized in that, contain effective dose the P2X2 receptor agonist or open agent and acceptable carrier pharmaceutically.
7. depression according to claim 6 and/or anti anxiety agent thing is characterized in that, the agonist of described P2X2 receptor or open agent at the chemical compound or the polypeptide that activate the design of P2X2 receptor.
8. depression according to claim 7 and/or anti anxiety agent thing is characterized in that, described is ATP or derivatives thereof ATP γ s at the chemical compound that activates the design of P2X2 receptor.
9. depression according to claim 6 and/or anti anxiety agent thing is characterized in that, described depression and/or anti anxiety agent thing, and its dosage form is liquid dosage form or solid dosage forms.
10. depression according to claim 9 and/or anti anxiety agent thing is characterized in that, described liquid dosage form is injection, solution, suspensoid, Emulsion or aerosol; Described solid dosage forms is tablet, capsule, pill, injectable powder, slow releasing preparation or various particulate delivery system.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310016690.5A CN103251951B (en) | 2013-01-16 | 2013-01-16 | The agonist of P2X2 receptor or open the application of agent in preparation antidepressant and/or anxiolytic drugs |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310016690.5A CN103251951B (en) | 2013-01-16 | 2013-01-16 | The agonist of P2X2 receptor or open the application of agent in preparation antidepressant and/or anxiolytic drugs |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103251951A true CN103251951A (en) | 2013-08-21 |
| CN103251951B CN103251951B (en) | 2016-02-10 |
Family
ID=48956375
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310016690.5A Active CN103251951B (en) | 2013-01-16 | 2013-01-16 | The agonist of P2X2 receptor or open the application of agent in preparation antidepressant and/or anxiolytic drugs |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103251951B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106188291A (en) * | 2016-08-30 | 2016-12-07 | 苏州普罗达生物科技有限公司 | Anti-interleukin 6 antibody polypeptides and application |
| CN106349345A (en) * | 2016-08-30 | 2017-01-25 | 苏州普罗达生物科技有限公司 | Glucocorticoid receptor inhibitor polypeptide and application |
| CN106366165A (en) * | 2016-08-30 | 2017-02-01 | 苏州普罗达生物科技有限公司 | Sigma receptor stimulant polypeptide and application |
| CN109675037A (en) * | 2019-01-25 | 2019-04-26 | 南方医科大学 | The application of ATP and its receptor in the self-closing disease drug of preparation treatment |
| CN110169976A (en) * | 2019-06-28 | 2019-08-27 | 北京大学 | Medicine composition for treating depression and its application containing adenosine a1 receptor agonists |
| CN110327362A (en) * | 2019-08-26 | 2019-10-15 | 北京大学 | Application of the inosinic acid in preparation antidepressant |
| WO2023151701A1 (en) * | 2022-07-12 | 2023-08-17 | 人工智能与数字经济广东省实验室(广州) | System for evaluating treatment effect of mental diseases and/or neurodegenerative diseases |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102000104A (en) * | 2010-11-24 | 2011-04-06 | 南方医科大学 | Use of triphosadenine and derivative thereof in preparation of antidepressant and/or antianxietic medicaments |
-
2013
- 2013-01-16 CN CN201310016690.5A patent/CN103251951B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102000104A (en) * | 2010-11-24 | 2011-04-06 | 南方医科大学 | Use of triphosadenine and derivative thereof in preparation of antidepressant and/or antianxietic medicaments |
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106188291A (en) * | 2016-08-30 | 2016-12-07 | 苏州普罗达生物科技有限公司 | Anti-interleukin 6 antibody polypeptides and application |
| CN106349345A (en) * | 2016-08-30 | 2017-01-25 | 苏州普罗达生物科技有限公司 | Glucocorticoid receptor inhibitor polypeptide and application |
| CN106366165A (en) * | 2016-08-30 | 2017-02-01 | 苏州普罗达生物科技有限公司 | Sigma receptor stimulant polypeptide and application |
| CN109675037A (en) * | 2019-01-25 | 2019-04-26 | 南方医科大学 | The application of ATP and its receptor in the self-closing disease drug of preparation treatment |
| CN110169976A (en) * | 2019-06-28 | 2019-08-27 | 北京大学 | Medicine composition for treating depression and its application containing adenosine a1 receptor agonists |
| CN110327362A (en) * | 2019-08-26 | 2019-10-15 | 北京大学 | Application of the inosinic acid in preparation antidepressant |
| CN110327362B (en) * | 2019-08-26 | 2022-09-27 | 北京大学 | Application of hypoxanthine nucleotide in preparation of antidepressant drug |
| WO2023151701A1 (en) * | 2022-07-12 | 2023-08-17 | 人工智能与数字经济广东省实验室(广州) | System for evaluating treatment effect of mental diseases and/or neurodegenerative diseases |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103251951B (en) | 2016-02-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103251951B (en) | The agonist of P2X2 receptor or open the application of agent in preparation antidepressant and/or anxiolytic drugs | |
| Bajic et al. | Morphine-enhanced apoptosis in selective brain regions of neonatal rats | |
| Chandler et al. | Identification and distribution of projections from monoaminergic and cholinergic nuclei to functionally differentiated subregions of prefrontal cortex | |
| Iwata et al. | Psychological stress activates the inflammasome via release of adenosine triphosphate and stimulation of the purinergic type 2X7 receptor | |
| Lasselin et al. | Mood disturbance during experimental endotoxemia: predictors of state anxiety as a psychological component of sickness behavior | |
| Chen et al. | Astragaloside VI promotes neural stem cell proliferation and enhances neurological function recovery in transient cerebral ischemic injury via activating EGFR/MAPK signaling cascades | |
| Gut et al. | Deep brain stimulation of different pedunculopontine targets in a novel rodent model of parkinsonism | |
| Gandolfi et al. | Cytidine 5′-diphosphocholine (citicoline): evidence for a neuroprotective role in glaucoma | |
| Bower et al. | Psychoneuroimmunology: An introduction to immune-to-brain communication and its implications for clinical psychology | |
| US20230277584A1 (en) | Methods of Modifying Neuronal Function by Changing Intracellular Magnesium Levels | |
| CN103269699A (en) | Methods of treating alcohol intoxication, alcohol use disorders and alcohol abuse which comprise the administration of dihydromyricetin | |
| Nakagawasai et al. | Liver hydrolysate improves depressive-like behavior in olfactory bulbectomized mice: Involvement of hippocampal neurogenesis through the AMPK/BDNF/CREB pathway | |
| Wang et al. | Sodium nitroprusside treatment for psychotic symptoms and cognitive deficits of schizophrenia: a randomized, double-blind, placebo-controlled trial | |
| Bloch et al. | Obsessive–compulsive disorder | |
| Li et al. | CRF-CRFR1 system within the dorsal medial prefrontal cortex are involved in consolation deficits under acute restraint stress in mandarin voles | |
| Shafaroodi et al. | A role for ATP-sensitive potassium channels in the anticonvulsant effects of triamterene in mice | |
| Zhan et al. | Oxytocin neurons mediate stress-induced social memory impairment | |
| CN101584686B (en) | Application of sodium valproate during preparing medicament for treating retina disease | |
| Gaskin et al. | Prolonged inactivation of the hippocampus reveals temporally graded retrograde amnesia for unreinforced spatial learning in rats | |
| US20140255517A1 (en) | Managing post-traumatic stress disorder | |
| CN102716206B (en) | Application of meridian warming and activating formula to preparation of medicine for preventing oxaliplatin (OXA)-induced peripheral neuropathy side effect | |
| CN109762896A (en) | A kind of marker MiR-125a-5p of multiple sclerosis | |
| CN109381473A (en) | Scutelloside is in the application for preparing gestational diabetes Fetal neurotubules malformation drug | |
| CN101310728A (en) | Free protein blood of pig injection and use thereof | |
| Dow-Edwards et al. | Behavioral responses to dopamine agonists in adult rats exposed to cocaine during the preweaning period |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20190327 Address after: 510530 Guanhao Science and Technology Park Phase I Laboratory Building 315-39, 12 Yuyan Road, Huangpu District, Guangzhou City, Guangdong Province Patentee after: Yushen (Guangzhou) Medical Technology Co., Ltd. Address before: 510515 No. 1838, Guangzhou Avenue, Guangzhou, Guangdong Patentee before: Southern Medical University |
|
| TR01 | Transfer of patent right |