CN103224935A - Paddy-rice-sourced senescence-signal-induced OsL2 promoter and application thereof - Google Patents

Abstract

The invention belongs to the technical field of genetic engineering, and specifically relates to a paddy-rice-sourced senescence-signal-induced OsL2 promoter and an application thereof. The promoter provided by the invention is sourced from a paddy rice leaf senescence-associated gene (paddy rice gamma-aminobutyric acid transaminase coding gene) OsL2 with a DNA sequence represented by SEQ ID No.1. A nucleic acid sequence coding a target product gene is subjected to segment fusion with the promoter segment, such that a recombinant DNA is obtained. In a transgenic plant obtained by conversion by using the recombinant DNA, target gene expression is induced by senescence signals. With the promoter provided by the invention, target gene expression can be promoted under the induction of senescence signals. The promoter provided by the invention can be used in transgenic improvement of yield and characteristics.

Description

A kind of OsL2 promotor and application thereof of being subjected to old and feeble signal induction that derives from paddy rice

Technical field

The invention belongs to gene engineering technology field, be specifically related to a kind of promotor that is subjected to old and feeble signal induction and application thereof that derives from paddy rice.

Background technology

Promotor is that RNA polymerase can be discerned and combination with it, thereby the section of DNA sequence that initial gene is transcribed is usually located at upstream region of gene.A typical promotor comprises CAAT-box and TATA-box, and they are respectively identification and the binding sites that relies on the RNA polymerase of DNA, generally are positioned at tens base places, transcription initiation site upstream.Usually have some special dna sequence dnas in the core promoter upstream, i.e. cis-acting elements, thus transcription factor is with it in conjunction with activating or the transcribing of suppressor gene.In case RNA polymerase location also is combined on the promotor and can transcribes by promotor gene, so promotor is the critical elements of gene expression regulation, and with the interaction of trans-acting factors such as RNA polymerase and other albumen cofactors.Start the pattern of transcribing according to promotor and it can be divided into 3 classes: constitutive promoter, tissue or organ specific promoters and inducible promoter [wait quietly on the road, natural science progress 14(8): 856-862,2004].

Compare with the tissue and organ specificity promotor with constitutive promoter, inducible promoter has special advantages: it can be as required under specific etap of plant, histoorgan or growing environment, the Push And Release of rapid induction genetic transcription.According to the source, inducible promoter can be divided into natural inducible promoter and artificial constructed inducible promoter [wait quietly on the road, natural science progress 14(8): 856-862,2004].The promotor of natural induction type comprise light, temperature, hormone, arid, high-salt stress, pathogenic bacteria reply promotor etc. [wait quietly on the road, natural science progress 14(8): 856-862,2004; Narusaka Y, et al, Plant J, 34(2): 137-148,2003; Song FM, et al, Gene, 290:115-124,2002].Research at present at most, but the most deep artificial abduction delivering system is chemical-inducible expression systems, GR system, estradiol inductive ER system, sterilant inductive EcR (the Gatz C of system as tsiklomitsin inductive TetR system, induced by dexamethasone, et al, Proc Nalt Acad Sci USA, 1988,85:1394-1397; Aoyama T, et al, Plant J, 1999,11:605-612; Zuo J, et al, Plant J, 2000,24:265-273; Unger E, et al, Transgenic Res, 2002,11:455-465).

In order to realize the target of blade function period regulation, Gan and Amasino(Inhibition of leaf senescence by autoregulated production of cytokinin, Science, 270:1986-1988,1995) with a promotor and a synthetic key gene of phytokinin that comes from the old and feeble positive regulating gene of Arabidopis thaliana IPT(prenyltransferase) merges, and made up a special exogenous gene expression self-feedback of aging and strengthened the expression fusion vector, changes this fusion vector over to tobacco, and transgene tobacco has showed the phenotype of leaf senile delay of progression.[A senescence-inhibition chimeric gene was transferred into rice by the biolistic method and expressed such as Fu Yongcai, J Agr Biotech(Journal of Agricultural Biotechnology), 7(1): 17-22,2000] change this fusion vector over to paddy rice, cultivated the new strain of the paddy rice that prevents early ageing system.Utilize the agrobacterium tumefaciens infection method that this fusion gene is imported green vegetables, transgenosis green vegetables chlorophyll content height, the old and feeble delay, for the cultivation of high yield and high quality novel vegetable kind provides a kind of [Yuan Zheng etc. of technological approaches efficiently, Mol.Biol., 28(5): 379-384,2002].

OsL2(Os04g0614600, AF251073, AK102306) is the gene of paddy rice coding γ-An Jidingsuan transaminase, mediation γ-An Jidingsuan (GABA) is converted into L-Ala (Alanine) with pyruvic acid (Pyruvate) simultaneously to the process of succinic acid semialdehyde (Succinic semialdehyde). OsL2Expression amount is very low in the tender and sophisticated blade of children, but significantly improves in the blade in old and feeble each stage.OsL2 has tissue expression specificity, and accumulation in a large number in blade does not obviously accumulate (Mohammad, et al, Physiologia Plantarum, 123:1-8,2005) but all has at root, stem, in spending.

The present invention is the old and feeble signal induction that is subjected to that comes from paddy rice OsL2Promoter fragment separates and functional verification.This promoter fragment can be used to make up output, quality and the resistance genes involved specifically expressing system in the old and feeble stage that drives.The advantage of this expression system is to make goal gene show significant high reactivity when plant senescence, shows low activity in not old and feeble period, is the gene expression regulation mode of conditional.Therefore, there is conspicuous application potential in this abduction delivering system in the transgene improvement of field crop.

Summary of the invention

The object of the present invention is to provide a kind of promotor that is subjected to old and feeble signal induction and application thereof that derives from paddy rice.

The promotor that is subjected to old and feeble signal induction that derives from paddy rice provided by the invention derives from rice leaf senescence-associated gene (being paddy rice γ-An Jidingsuan transaminase encoding gene) OsL2, its dna sequence dna is shown in the SEQ ID NO:1.

The present invention also provides the recombinant DNA carrier of the dna sequence dna shown in a kind of SEQ of including ID NO:1, this recombinant DNA carrier contain described dna sequence dna as promotor, link to each other with this promotor be the coding goal gene dna sequence dna.

The present invention also provides the clone of the recombinant DNA carrier of the dna sequence dna shown in the described SEQ of the including ID NO:1.

The present invention also provides the application of described promotor, is about to described recombinant DNA carrier and transforms vegetable material acquisition transgenic plant, and these transgenic plant are induced purpose product expression of gene under the effect of old and feeble signal.Particularly, the invention provides a kind of goal gene product that causes and express the method that increases in plant, concrete steps are:

A) transform plant with described recombinant DNA carrier;

B) the time aerial expression that increases the goal gene product that utilizes old and feeble signal to make that transgenic plant are being expected.

The present invention also provides described promotor to start and process at the regulation and control leaf senile, and drives old and feeble stage specifically expressing and application crop yield quality trait improvement related gene expression aspect.Experiment shows, thereby promotor of the present invention is delaying leaf senile improvement crop yield and quality trait, drives high added value product gene at the specifically expressing in old and feeble stage, and there is very big using value aspect such as improvement vegetables with green leaves postharvest storage.

Description of drawings

Fig. 1 OsL2The cis element analysis of upstream region of gene promoter sequence.

The phenotype of the stripped dark place reason of Fig. 2 rice leaf.

Fig. 3 rice leaf exsomatizes in the reason process of dark place OsL2Expression conditions.

Under Fig. 4 naturally-aged and the dark place reason, the instantaneous conversion checking of promoter activity.

Fig. 5 PCAMBIA1301-OsL2Serial carrier makes up synoptic diagram.

Fig. 6 different lengths is segmental OsL2The structure of promotor.

Embodiment

Embodiment 1: OsL2The component analysis of upstream region of gene promoter fragment

The present invention does the cis element analysis by PlantCARE (http://bioinformatics.psb.ugent.be/webtools/ plantcare/html/) on-line analysis instrument to the promoter fragment of being cloned.Analytical results according to PlantCARE, contain multiple cis-regulating element (Fig. 1) in the 1738bp promoter sequence of being cloned, comprise mainly that wherein light response element is (as G-Box, GT1-motif, Box 4, Box I, CATT-motif, GAG-motif, LAMP-element, Sp1, chs-CMA2a, ACE, ATC-motif, MNF1 etc.), element relevant such as ABRE with dormin, the element relevant with methyl jasmonate (MeJA) is (as CGTCA-motif, TGACG-motif etc.), the element relevant with Plant hormones regulators,gibberellins is (as GARE-motif, TATC-box etc.), element relevant such as TCA-element with Whitfield's ointment, the element relevant with growth hormone is (as AuxRR-core, TGA-element etc.) etc.

Embodiment 2: paddy rice OsL2The acquisition of upstream region of gene promoter fragment

2.1 the stripped dark place reason of rice leaf

Be taken at 16h L/8h D illumination, cultivate 40 days rice leaf under 28 ℃ of conditions, in the dark manage sampling (Fig. 2) in 0,1,2,4,6,8 day respectively.

2.2 RNA extracts

The about 0.1g of water intaking rice material.After liquid nitrogen fully grinds, transfer to the 1.5ml centrifuge tube, add 1ml TRIzol (invitrogen company), behind the mixing, room temperature was placed 15 minutes, added the 0.2ml chloroform: primary isoamyl alcohol (24:1), acutely shake after 15 seconds room temperature and placed 5 minutes, 13000rpm, 4 ℃ are centrifugal 15 minutes.Get supernatant liquor and add the equal-volume Virahol, careful mixing, room temperature was placed 15 minutes, 13000rpm, 4 ℃ are centrifugal 15 minutes.70% washing with alcohol precipitation, drying at room temperature 15 minutes.Be dissolved in an amount of ddH that handled through 0.1% DEPC ₂In the O water, be stored in-80 ℃ standby.

2.3 cDNA first chain is synthetic and reverse transcription PCR

Adopt the cDNA first chain synthetic agent box of Shen, Shanghai energy lottery industry biotech company (SHBC), total RNA reverse transcription is become cDNA according to operational guidance.Reaction system and reaction conditions are respectively: total RNA of 2 μ g preparation, and 0.5 μ l Rnase inhibitor adds deionized water to the 8.5 μ l that DEPC handled, the Oligo of 2 μ l (dT), 18 primer, 65 ℃, 5min, room temperature is placed 10min, the brief centrifugal 5s of 13000rpm.Add 4 μ l, 5 * First-Strand buffer more successively, 0.5 μ l RNase Inhibitor, 2 μ l 100mM DTT, 2 μ l dNTP, 1 μ l MMLV Reverse Transcriptase.Careful mixing; 37 ℃ of reverse transcriptions 1 hour, 90 ℃ 5 minutes; Cooled on ice; 13000rpm of short duration centrifugal 5 seconds, deposit in-20 ℃.The cDNA that obtains can be used for the detection of related gene expression amount.

2.4 rice leaf exsomatizes in the reason process of dark place OsL2Expression conditions

We utilize RT-PCR to detect OsL2Expression of gene situation [OsL2 S 5 ' CACACGGACTGCCC TCACTACT 3 ' (SEQ ID NO:2), OsL2 AS 5 ' ACACCACCAGCACCCATCACA 3 ' (SEQ ID NO:3)].Fig. 3 shows OsL2Gene expression dose in rice leaf exsomatizes dark place reason process, rise significantly.

2.5 OsL2The vector construction of gene promoter

Design primer: OsL2 S 5 ' GATGGACCGAATGAACAAGGA 3 ' (SEQ ID NO:4), OsL2 AS 5 ' CTTGCACAGCTCCAACCTC 3 ' (SEQ ID NO:5), genomic dna with the paddy rice wild-type is a template, the segmental promotor of the corresponding length that increases, the PCR product is inserted the T carrier, after order-checking is correct, with BamHI and NcoI it is downcut from the T carrier, be connected and transformed into escherichia coli with same pCAMBIA1301 binary vector through BamHI and NcoI double digestion, select positive colony, behind the extracting plasmid, with electric shocking method the positive colony plasmid is transformed Agrobacterium (GV3101), and identify positive transformant, select positive transformant and in the YEB liquid nutrient medium of three anti-(Rif+Gent+Kan), shake bacterium, glycerine with 30% is protected bacterium with volume ratio 1:1, deposit in-80 ℃ standby.

2.6 common experimental method in the vector construction

2.6.1 DNA digestion with restriction enzyme

(1) 20 μ l enzyme is cut system, 2 μ l DNA, an amount of enzyme cutting buffering liquid (referring to the Takara catalogue), enzyme amount (0.2 μ l enzyme is used for enzyme and cuts evaluation, and 0.5 μ l enzyme is used for enzyme cutting clone).System enlarges, and scales up respectively to become partial volume;

(2) add water, buffer, DNA, enzyme in the following order, mixing, 37 ℃ of reaction 1.5-3h.(adding restriction endonuclease at last).

2.6.2 glass powder is made and glass powder reclaims dna segment

Glass powder is made

(1) with clean mortar quartz sand is ground to enough carefully, gets sizeable glass powder particles with the sieve sieve;

(2) with the long-pending sterilized water suspension glass powder of monoploid, leave standstill a moment;

(3) when layering occurring, draw the muddy liquid in upper strata to new centrifuge tube, lower sediment repeats 2,3 operations;

(4) 2000-3000rpm, 1min is centrifugal, removes supernatant;

(5) after the sterile water wash degerming, with the 1:1 ratio with the sterilized water glass powder that suspends.

Glass powder reclaims dna segment

(1) claim empty centrifuge tube weight, cut glue after, weigh again, calculate the weight of glue;

(2) add NaI to add 3ul volume 6mol/L NaI ratio in the 1mg glue, fully dissolving in 55 ℃ of baking ovens or the water-bath;

(3) add 5-10ul glass powder, mixing fully suspends;

(4) ice bath 15min, centrifuge tube is flicked every 5min in the centre, and sedimentary glass powder is suspended;

(5) 7000rpm, 1min is centrifugal, abandons supernatant;

(6) 50 times of glass powder volumes add Rince buffer and fully blow and beat washing;

(7) 5000rpm, 1min is centrifugal, repeats 6,7 twice again;

(8) remove most buffer, volatilization ethanol 5-10min in 55 ℃ of water-baths or the baking oven;

(9) piping and druming of 10-20ulMili-Q water suspends, and Votex fully vibrates;

Dissolving DNA 15min in (10) 55 degree baking ovens or the water-baths is every 5min mixing gently;

(11) 13000rpm after 2min is centrifugal, gets supernatant.

New wash stock solution:20 * rince buffer:H2O: dehydrated alcohol=1:9:10

20×rince buffer: 0.2mol/L Tris-Cl（pH7.5），1mol/L NaCl，20mmol/L EDTA

Ethanol sedimentation reclaims dna segment

(1) the 3M NaAc(enzyme system of cutting that adds 1/10 volume is used earlier equal-volume phenol: chloroform extracting albumen);

(2) add 2V-20 ℃ pre-cooled ethanol, place 30 min on ice;

(3) 12000 rpm, centrifugal 10 min;

(4) 1 ml 70% washing with alcohol precipitation, 55 ℃ of oven dry are dissolved in TE.

2.6.3 carrier is connected with gene fragment

Connect damping fluid 5.5 μ l

Insert fragment 3.0 μ l

T4 ligase enzyme 1.0 μ l

Enzyme is cut back carrier 0.5 μ l

16 ℃ of connections are spent the night.

2.6.4 competent cell preparation and conversion

Bassoon prepares competent cell

(1) with the ratio switching activatory bacterial classification evening before yesterday of 1:100,280rpm cultivates OD value 0.3 in 37 ℃ of shaking tables, and what this experiment was adopted is intestinal bacteria Top10Strain system;

(2) nutrient solution is poured into the 50ml centrifuge tube, precooling a little on ice, 4000rpm, 10min is centrifugal;

(3) outwell supernatant, add the calcium chloride of 10ml 0.1mol/L CaCl2, break up the bacterium piece gently;

(4) place 30min on ice, 2500rpm, 10min centrifugal (it is good that ring-type appears in centrifuged deposit);

(5) outwell supernatant, be placed into fast on ice, add 2ml 0.1mol/L CaCl2, thalline gently suspends;

(6) be placed on ice, promptly can be used to after 2 hours transform.

Transform

(1) prepares 42 ℃ of water-baths;

(2) with the 200ul competent cell be connected liquid (5-10ul) or plasmid (1ul) joins in the centrifuge tube mixing;

(3) behind the ice bath 30min, 42 ℃ of heat shock 90s are placed on 5min on ice;

(4) transform the direct coated plate of plasmid;

(5) transform the SOC nutrient solution that connects 2 times of cell volumes of liquid adding, 37 ℃ of shaking table 50-100rpm cultivate (Amp resistance 1 hour, Kan, Cm resistance 2 hours) in advance, and what this experiment was adopted is the Kan resistant panel;

(6) get the 200ul mixture and be coated in and contain on a certain amount of antibiotic LB flat board, be inverted overnight incubation for 37 ℃;

(7) next day, obtained positive colony by resistance screening morning.

2.6.5 plasmid extraction

(1) choosing single bacterium colony shakes bacterium and spends the night to containing in a certain amount of antibiotic LB liquid nutrient medium 37 ℃;

(2) get 1ml bacterium liquid, 12000rpm collected thalline in 30 seconds, collected twice;

(3) add the solution I suspension thalline of 100ul ice precooling, add the 200ul solution II, the mixing that turns upside down adds the solution III of 150ul precooling again, and the mixing that turns upside down placed 5 minutes on ice;

(4) 12000rpm is centrifugal 3 minutes, shifts supernatant in new 1.5ml centrifuge tube;

(5) add equal-volume phenol: the chloroform extracting once, 12000rpm 3 minutes, gets phase;

(6) add the dehydrated alcohol that 2 times of volumes are iced precooling, mixing was placed on 30 minutes on ice;

(7) 12000rpm is centrifugal 5 minutes, removes supernatant, precipitates with 70% washing with alcohol;

Dried 5 minutes, and be dissolved in 50ul TE(pH 8.0 for (8) 55 ℃), add 0.5ugRNase, 37 ℃ digested 30 minutes.-20 ℃ of preservations.

Solution I: 50 mmol/L glucose, 25 mmol/L Tris-Cl, pH 8.0; 10 mmol/L EDTA, pH 8.0, autoclaving

Solution II: 0.2 mol/L NaOH, 1%SDS(is now with the current, can not place on ice)

Solution III: per 100 ml, 60 ml, 5 mol/L potassium acetates, 11.5 ml glacial acetic acids, 28.5 ml deionized waters

Embodiment 3: the instantaneous conversion checking of promoter activity

Tobacco with the illumination cultivation of isometric growth phase is contrast, and tobacco was carried out complete stool dark place reason 2 days, then injects sampling dyeing after 2 days; Under the illumination cultivation condition, be contrast, the naturally-aged blade that the part begins to turn to be yellow is injected, sampling dyeing after 2 days with the tender tobacco leaf of children.Experimental result shows that instantaneous commentaries on classics has carrier POsL2-pCAMBIA1301Tobacco material dark induce with the naturally-aged blade in GUS dyeing all darker, and contrast does not see substantially that all tangible GUS dyeing (Fig. 4) is arranged.According to above result, we have carried out the promotor truncated segment to promoter sequence and have analyzed (Fig. 5,6).

Embodiment 4: OsL2The application of old and feeble evoked promoter

Of the present invention OsL2Aging induces evoked promoter to be building up in the plant expression vector with method well known in the art.For the ease of to changeing OsL2The cell of evoked promoter or plant are identified and screen, can process employed carrier, as add the alternative mark of plant ( BARGene, GUSGene, luciferase gene etc.).By the plant transformed host both can be monocotyledons, as paddy rice, corn, wheat and turfgrass etc., also can be dicotyledons, as soybean, cotton and willow etc., but was not limited to above-mentioned species.Carry of the present invention OsL2The expression vector of inducible promoter can be by means of Ti-plasmids, Ri plasmid, plant viral vector, microinjection, electricity is led and method mediated transformation vegetable cell or tissues such as Agrobacterium, and transformation receptor cultivated into plant, to obtain the breeding resource material that crop yield and quality trait are significantly improved.

＜110〉Fudan University

＜120〉a kind of OsL2 promotor and application thereof of being subjected to old and feeble signal induction that derives from paddy rice

<130> 001

<160> 5

<170> PatentIn version 3.3

<210> 1

<211> 1738

<212> DNA

＜213〉paddy rice (Oryza sativa) kind Japan fine (Japonica)

<400> 1

gatggaccga atgaacaagg agtccaaaat caagagttga cgaaagcaag gtatagcgtc 60

ttctcctcca tctcctccac aaatgaaatt ctatagtcga tcgctgctat cccaattcag 120

atcctctgca gtactgcata tgctggaccc cctcactcct gctatccaat tgagccgcca 180

accgccaccg cagaaggaaa ggggcacgtc gcctgatccg ttttaggggt taaaccataa 240

tatgatgaag agcgggggct tcacaagaaa aattcctcac caatgcttcc gagtgctacg 300

ccggtctgaa caaatttgat gggctcgtag aatttcaagc tgacgagacc gaccgagtga 360

caggtgagca gtgcaaacgg caaagcgtgt atcagcgcac atgatgatgc gaaacgctat 420

ctgcttggca ttcatctgca acttggcaac ttgatttgcg ggtgcgatgt actctctcca 480

ttaaaaaaaa acacacaaac actaagtttc cgtatttaac gtttgactgt gtattttata 540

taaatttttt ttataattag tatttttttt gttgttacat gataaaacat gattaatact 600

ttatacatga tttgtctttt tattttttta taattttttt aaataagaca aacagttaaa 660

cgttggaacg gaaactcaag gtttatcttt ttttttttgg aacggaggga gtattatttg 720

gtcacgagtg agcatgattt gattcgcaca agcacacctg aagtactgta ctccattttg 780

caaaatttct tcaaaatccg tgtgggacat taggcttcca aaaaaaaagg cacatgaact 840

tttgtttgaa tcaaacaact gccagggtgt actcaactac acatggcttc aattctgtag 900

acgccatctc tgcaagacaa tctagagagg gaaggagata aactcgtgac aaagcagaca 960

cgtgctcaat gcgtaacaag acacaagcgt ttgaacttgg attccctggc tacagtcatt 1020

aaaattaaat ttttccggaa gcaaacagtg catttaaaaa ccaaaagatc ttgctcaact 1080

tgattcgttt caaaaactga aatctattac ctccgtccac aaagagtgca gttttgtact 1140

tttcatattc aatgtttgat cgtccgtctt atttgaagat tttttatgat tagtattttt 1200

tataattaga tgataaaaca taaataatat ttaatgttta actatttttt aaaaataata 1260

taatttttta aattgacaga cggttaaatg ttgatataga agcaacgact tcacttgaat 1320

tagaatggag gtagtatttt ataagagcaa ttctacggtt cttgaggagg taccatgaga 1380

tactaaaaat ttagtataaa atttgatacc tcatggtatc tcatagtacc tagtactaat 1440

gaggtatcac tttttatctc ctcaagaacc ataaaattgc tcattttata attatccttt 1500

tttttctttt tttggttttg ggacacttca gctggagaag gagaagaaca gtctgcactc 1560

tgcacacgtc cccatctccc ccgtctctcc tgcgttctct tcgcctacct tacgataaac 1620

ttggccacgt ctcaatctct ctctctcgcg ctctcctctc cttctataat actcggcctc 1680

cccctcgctt ctcgctctgt ttctccgaga attagggggg aggttggagc tgtgcaag 1738

<210> 2

<211> 22

<212> DNA

<213>

<400> 2

cacacggact gccctcacta ct 22

<210> 3

<211> 21

<212> DNA

<213>

<400> 3

acaccaccag cacccatcac a 21

<210> 4

<211> 21

<212> DNA

<213>

<400> 4

gatggaccga atgaacaagg a 21

<210> 5

<211> 19

<212> DNA

<213>

<400> 5

cttgcacagc tccaacctc 19

Claims (6)

1. old and feeble signal induction that is subjected to that derives from paddy rice OsL2Promotor is characterized in that nucleotides sequence classifies as shown in the SEQ ID NO:1.

2. a recombinant DNA carrier is characterized in that this recombinant DNA carrier contains the described promotor of claim 1, and link to each other with this promotor be the coding goal gene dna sequence dna.

3. clone that comprises the described recombinant DNA carrier of claim 2.

4. the application of a recombinant DNA carrier as claimed in claim 2 is characterized in that described recombinant DNA carrier plant transformed material, and the plant that conversion has this recombinant DNA carrier is under the effect at old and feeble signal, and goal gene product level rises.

5. one kind causes that in plant the goal gene product expresses the method increase, it is characterized in that concrete steps are:

A) transform plant with the described recombinant DNA carrier of claim 2;

B) the time aerial expression that increases the goal gene product that utilizes old and feeble signal to make that transgenic plant are being expected.

6. promotor according to claim 1 starts and process at the regulation and control leaf senile, and drives old and feeble stage specifically expressing and application crop yield quality trait improvement related gene expression aspect.

Images