CN103225000A - Bird flu H7N9 virus detection reagents and detection kit - Google Patents
Bird flu H7N9 virus detection reagents and detection kit Download PDFInfo
- Publication number
- CN103225000A CN103225000A CN2013101522305A CN201310152230A CN103225000A CN 103225000 A CN103225000 A CN 103225000A CN 2013101522305 A CN2013101522305 A CN 2013101522305A CN 201310152230 A CN201310152230 A CN 201310152230A CN 103225000 A CN103225000 A CN 103225000A
- Authority
- CN
- China
- Prior art keywords
- seq
- bird flu
- virus
- virus detection
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention belongs to the field of microbe detection, and provides bird flu H7N9 virus detection reagents. The reagents comprise a PCR buffer solution, dNTPs, DNA polymerase, a first primer pair (SEQ ID NO: 1 and SEQ ID NO: 2), a first probe (SEQ ID NO: 3), a second primer pair (EQ ID NO: 4 and SEQ ID NO: 5), and a second probe (SEQ ID NO: 6). The invention also provides an bird flu H7N9 virus detection kit. When the detection kit provided by the invention is used for detecting bird flu H7N9 virus, the kit is rapid, safe, and highly sensitive.
Description
Technical field
The invention belongs to the microorganism detection field, relate in particular to a kind of bird flu H7N9 virus detection reagent and comprise the detection kit of this reagent.
Background technology
Bird flu (Bird Flu) is a kind of acute infectious disease that is caused by avian influenza virus, can infect the mankind, metainfective symptom mainly shows as high heat, cough, runny nose, myalgia etc., and is most with serious pneumonia, multiple organ failures such as the severe patient heart, kidney cause death, and case fatality rate is very high.Avian influenza virus belongs to orthomyxoviridae family's influenza A virus and belongs to.The influenza A virus particle is polymorphism, and wherein spherical diameter 80～120nm has cyst membrane.Genome is segmented sub-thread strand RNA.Different according to its adventitia hemagglutinin (H) with neuraminidase (N) protein antigenicity, can be divided into 16 H hypotypes (H1～H16) and 9 N hypotypes (N1～N9) at present.Influenza virus A avian is except that infecting fowl, but also infected person, pig, horse, mink and marine mammal.But the avian influenza virus subtype of infected person is H5N1, H9N2, H7N7, H7N2, H7N3.It is novel reprovision virus that the people who finds in China Shanghai and two places, Anhui in by the end of March, 2013 infects the H7N9 avian influenza virus, it is the new subtype influenza virus that the whole world is found first, do not include China's statutory report monitoring of infectious disease reporting system as yet in, and at the beginning of 2013 4 months, do not have vaccine to release as yet.Infect this viral patient and all occur symptoms such as heating in early days, do not confirm as yet in April, 2013 whether this viroid has the characteristic that the people is infected the people.
Because avian influenza virus H7N9 hypotype is a kind of new subtype influenza virus, for this virus, national CDC has issued Case definition:
(1) suspected case: meet (the generally not high or reduction of total white blood cells of clinical symptom and routine blood test.The patient with severe symptoms has total white blood cells and lymphopenia more, and blood platelet reduction arranged), biochemically (have creatine kinase, serum lactic dehydrogenase, aspartate amino transferase, alanine aminotransferase to raise more, c reactive protein raises, and myohaemoglobin can raise) and chest iconography feature (take place the sheet image to occur in patient's lung of pneumonia.Patient with severe symptoms's lesion growth is rapid, is multiple ground glass shadow of two lungs and pulmonary consolidation image, can merge a small amount of hydrothorax.When ARDS took place, pathology was widely distributed), the influenza A virus universal primer positive can have the epidemiology contact history side by side except seasonal influenza.
(2) confirmed cases: meet the suspected case Case definition, and isolate the H7N9 avian influenza virus or the H7N9 avian influenza virus detection of nucleic acids positive in the respiratory secretions sample.
(3) severe cases: pneumonia merges respiratory failure or other organ failure persons are severe cases.
Because the common PD of bird flu H7N9 patient is rapid, and the time of its appearance is shorter,, will play very big booster action to the diagnoses and treatment of the state of an illness if therefore can realize detection fast and accurately to bird flu H7N9 virus.
Summary of the invention
The test kit that the purpose of the embodiment of the invention is to provide a kind of bird flu H7N9 virus detection reagent and comprises this detection reagent is so that can quick and precisely detect bird flu H7N9 virus, with the diagnosis and the treatment of auxiliary bird flu.
The embodiment of the invention is to realize like this, a kind of bird flu H7N9 virus detection reagent, comprise PCR damping fluid, dNTPs, archaeal dna polymerase, also comprise first primer to (SEQ ID NO:1 and SEQ ID NO:2), the first probe SEQ ID NO:3, second primer to (SEQ ID NO:4 and SEQ ID NO:5) and the second probe SEQ ID NO:6.
Another purpose of the embodiment of the invention is to provide a kind of bird flu H7N9 virus detection kit, comprises bird flu H7N9 virus detection reagent of the present invention, also contains positive control and negative control.
Bird flu H7N9 virus detection reagent of the present invention and comprise the detection kit of this reagent can be used for the detection of bird flu H7N9 virus.Utilize bird flu H7N9 virus detection kit provided by the invention bird flu H7N9 virus to be detected by fluorescent quantitative PCR detection method, directly detect advantages such as this testing process has fast, safety, sensitivity height after sample to be detected can being extracted RNA.
Description of drawings
Fig. 1 is the schema that utilizes the bird flu H7N9 virus detection kit detection bird flu H7N9 virus of one embodiment of the invention;
Fig. 2 is that the bird flu H7N9 virus of the embodiment of the invention detects the positive findings synoptic diagram;
Fig. 3 is that the bird flu H7N9 virus of the embodiment of the invention detects the negative findings synoptic diagram.
Embodiment
In order to make the technical problem to be solved in the present invention, technical scheme and beneficial effect clearer,, the present invention is further elaborated below in conjunction with drawings and Examples.Should be appreciated that specific embodiment described herein only in order to explanation the present invention, and be not used in qualification the present invention.
The embodiment of the invention provides a kind of bird flu H7N9 virus detection reagent, comprise PCR damping fluid, dNTPs, archaeal dna polymerase, also comprise first primer to (SEQ ID NO:1 and SEQ ID NO:2), the first probe SEQ ID NO:3, second primer to (SEQ ID NO:4 and SEQ ID NO:5) and the second probe SEQ ID NO:6.
Particularly, above-mentioned PCR damping fluid can be for self containing the damping fluid of magnesium ion, also can be by add MgCl in the damping fluid that does not contain magnesium ion
2Obtain.In a preferred embodiment, this PCR damping fluid is by adding MgCl in the damping fluid that does not contain magnesium ion
2Obtain, more preferably, this MgCl
2Concentration be 25mM.
Particularly, above-mentioned archaeal dna polymerase is the Taq enzyme, is preferably Hot Start Taq enzyme, i.e. warm start Taq enzyme.
Particularly, above-mentioned first primer to sequence is:
H7 upstream primer: 5 '-GTAAACACATTAACTGAAAGAGG-3 ' SEQ ID NO:1
The H7 downstream primer: 5 '-CAATGTGACCAATTCCTAGAAT-3 ' SEQ ID NO:2,
First probe sequence is:
H7 probe: 5 '-TCCCCAGGATCTGCTCAAAAGGGAAAAG-3 ' SEQ ID NO:3;
Above-mentioned second primer to sequence is:
N9 upstream primer: 5 '-CAGATGAATGCAGGTTCTATG-3 ' SEQ ID NO:4
The N9 downstream primer: 5 '-TATCGTGTATTGTTCCGTTTG-3 ' SEQ ID NO:5,
Second probe sequence is:
N9 probe: 5 '-TCAGCCAAGGAACAACAATCAGAGG-3 ' SEQ ID NO:6.
5 ' end of above-mentioned probe sequence is connected with the fluorescence report group respectively, and 3 ' end is connected with quenching group respectively.When the fluorescence report group of 5 ' end of probe and the quenching group of 3 ' end are earlier close mutually, because the transmission ofenergy effect takes place, the fluorescence report group can not send fluorescence, but carrying out along with amplified reaction, the fluorescence report group of 5 ' end splits away off along with the hydrolysis of probe, no longer with the effect of quenching group generation transmission ofenergy, thereby can send fluorescence, can carry out quantitative analysis to unknown template by the accumulation that detects fluorescent signal.The fluorescence report group that uses in the embodiment of the invention can be selected from FAM, VIC(HEX) and ROX in two kinds, VIC(HEX wherein) be meant that VIC and HEX can replace use, but do not use simultaneously.Use two kinds in above-mentioned three kinds of fluorescence report groups can produce two kinds of different fluorescence, so that detected result is easy to identification.The quenching group that probe 3 ' end in the embodiment of the invention connects is DABCYL, also can be BHQ.
Above-mentioned bird flu H7N9 virus detection reagent can be by quantitative fluorescent PCR reaction pair bird flu H7N9 virus the H7 hypotype of hemagglutinin and the N9 hypotype of neuraminidase detect respectively, to determine existing of avian influenza virus H7 hypotype and N9 hypotype respectively.
The embodiment of the invention also provides another kind of bird flu H7N9 virus detection reagent, it comprises PCR damping fluid, dNTPs, archaeal dna polymerase, first primer to (SEQ ID NO:4 and SEQ ID NO:5), the second probe SEQ ID NO:6, also comprises three-primer to (SEQ ID NO:7 and SEQ ID NO:8), the 3rd probe SEQ ID NO:9 to (SEQ ID NO:1 and SEQ ID NO:2), the first probe SEQ ID NO:3, second primer.
In the above-mentioned another kind of bird flu H7N9 virus detection reagent, three-primer is as follows to sequence:
Influenza A upstream primer: 5 '-TTCTAACCGAGGTCGAAACG-3 ' SEQ ID NO:7
The influenza A downstream primer: 5 '-ACAAAGCGTCTACGCTGCAG-3 ' SEQ ID NO:8,
The 3rd probe sequence is:
Influenza A probe: 5 '-TCATACCGTCAGGCCCCCTCAAAGC-3 ' SEQ ID NO:9.
In the embodiments of the invention, 5 ' end of above-mentioned first probe, second probe, the 3rd probe is connected with the fluorescence report group respectively, and 3 ' end is connected with quenching group respectively.This fluorescence report group can be selected from FAM, VIC(HEX) and ROX.Particularly, the respectively corresponding three kinds of different fluorescence report groups of above-mentioned three kinds of probes, for example, but be not limited to, the fluorescence report group that first probe sequence, 5 ' end connects is VIC, the fluorescence report group that second probe sequence 5 ' end connects is ROX, and the fluorescence report group that the 3rd probe sequence 5 ' end connects is FAM, and wherein VIC is replaceable is HEX.Three kinds of probe sequences correspond respectively to three kinds of different fluorescence report groups and can produce three kinds of different fluorescence when fluorescence quantitative PCR detection, corresponding to three different fluorescence channels, can make detected result be easy to identification when reading the result.
Above-mentioned bird flu H7N9 virus detection reagent can detect sample to be detected by fluorescence quantifying PCR method, first primer is to reaching the H7 hypotype of first probe corresponding to avian influenza virus in this detection reagent, second primer is to reaching the N9 hypotype of second probe corresponding to avian influenza virus, three-primer can be used for identifying influenza A virus to reaching the generic features sequence of the 3rd probe corresponding to influenza A virus.Can identify the bird flu of H7N9 virus infection and other influenza As after utilizing this reagent to detect and both are distinguished.
Particularly, also can comprise reversed transcriptive enzyme in bird flu H7N9 virus detection reagent of the present invention, preferably this reversed transcriptive enzyme is the M-MLV reversed transcriptive enzyme.Because bird flu H7N9 virus is RNA viruses, therefore reversed transcriptive enzyme is integrated in the bird flu H7N9 virus detection reagent and the reverse transcription of viral RNA and the detection of virus characteristic sequence can be finished in same reaction, simplify reactions steps, improved detection efficiency.This reversed transcriptive enzyme is identical with archaeal dna polymerase in bird flu H7N9 virus detection reagent of the present invention, and both can mix by equal-volume, obtain mixed enzyme solution, mix with other components then.
In embodiments of the present invention, above-mentioned primer and probe store in mother liquor, and the concentration during storage is 45-55 μ M.Preferably, this storage concentration is 50 μ M.When using the preparation test kit, various mother liquors are added to and mix mutually in the PCR reaction tubes and mix with other component.
In the embodiment of the invention, above-mentioned bird flu H7N9 virus detection reagent also can comprise the PCR toughener, i.e. PCR enhancer.In the PCR reaction process, the PCR toughener can improve the thermostability of archaeal dna polymerase, reduce the secondary structure of DNA, activity to enzyme does not influence simultaneously, therefore when running into some template complexs (as GC content height), this can greatly reduce the negative impact of DNA secondary structure to the PCR reaction by improving annealing temperature.
The embodiment of the invention also provides a kind of bird flu H7N9 virus detection kit, and this detection kit comprises the bird flu H7N9 virus detection reagent that contains the foregoing description, and Fig. 1 has shown an embodiment who utilizes this detection kit to detect.
In the embodiments of the invention, this detection kit also comprises positive control and negative control, wherein positive control comprises and contains following one or more: at artificial-synthetic DNA's fragment of influenza A (first stream) characteristic sequence, can for, but be not limited to, SEQ ID NO:10, the artificial-synthetic DNA's fragment that contains H7 hypotype characteristic sequence, can for, but be not limited to SEQ ID NO:11, and the artificial-synthetic DNA's fragment that contains N9 hypotype characteristic sequence, can for, but be not limited to SEQ ID NO:12; Can contain the sequence that other RNA viruses reverse transcriptions obtain in the negative control, as the cDNA sequence of Influenza B virus RNA reverse transcription acquisition, or the cDNA sequence of norovirus RNA reverse transcription acquisition, also can not comprise any dna fragmentation.
Particularly, H7 hypotype characteristic sequence in the above-mentioned positive control can be by first primer to detecting by the PCR method, above-mentioned N9 hypotype characteristic sequence can be by second primer to detecting by the PCR method, and above-mentioned influenza A characteristic sequence can be by three-primer to detecting by the PCR method.
When utilizing bird flu H7N9 virus detection kit of the present invention that testing sample is detected by the quantitative fluorescent PCR reaction, can utilize the PCR reaction system of 25 μ L to detect, also available other this areas reaction volume commonly used detects.Particularly, the PCR reaction system of 25 μ L can comprise following composition:
In one embodiment of the invention, this bird flu H7N9 virus detection kit contains Hot Start Taq enzyme and M-MLV reversed transcriptive enzyme simultaneously, wherein Hot Start Taq enzyme (5U/ μ L) and M-MLV reversed transcriptive enzyme (5U/ μ L) are respectively got the mixing of 0.2-0.3 microlitre, add 50% glycerine then and supply volume to 0.6 microlitre (as needs).This mixed enzyme solution and 0.4ulPCR toughener are added in the above-mentioned 19 microlitre mixtures simultaneously, and cumulative volume is 20 microlitres, in testing process, to the RNA solution that wherein adds 5 microlitre testing samples.
In one embodiment of the invention, this bird flu H7N9 virus detection kit only contains the M-MLV reversed transcriptive enzyme, the M-MLV reversed transcriptive enzyme of getting the 0.2-0.3 microlitre in this detection kit preparation process adds the sterilization ultrapure water or 50% glycerine complements to 0.6 microlitre, be added to simultaneously in the above-mentioned 19 microlitre mixtures with the 0.4ulPCR toughener then, cumulative volume is 20 microlitres, in testing process, to the RNA solution that wherein adds 5 microlitre testing samples.
Particularly, when utilizing bird flu H7N9 virus detection kit of the present invention to detect, utilize PCR to extract reagent (or test kit) obtains containing RNA to sample extraction RNA solution earlier, then this RNA solution is added in the detection reaction liquid of detection kit of the present invention, on quantitative real time PCR Instrument, detects.
Particularly, when utilizing bird flu H7N9 virus detection kit of the present invention to detect by PCR, the PCR reaction conditions is:
42-50℃：10-30min；
92-95℃：2-3min；
92-95 ℃: 5-10s; 55-60 ℃: 40-80s; 72 ℃: the 10-20s(40-50 circulation).
In the above-mentioned PCR reaction process, 42-50 ℃ reactions steps makes the RNA of detected sample to be reversed and records into cDNA, then by subsequent P CR reaction detection characteristic sequence wherein.
Particularly, utilize bird flu H7N9 virus detection kit of the present invention to carry out after PCR detects, by following condition judgment negative sample and positive sample:
Positive sample: amplification curve diagram Ct value≤40, and obvious exponential growth is arranged, as shown in Figure 2.
Negative sample: amplification curve diagram Ct value＞40 or do not have the Ct value, as shown in Figure 3.
Detected result is according to as shown in table 1:
Table 1PCR detected result is judged
| Amplification | Presentation of results |
| First primer is to (-), and second primer is to (-), and three-primer is to (-) | Do not detect bird flu H7N9 nucleic acid |
| First primer is to (+), and second primer is to (+), and three-primer is to (+) | Detect bird flu H7N9 nucleic acid |
| First primer is to (-), second primer to (-) three-primer to (+) | Detect influenza A virus |
| First primer is to (+), and second primer is to (-), and three-primer is to (+) | Detect bird flu H7 hypotype |
| First primer is to (-), and second primer is to (+), and three-primer is to (+) | Detect bird flu N9 hypotype |
Below the present invention is described further by specific embodiment.
Embodiment oneThe preparation detection kit
1. according to following sequence synthesized primer thing and probe:
The H7 upstream primer: 5 '-GTAAACACATTAACTGAAAGAGG-3 ' SEQ ID NO:1,
The H7 downstream primer: 5 '-CAATGTGACCAATTCCTAGAAT-3 ' SEQ ID NO:2,
H7 probe: 5 '-(VIC) TCCCCAGGATCTGCTCAAAAGGGAAAAG (DABCYL)-3 ' SEQ ID NO:3;
The N9 upstream primer: 5 '-CAGATGAATGCAGGTTCTATG-3 ' SEQ ID NO:4,
The N9 downstream primer: 5 '-TATCGTGTATTGTTCCGTTTG-3 ' SEQ ID NO:5,
N9 probe: 5 '-(ROX) TCAGCCAAGGAACAACAATCAGAGG (DABCYL)-3 ' SEQ ID NO:6;
The influenza A upstream primer: 5 '-TTCTAACCGAGGTCGAAACG-3 ' SEQ ID NO:7,
The influenza A downstream primer: 5 '-ACAAAGCGTCTACGCTGCAG-3 ' SEQ ID NO:8,
Influenza A probe: 5 '-(FAM) TCATACCGTCAGGCCCCCTCAAAGC (DABCYL)-3 ' SEQ ID NO:9.
Wherein above-mentioned probe sequence contains corresponding fluorescence report group and quenching group.The synthetic back of above-mentioned sequence stores in solution.
2. synthetic following positive control sequence:
Positive control sequence at influenza A:
ATGAGTCTTCTAACCGAGGTCGAAACGTACGTTCTTTCTATCATACCGTCAGGCCCCCTC?AAAGCCGAGATTGCGCAGAGACTGGAAAGTGTCTTTGCAGGAAAGAACACAGATCTT?GAGGCTCTCATGGAATGGCTAAAGACAAGACCAATCTTGTCACCTCTGACTAAGGGAA?TTTTAGGATTTGTGTTCACGCTCACCGTGCCCAGTGAGCGAGGACTGCAGCGTAGACG?CTTTGTC?SEQ?ID?NO：10
Positive control sequence at H7:
CAAAGTAAACACATTAACTGAAAGAGGAGTGGAAGTCGTCAATGCAACTGAAACAGT?GGAACGAACAAACATCCCCAGGATCTGCTCAAAAGGGAAAAGGACAGTTGACCTCGG?TCAATGTGGACTCCTGGGGACAATCACTGGACCACCTCAATGTGACCAATTCCTAGAAT?TTTCAGCCGA?SEQ?ID?NO：11
Positive control sequence at N9:
AGAACCCTATGTTTCATGCGACCCAGATGAATGCAGGTTCTATGCTCTCAGCCAAGGAA?CAACAATCCGAGGGAAACACTCAAACGGAACAATACACGATAGGTCCCAGTATCGCGC?CCTGATAAGCTGGCCACTATCATCACCGCCCACAGTGTACAA?SEQ?ID?NO：12。
Place solution to store respectively above-mentioned dna sequence dna and obtain three kinds of positive control solutions.
3. preparation negative control
Obtain norovirus, extract RNA and be cDNA, in solution, store its reverse transcription.Utilize Trizol reagent to extract RNA, concrete operations are carried out to specifications.Reverse transcription uses the M-MLV reversed transcriptive enzyme to carry out, and obtains negative controls.
4. preparation test kit
A. prepare the PCR reaction solution according to following component and consumption:
MgCl
2(25mM) 144 microlitres/box (3 microlitre/pipe)
DNTPs 144 microlitres/box (3 microlitre/pipe)
Each 9.6 microlitres/box of each bar primer and probe (SEQ ID NOs:1-9) (50 μ M) (each 0.2 microlitre/pipe)
Add sterilization ultrapure water to 912 microlitre/box (each 19 microlitre/pipe)
Every box comprises that 6 PCR react eight pipes in the detection kit of the present invention, therefore totally 48 PCR reaction tubess, and in the EP pipe of packing into after each component mixed, the consumption in the above-mentioned bracket is to carry out PCR consumption in every PCR reaction tubes when detecting.
B. get 9.6 microlitre Hot Start Taq enzyme (5U/ μ l) and 9.6 microlitre M-MLV reversed transcriptive enzymes, add 9.6 microlitres, 50% glycerine and mix, get mixed enzyme solution.When detecting, contain 0.2 microlitre Hot Start Taq enzyme and 0.2 microlitre M-MLV reversed transcriptive enzyme in every PCR pipe.
C. get 19.2 microlitre PCR tougheners, wherein when detecting, contain PCR toughener 0.4 microlitre in every PCR pipe.
D. above-mentioned PCR reaction solution, mixed enzyme solution, PCR toughener, positive control solution and negative controls are assembled into test kit, wherein positive control solution and negative controls are 25 microlitres in every test kit.
Embodiment two
1. synthetic first primer is to (SEQ ID NO:1 and SEQ ID NO:2) and first probe (SEQ ID NO:3, its 5 ' end is connected with HEX, 3 ' end connection DABCYL), second primer is to (SEQ ID NO:4 and SEQ ID NO:5) and second probe (SEQ ID NO:6, its 5 ' end is connected with FAM, and 3 ' end connects DABCYL).The synthetic back of above-mentioned sequence stores in solution.
2. preparation positive control solution, operation steps is with embodiment one step 2.
3. preparation negative control
Obtain Influenza B virus, extract RNA and be cDNA, in solution, store its reverse transcription.Utilize Trizol reagent to extract RNA, concrete operations are carried out to specifications.Reverse transcription uses the M-MLV reversed transcriptive enzyme to carry out, and obtains negative controls.
4. preparation test kit
A. prepare the PCR reaction solution according to following component and consumption:
MgCl
2(25mM) 144 microlitres/box (3 microlitre/pipe)
DNTPs 144 microlitres/box (3 microlitre/pipe)
Each 9.6 microlitres/box of each bar primer and probe (SEQ ID NOs:1-6) (50 μ M) (each 0.2 microlitre/pipe)
Add sterilization ultrapure water to 912 microlitre/box (each 19 microlitre/pipe)
Every box comprises that 6 PCR react eight pipes in the detection kit of the present invention, therefore totally 48 PCR reaction tubess, and in the EP pipe of packing into after each component mixed, the consumption in the above-mentioned bracket is to carry out PCR consumption in every PCR reaction tubes when detecting.
B. get 9.6 microlitre Hot Start Taq enzymes (5U/ μ l), add 19.2 microlitres, 50% glycerine and mix, get archaeal dna polymerase liquid.When detecting, contain 0.2 microlitre Hot Start Taq enzyme in every PCR pipe.
C. above-mentioned PCR reaction solution, archaeal dna polymerase liquid, positive control solution and negative controls are assembled into test kit, wherein positive control solution and negative controls are 25 microlitres in every test kit.
Embodiment three
Owing to can't obtain bird flu H7N9 virus at present, therefore utilize the detection kit of embodiment one preparation to carry out bird flu H7N9 virus and detect by the mode of artificial combination.
Get 20 parts of influenza A virus Virus Samples, extract RNA, be divided into four groups then:
First group: 8 increments this, every increment is wherein originally added bird flu H7 and two positive control fragments of N9 (SEQ ID NO:10 and SEQ ID NO:11) of synthetic respectively;
Second group: 6 increments this, originally add the bird flu H7 positive control fragment (SEQ ID NO:10) of synthetic respectively to every increment wherein;
The 3rd group: 4 increments this, originally add the bird flu N9 positive control fragment (SEQ ID NO:11) of synthetic respectively to every increment wherein;
The 4th group: 2 fens samples do not add exogenous dna fragment.
Adopt the negative controls of 10 parts of embodiment one step 3 preparations simultaneously, utilize the detection kit of embodiment one preparation to detect, the result is as shown in table 2:
Table 2 detected result
Above-mentioned detected result conforms to practical situation.
Embodiment fourThe detection of bird flu H7N9 virus
Present embodiment utilizes the detection kit of embodiment one preparation to whether containing bird flu H7N9 virus in the sample to be tested to measure, operating process as shown in Figure 1, the concrete operations step is as follows:
1. sample rna extracts
Get 10 influenza patients, obtain throat swab sample 10 examples, utilize viral RNA to extract test kit and extract RNA, concrete operations are carried out to specifications.
2. PCR reaction solution (19.0 μ l), mixed enzyme solution (0.6 μ l) and PCR toughener (0.4 μ l) in the detection kit of embodiment one preparation are mixed in each PCR pipe of eight pipes.
3. get the sample rna to be checked that 5 μ l steps 1 obtain, add in the PCR pipe of above-mentioned steps 2, mix last machine testing.Comprise positive control and negative control during detection.Comprise three kinds of positive control solutions in the positive control reaction tubes simultaneously.
4. be set as follows the PCR reaction conditions:
45℃：20min；
92℃：5min；
92 ℃: 7s; 58 ℃: 50s; 72 ℃: 10s(45 circulation).
5. the result judges
According to the amplification collection of illustrative plates according to following standard determination result:
Positive sample: amplification curve diagram Ct value≤40, and obvious exponential growth is arranged, as shown in Figure 2.
Negative sample: amplification curve diagram Ct value＞40 or do not have the Ct value, as shown in Figure 3.
6. detected result
Present embodiment has 10 routine experimenters, and detected result reference table 1 judges that wherein 8 examples are influenza A, and none example infects bird flu H7N9 virus.
Embodiment five
Utilize the detection kit of embodiment two preparations to carry out the detection of bird flu H7N9 virus.
1. sample rna extracts and reverse transcription
2. PCR reaction solution (19.0 μ l), archaeal dna polymerase liquid (0.6 μ l) in the detection kit of embodiment two preparations are mixed in each PCR pipe of eight pipes.
3. get the sample cDNA to be checked that 5 μ l steps 1 obtain, add in the PCR pipe of above-mentioned steps 2, mix last machine testing.Comprise positive control and negative control during detection.Comprise three kinds of positive control solutions in the positive control reaction tubes simultaneously.
4. be set as follows the PCR reaction conditions:
95℃：2min；
95 ℃: 5s; 55 ℃: 80s; 72 ℃: 15s(40 circulation).
5. detected result
With embodiment four.
The above only is preferred embodiment of the present invention, not in order to restriction the present invention, all any modifications of being done within the spirit and principles in the present invention, is equal to and replaces and improvement etc., all should be included within protection scope of the present invention.
Claims (10)
1. bird flu H7N9 virus detection reagent, comprise PCR damping fluid, dNTPs, archaeal dna polymerase, also comprise first primer to SEQ ID NO:1 and SEQ ID NO:2, the first probe SEQ ID NO:3, second primer to SEQ ID NO:4 and the SEQ ID NO:5 and the second probe SEQ ID NO:6.
2. bird flu H7N9 virus detection reagent as claimed in claim 1, it is characterized in that, 5 ' the end of the described first probe SEQ ID NO:3 and the second probe SEQ ID NO:6 is connected with different fluorescence report groups respectively, and 3 ' end is connected with quenching group respectively.
3. bird flu H7N9 virus detection reagent as claimed in claim 1 is characterized in that, also comprises three-primer to SEQ ID NO:7 and SEQ ID NO:8, and the 3rd probe SEQ ID NO:9.
4. bird flu H7N9 virus detection reagent as claimed in claim 3 is characterized in that, the 5 ' end of described the 3rd probe SEQ ID NO:9 is connected with the fluorescence report group, and 3 ' end is connected with quenching group.
5. as claim 2 or 4 described bird flu H7N9 virus detection reagents, it is characterized in that described fluorescence report group is selected from FAM, VIC and ROX or is selected from FAM, HEX and ROX.
6. bird flu H7N9 virus detection reagent as claimed in claim 1 is characterized in that, also comprises reversed transcriptive enzyme.
7. bird flu H7N9 virus detection reagent as claimed in claim 1 is characterized in that, also comprises the PCR toughener.
8. a bird flu H7N9 virus detection kit comprises as each described bird flu H7N9 virus detection reagent among the claim 1-7.
9. bird flu H7N9 virus detection kit as claimed in claim 8 is characterized in that described detection kit also comprises positive control and negative control.
10. bird flu H7N9 virus detection kit as claimed in claim 8 is characterized in that, described positive control comprises one or more among the sequence SEQ ID NO:10-SEQ ID NO:12.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310152230.5A CN103225000B (en) | 2013-04-27 | 2013-04-27 | Bird flu H7N9 virus detection reagents and detection kit |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310152230.5A CN103225000B (en) | 2013-04-27 | 2013-04-27 | Bird flu H7N9 virus detection reagents and detection kit |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103225000A true CN103225000A (en) | 2013-07-31 |
| CN103225000B CN103225000B (en) | 2014-11-05 |
Family
ID=48835639
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310152230.5A Active CN103225000B (en) | 2013-04-27 | 2013-04-27 | Bird flu H7N9 virus detection reagents and detection kit |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103225000B (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104017902A (en) * | 2014-03-21 | 2014-09-03 | 北京世纪元亨动物防疫技术有限公司 | RT-PCR (reverse transcription-polymerase chain reaction) primer pair and kit for detecting avian influenza virus N9 subtype and detection method thereof |
| CN104404172A (en) * | 2014-12-15 | 2015-03-11 | 中国医学科学院医学实验动物研究所 | Liquid chip detection kit for H7N9 subtype influenza viruses |
| CN110468238A (en) * | 2019-09-11 | 2019-11-19 | 深圳市芯思微生物科技有限公司 | A kind of primed probe group, kit and the application of constant-temperature amplification detection A type and influenza B virus |
| CN112941237A (en) * | 2021-03-25 | 2021-06-11 | 中国人民解放军军事科学院军事医学研究院 | CRISPR nucleic acid detection kit for specifically detecting H7N9 avian influenza A virus |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102978282A (en) * | 2012-11-14 | 2013-03-20 | 深圳市生科源技术有限公司 | Typhoid fever salmonella and salmonella paratyphi fluorescent quantitative polymerase chain reaction (PCR) detection kit and application thereof |
-
2013
- 2013-04-27 CN CN201310152230.5A patent/CN103225000B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102978282A (en) * | 2012-11-14 | 2013-03-20 | 深圳市生科源技术有限公司 | Typhoid fever salmonella and salmonella paratyphi fluorescent quantitative polymerase chain reaction (PCR) detection kit and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| KATERI BERTRAN等: "Pathogenesis and transmissibility of highly (H7N1) and low (H7N9) pathogenic avian influenza virus infection in red-legged partridge (Alectoris rufa)", 《VETERINARY RESEARCH》, vol. 42, no. 24, 31 December 2011 (2011-12-31), pages 1 - 9 * |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104017902A (en) * | 2014-03-21 | 2014-09-03 | 北京世纪元亨动物防疫技术有限公司 | RT-PCR (reverse transcription-polymerase chain reaction) primer pair and kit for detecting avian influenza virus N9 subtype and detection method thereof |
| CN104404172A (en) * | 2014-12-15 | 2015-03-11 | 中国医学科学院医学实验动物研究所 | Liquid chip detection kit for H7N9 subtype influenza viruses |
| CN110468238A (en) * | 2019-09-11 | 2019-11-19 | 深圳市芯思微生物科技有限公司 | A kind of primed probe group, kit and the application of constant-temperature amplification detection A type and influenza B virus |
| CN112941237A (en) * | 2021-03-25 | 2021-06-11 | 中国人民解放军军事科学院军事医学研究院 | CRISPR nucleic acid detection kit for specifically detecting H7N9 avian influenza A virus |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103225000B (en) | 2014-11-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2021196498A1 (en) | Primer, probe and kit for detecting novel coronavirus | |
| CN111254228B (en) | Kit for detecting novel coronavirus and influenza virus | |
| EP4012050A1 (en) | Composition, kit and method for detecting and typing viruses causing respiratory tract infection and application of composition, kit and method | |
| CN103275862B (en) | Fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR) kit for detecting influenza A virus subtype H7N9 | |
| EP4215624A1 (en) | Method and kit for multiple detection of respiratory virus nucleic acids | |
| CN101818207B (en) | Detection method and detection kit of influenza A virus, H1N1 and H3N2 subtype influenza virus | |
| CN103045755B (en) | A kind of fluorescent quantitative PCR detection method detecting Ebola virus and primer thereof and test kit | |
| CN111808989A (en) | Coronavirus/influenza virus/rhinovirus nucleic acid combined detection kit and use method thereof | |
| CN107326100A (en) | Aftosa and the double real-time fluorescence quantitative PCR detection kit of Sai Nika paddy virus | |
| CN109207639A (en) | Respiratory pathogen rapid fluorescence PCR detection kit and its primer combination of probe | |
| CN103225000B (en) | Bird flu H7N9 virus detection reagents and detection kit | |
| CN103255232B (en) | Dual fluorescence RT (Reverse Transcription)-PCR (Polymerase Chain Reaction) detection kit and method for avian influenza H7N9 virus | |
| CN101649356A (en) | Fluorescent quantitative detection kit of H1N1 influenza virus A and detection method thereof | |
| CN105950785A (en) | Ternary fluorescence RT-PCR detection kit of avian influenza virus, new castle disease virus and infectious bronchitis virus, primers and probes | |
| CN110343784A (en) | The composition and kit of quadruple influenza nucleic acids detection based on melting curve | |
| CN103320530B (en) | H1N1/H5N1 type avian influenza virus detection kit and application thereof | |
| CN102140557B (en) | Kit for rapidly and synchronously detecting nucleic acids of influenza virus A | |
| CN105200161A (en) | Real-time fluorescence RT-PCR method for quantitatively detecting human-infected avian influenza virus (A/H7N9) | |
| CN102071263A (en) | Nested fluorescence reverse transcription-polymerase chain reaction (RT-PCR) detection method for avian influenza virus (AIV) H5 subtype and detection kit | |
| CN115323075B (en) | RT-RAA primer probe group and kit for detecting infectious bronchitis viruses and genotyping and application of RT-RAA primer probe group and kit | |
| CN105671209A (en) | Primers, probe, kit and method for detecting bovine coronavirus | |
| CN105296675A (en) | Nucleic acid detecting kit for influenza B viruses and preparation method of nucleic acid detecting kit | |
| CN102912035B (en) | General purpose real-time fluorescent RT-PCR (reverse transcription-polymerase chain reaction) non-diagnostic method for Hantaan virus detection | |
| CN105936944A (en) | Triple fluorescent RT-PCR detection kit, primer and probe for CSFV, PRRSV and SIV H1 subtype | |
| CN102061340A (en) | II-type parainfluenza virus (PIV) fluorescence quantitative polymerase chain reaction (PCR) kit and detection method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| PE01 | Entry into force of the registration of the contract for pledge of patent right |
Denomination of invention: Avian influenza h7n9 virus detection reagent and detection kit Effective date of registration: 20220217 Granted publication date: 20141105 Pledgee: Shenzhen hi tech investment small loan Co.,Ltd. Pledgor: SHENZHEN UNI-MEDICA TECHNOLOGY Co.,Ltd. Registration number: Y2022980001620 |
|
| PE01 | Entry into force of the registration of the contract for pledge of patent right |