CN103223219A - CYP5013C2 protein and coding gene thereof, and tetrahymena expressing CYP5013C2 protein - Google Patents

Abstract

The invention discloses CYP5013C2 protein and coding gene thereof, and provides tetrahymena expressing the CYP5013C2 protein and an application of the tetrahymena in DDT degradation. According to the present invention, an application of the tetrahymena overexpressing the CYP5013C2 gene in DDT degradation is protected; the CYP5013C2 gene is the gene coding protein (a) or protein (B), wherein the protein (a) is protein comprising an amino acid sequence represented by a sequence 1 in the sequence table, and the protein (b) is the protein formed by carrying out substitution and/or deletion and/or addition of one or a plurality of amino acid residues on the amino acid sequence represented by the sequence 1, has the same function, and is derived from the sequence 1; and the recombinant tetrahymena has the following advantages that: (1) stress response of the CYP5013C2 gene to the DDT is specific and sensitive; (2) the CYP5013C2 genes involves in a DDT biotransformation process in tetrahymena cells; (3) the tetrahymena has an efficient DDT degradation function; (4) the DDT in a water body can be controlled in the bottom end of a food chain; and (5) environment pollution is not generated.

Description

CYP5013C2 albumen and encoding gene thereof and the tetrahymena of expressing CYP5013C2 albumen

Technical field

The present invention relates to a kind of CYP5013C2 albumen and encoding gene thereof, and tetrahymena and the application in degraded DDT thereof of expressing CYP5013C2 albumen is provided.

Background technology

DDT (DDT) is a kind of organochlorine insecticide, since the nineteen forty-two commercialization, has removed and has obtained remarkable effect aspect the lice killing mosquito, has prevented typhic popular.Technical grade DDT comprises two class isomers, and 70-80% is the p that active component is arranged, p'-DDT, and remaining is accessory substance o, p'-DDT, they can be metabolized to p respectively after entering organism, p'-DDE and p, p'-DDD, and o, p'-DDE and o, p'-DDD.Many studies show that, the DDT that sprays mainly enters water body by the rainwash mode, stick to immediately on hydrobiological body surfaces such as algae, zooplankter etc. are low and the cilium thereof, transportation by food chain and food web, DDT is at last at the higher organism body accumulation, to wild animal even humanly cause permanent harm (comprise breast cancer, diabetes, low sperm quality, spontaneous abortion, nervous system in children grow impaired etc.).

1972, Americanologist was crossed legislation and is banned use of DDT, and other country also begins to forbid DDT subsequently one after another.Calendar year 2001, " conference of plenipotentiaries on the stockholm convention on persistent organic pollutants " passed through in the united nations environment conference, listed 12 kinds of persistence organic pollutants (the persistent organic pollutant that demands urgently controlling that comprises DDT, POPs), more than 100 country signed this pact.Behind the DDT forbidding, malaria is staged a comeback again in part African country.In September, 2006, the World Health Organization announces the formal ban of removing DDT, allows some areas to reuse this pesticide.

DDT concentration in the global environment is the trend of continuous rising at present, and this mainly contains the source of the following aspects: (1) African part country still adopts DDT control malaria; (2) use the pesticide that contains DDT; 3) still use and undecomposed DDT as pesticide decades ago in release the ocean.In addition, DDT has the long half-life, is 0.25-15 in soil, is in human body 4 years.Therefore, though DDT uses in the Southern Hemisphere, because ocean current and atmospheric action, the concentration of DDT is also still rising in the ocean, the Northern Hemisphere.Compare with low temperature area, DDT is in the easier volatilization in high temperature area, and Atmospheric Flow effect has on a large scale caused the accumulation of DDT in high latitude area and polar region.So still there is serious threat in the DDT in the environment to wild animal and human health at present, and takes certain technological means that the DDT in the environment is carried out efficient degradation, for preserving the ecological environment and ensureing that human health has very important significance.

Summary of the invention

The purpose of this invention is to provide a kind of CYP5013C2 albumen and encoding gene thereof, and tetrahymena and the application in degraded DDT thereof of expressing CYP5013C2 albumen is provided.

The present invention protected the application of tetrahymena in degraded DTT of expressing the CYP5013C2 gene; Described CYP5013C2 gene is the gene of coding CYP5013C2 albumen; Described CYP5013C2 albumen is following (a) or (b): (a) protein of being made up of the amino acid sequence shown in the sequence in the sequence table 1; (b) with the amino acid sequence of sequence 1 through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and have the protein of deriving by sequence 1 of identical function.

Described CYP5013C2 gene is following 1) or 2) or 3) dna molecular: the 1) dna molecular of code area shown in sequence in the sequence table 2; 2) under stringent condition with 1) the dna sequence dna hybridization that limits and coding dna molecular with albumen of identical function; 3) with 1) dna sequence dna that limits has the dna molecular that 90% above homology and coding have the albumen of identical function.Described stringent condition is in the solution of 0.1 * SSPE(or 0.1 * SSC), 0.1%SDS, hybridization and wash film under 65 ℃ of conditions.

The tetrahymena that described mistake is expressed the CYP5013C2 gene is to import the reorganization tetrahymena that the dna fragmentation that contains described CYP5013C2 gene obtains in the tetrahymena that sets out.In the described dna fragmentation, drive described CYP5013C2 expression of gene by tetrahymena mtt1 gene promoter.Described dna fragmentation specifically can be the sequence 4 of sequence table is carried out the dna molecular that following transformation obtains from the double chain DNA molecule shown in 5 ' terminal the 2216th to 7096 nucleotides: sequence 4 is substituted by the nucleotides shown in the sequence 2 of sequence table from 5 ' terminal the 5713rd nucleotides to 6543 nucleotides.The described tetrahymena that sets out specifically can be tetrahymena thermophila B2086 strain system.

The present invention also protects the application of above arbitrary described CYP5013C2 gene in promoting tetrahymena degraded DTT.Described tetrahymena specifically can be tetrahymena thermophila B2086 strain system.

The present invention also protects dna fragmentation, recombinant vector or the reorganization tetrahymena that contains above arbitrary described CYP5013C2 gene.Described dna fragmentation specifically can be the sequence 4 of sequence table is carried out the dna molecular that following transformation obtains from the double chain DNA molecule shown in 5 ' terminal the 2216th to 7096 nucleotides: sequence 4 is substituted by the nucleotides shown in the sequence 2 of sequence table from 5 ' terminal the 5713rd nucleotides to 6543 nucleotides.Described recombinant vector specifically can be the recombinant plasmid that the CYP5013C2 gene obtains as described in the MCS of carrier PXS75 (between BamH I and Asc I restriction enzyme site) insertion.Described reorganization tetrahymena specifically can be described dna fragmentation is imported the reorganization tetrahymena that the tetrahymena that sets out obtains.The described tetrahymena that sets out specifically can be tetrahymena thermophila B2086 strain system.

Reorganization tetrahymena provided by the invention has the following advantages:

(1) CYP5013C2 gene pairs DDT coerce the response special and sensitive;

(2) the CYP5013C2 gene participates in DDT at the intracellular biotransformation of tetrahymena;

(3) has the function of efficient degradation DDT; The wild type tetrahymena that contains CYP5013C2 gene normal expression level 70% the DDT that in 4 hours, can degrade, and the transgenosis tetrahymena that contains the CYP5013C2 gene overexpression has the ability of the DDT that degrades more efficiently, its can degrade in 4 hours DDT of 91%;

(4) DDT in the water body can be controlled at the food chain bottom: the DDT of sprinkling mainly enters water body by the rainwash mode, tetrahymena then lives in the water body in the free swimming mode, therefore the transgenosis tetrahymena that contains the CYP5013C2 gene overexpression reaches in the food chain bottom and controls DDT to more high-grade organism transfer and enrichment by the DDT in the efficient degradation water body;

(5) free from environmental pollution: that 1 macronucleus and 1 small nut are arranged in tetrahymena thermophila's cell, the tetrahymena of different mating types is through the zoogamy process, exercise the macronucleus chromosome of vital movement function in the filial generation tetrahymena and grow, the then whole apoptosis of the former parent's macronucleus chromosome in the filial generation tetrahymena from parent's small nut chromosome; The transgenic fragment of transgenosis tetrahymena is positioned on the macronucleus chromosome, the transgenosis tetrahymena can be lost transgenic fragment after experience zoogamy process, genetically modified organism disappears, so genetically modified organism can not cause permanent interference to aquatic ecosystem, does not also just pollute the environment.

More than arbitrary described DDT specifically can be p, p'-DDT.

The present invention also protects a kind of protein, for following (a) or (b): (a) protein of being made up of the amino acid sequence shown in the sequence in the sequence table 1; (b) with the amino acid sequence of sequence 1 through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and have the protein of deriving by sequence 1 of identical function.

The present invention also protects the gene of code for said proteins, is following 1) or 2) or 3) dna molecular: the 1) dna molecular of code area shown in sequence in the sequence table 2; 2) under stringent condition with 1) the dna sequence dna hybridization that limits and coding dna molecular with albumen of identical function; 3) with 1) dna sequence dna that limits has the dna molecular that 90% above homology and coding have the albumen of identical function.Described stringent condition is in the solution of 0.1 * SSPE(or 0.1 * SSC), 0.1%SDS, hybridization and wash film under 65 ℃ of conditions.

The present invention is for preserving the ecological environment and ensureing that human health has very important significance.

Description of drawings

Fig. 1 is among the embodiment 1, adopts the p of each concentration, and p'-DDT handles the growth curve of tetrahymena down.

Fig. 2 is among the embodiment 3, relative expression's level of tetrahymena CYP5013C2 gene.

Fig. 3 is among the embodiment 4, the photo that CYP5013C2 albumen is located in cell.

Fig. 4 is among the embodiment 5, the schematic flow sheet of gene silencing.

Fig. 5 is among the embodiment 6, the structural representation of recombinant plasmid OECYP5013C2_PXS.

Fig. 6 is among the embodiment 7, the growth curve of tetrahymena.

Fig. 7 is the result of embodiment 8.

The specific embodiment

Following embodiment is convenient to understand better the present invention, but does not limit the present invention.Experimental technique among the following embodiment if no special instructions, is conventional method.Used test material among the following embodiment if no special instructions, is to buy from routine biochemistry reagent shop and obtains.Quantitative test in following examples all is provided with repeated experiments three times, results averaged.

Tetrahymena thermophila (Tetrahymena thermophila) SB210 strain system: be so kind as to give list of references by Eduardo professor Orias of University of California at Santa Barbara: Eisen JA, Coyne RS, Wu M, Wu D, Thiagarajan M, Wortman JR, Badger JH, Ren Q, Amedeo P, Jones KM, Tallon LJ, Delcher AL, Salzberg SL, Silva JC, Haas BJ, Majoros WH, Farzad M, Carlton JM, Smith RK Jr, Garg J, Pearlman RE, Karrer KM, Sun L, Manning G, Elde NC, Turkewitz AP, Asai DJ, Wilkes DE, Wang Y, Cai H, Collins K, Stewart BA, Lee SR, Wilamowska K, Weinberg Z, Ruzzo WL, Wloga D, Gaertig J, Frankel J, Tsao CC, Gorovsky MA, Keeling PJ, Waller RF, Patron NJ, Cherry JM, Stover NA, Krieger CJ, del Toro C, Ryder HF, Williamson SC, Barbeau RA, Hamilton EP, Orias E.Macronuclear genome sequence of the ciliate Tetrahymena thermophila, a model eukaryote.Plos Biol.2006.4 (9): e286.); Can from the National Tetrahymena Stock Center ( Http:// tetrahymena.vet.cornell.edu/index.html) buy.

Tetrahymena thermophila B2086 strain system: professor Bruns of Cornell University present, list of references Jacek Gaertig and Martina A.Gorovaky.Efficient mass transformation of Tetrahymena thermophila by electroporation of conjugants.Proc.Natl.Acad.Sci.USA.1992.89 (19): 9196-9200.; Can be from the National Tetrahymena Stock Center( Http:// tetrahymena.vet.cornell.edu/index.html) buy.

PNeo4 carrier: by professor Mochizuki of molecular engineering research institute of Austria Wirtschaftsserv GmbH present, list of references Mochizuki K.High efficiency transformation of Tetrahymena using a codon-optimized neomycin resistance gene.Gene.2008.425 (1-2): 79-83..

P, p'-DDT:Supelco, the U.S., production code member: N12810, structural formula is as follows:

TCDD:Sigma, the U.S., production code member: QC1373.

SPP culture medium: 1%proteose peptone(BD, the U.S., production code member: 211693), 0.1% yeast extract, 0.2% glucose, and 0.003% iron edta sodium salt (EDTA ferric-sodium salt, Sigma, the U.S., production code member: E6760-100G).

The growth curve of wild type tetrahymena under embodiment 1, the variable concentrations DDT treatment conditions

1, with p, p'-DDT is dissolved in DMSO, obtains the mother liquor that concentration is 0.1M, and 4 ℃ keep in Dark Place.

2, be to be seeded in the 20mL SPP culture medium with the 2mL tetrahymena thermophila SB210 strain of exponential phase early, making the cell concentration of tetrahymena thermophila SB210 strain system is 3 * 10 ⁴Individual cell/mL.

3, the mother liquor of step 1 preparation is adjusted with DMSO added to after the concentration in the system that step 2 obtains, make p, the concentration of p'-DDT is respectively 0.25,1,4,16,64 or 256mg/L, and the contrast of inoculation equal-volume DMSO is set.

4,30 ℃ of the systems that step 3 is obtained, 90rpm shaken cultivation respectively at sampling 200 μ L after 0,3,6,9,12,24,36 or 48 hour, are counted with cell counter, make growth curve.

Tetrahymena is exposed in the DDT environment of 0-256mg/L concentration range and all can survives, and shows that ability of its tolerance DDT will be far above other zooplankter.

Adopt the p of each concentration, p'-DDT handles, and growth curve is seen Fig. 1.From the growth curve of tetrahymena as can be known: the lag phase of tetrahymena is 0-3 hour, and be 3-24 hour exponential phase of growth, and be 24-48 hour resting stage.

According to the growth curve result of tetrahymena, with Gompertz formula Log N _t=A+C * exp{-exp[-B * (t-M)] } set up the corresponding growth model of tetrahymena, wherein: Nt represents the cell density of particular point in time, A represents initiator cell density, C represents that the cell density between resting stage and the lag phase is poor, B represents maximum growth rate, and M represents the maximum growth rate of particular point in time, and t represents particular point in time, each concentration p, the growth model of tetrahymena sees Table 1 under the p'-DDT treatment conditions.From growth model, calculate each DDT concentration and handle the tetrahymena generation time down that (generation time does not have significant difference (P〉0.05) between GT).In view of the above, hypothesis can be proposed: may exist relevant gene to resist coercing of DDT in the tetrahymena body.

Table 1 tetrahymena is at variable concentrations p, the growth model under the p'-DDT exposure condition

P, p '-DDT treatment conditions	Growth model
		Omg/L	LogN t=4.48537+1.85829×exp{-exp[-0.08747×(t-1.99305)]}
0.25mg/L	LogN t=4.49101+1.844×exp{-exp[-0.08728×(t-2.71354)]}
		lmg/L	LogN t=4.48572+1.84934×exp{-exp[-0.08971×(t-2.45045)]}
4mg/L	LogN t=4.48749+1.82837×exp{-exp[-0.08885×(t-3.27701)]}
		16mg/L	LogN t=4.48501+1.82088×exp{-exp[-0.08806×(t-3.04398)]}
64mg/L	LogN t=4.48608+1.7909×exp{-exp[-0.09407×(t-3.65182)]}
		256mg/L	LogN t=4.48608+1.7737×exp{-exp[-0.08909×(t-5.71825)]}

Embodiment 2, from tetrahymena the screening can resist the gene that DDT coerces

Get tetrahymena thermophila CU428 strain system, carry out the analysis of full genomic gene expression chip, with ArrayStar2.0 software computational analysis is carried out in gene expression, with equal volume DMSO treatment samples is control group, filter out DDT and expose the gene that raises or reduce down more than 2 times, find that CYP5013C2 expression of gene level obviously raises under DDT exposes.CYP5013C2 albumen is as described in the sequence 1 of sequence table, and the CYP5013C2 gene is shown in the sequence 2 of sequence table.Amino acid code is distinguished to some extent with other species in tetrahymena, and terminator codon has three kinds (tga, tag and taa) in other species, but has only a terminator codon (tga) in the tetrahymena, tag and the taa glutamine of all encoding.

Embodiment 3, real-time quantitative PCR detect relative expression's level of tetrahymena CYP5013C2 gene

With the p of 4mg/L concentration, the p'-DDT(cultivating system adopts the SPP culture medium) or the TCDD(cultivating system of 1 μ g/L concentration adopt the SPP culture medium) handle exponential phase (3 * 10 early respectively ⁵The tetrahymena thermophila SB210 strain of individual cell/mL) is 24 hours, organizes in contrast with the DMSO of equal volume.

Extracting total RNA and reverse transcription is cDNA, is template with cDNA, and the primer of forming with F1 and R1 is to carrying out real-time quantitative PCR, with Opticon Monitor3 software collection data.Use the variation of the genes of interest relative expression level of Relative Expression Software Tool (REST) software analysis after 17S rDNA proofreaies and correct, its Mathematical Modeling is based on pcr amplification threshold cycle between sample and control group and counts threshold cycle(Ct) the difference size, with the conspicuousness (P＜0.05) of ANOVA check genes of interest relative expression level.

F1：5'-AGTGATTATTGCCTCATTCTTTGG-3'；

R1：5'-TGTTCTTCAGTAACCCCTAATTCG-3'。

The results are shown in Figure 2.The result shows: the CYP5013C2 gene has specificity for the response of DDT; Under the DDT exposure condition, the CYP5013C2 gene expression dose is with respect to (DMSO) in the same old way improved 15 times.

Embodiment 4, CYP5013C2 albumen are in intracellular location

Genes of interest is substituted into process in the expression vector fast by homologous recombination, is according to pENTR ^TMDirectional

Cloning Kits(Invitrogen),

LR Clonase ^TMII Enzyme Mix(Invitrogen) people (Yao MC such as specification and Yao, Yao CH, Halasz LM, Fuller P, Rexer CH, Wang SH, Jain R, Coyne RS, Chalker DL.Identification of novel chromatin-associated proteins involved in programmed genome rearrangements in Tetrahymena.J.Cell Sci.2007.120 (Pt12): method of operating 1978-1989.) is set up.

(Fig. 3 a) with ZEISS microscope (Zeiss Axioplan2imaging micro imaging system) (optical filter FITC) under green exciting light the CYP5013C2 protein positioning of inducing cell to be carried out fluoroscopic examination, (optical filter FITC) carries out fluoroscopic examination (Fig. 3 b) to the nucleus location of inducing cell under blue excitation light, under ordinary optical microscope, observe the form (Fig. 3 c) of tetrahymena, with the supporting digital imaging system Taking Pictures recording of ZEISS microscope.

The result shows that the CYP5013C2 albumen of CYP5013C2 coded by said gene is positioned the endoplasmic reticulum of tetrahymena cell.Can propose hypothesis: tetrahymena CYP5013C2 albumen may participate in xenobiontics at intracellular biotransformation.

The structure of embodiment 5, the strain of tetrahymena CYP5013C2 gene silencing

The schematic flow sheet of gene silencing is seen Fig. 4.Obtain the CYP5013C2 gene 5' flanking region of 1.33kb with primer CYP5013C2_5f and CYP5013C2neo_5r amplification, obtain the neo4 gene with primer neo4_f and neo4_r amplification, obtain the CYP5013C2 gene 3' flanking region of 1.06kb with primer CYP5013C2neo_3f and CYP5013C2_3r amplification, last nested primer CYP5013C2nest_f and CYP5013C2nest_r couple together CYP5013C2 gene 5' flanking region, neo4 gene, these 3 fragments of CYP5013C2 gene 3' flanking region, obtain the junction fragment of 4.39kb length.Junction fragment enters in the tetrahymena thermophila B2086 strain system by the particle gun transfection, under paromomycin drug screening, chooses that tetrahymena is unicellular to obtain pure transformant, is the strain of tetrahymena CYP5013C2 gene silencing.

One, preparation splicing fragment

CYP5013C2_5f：5'-TTCATCTACTTTCTTCAACCATTCA-3'；

CYP5013C2neo_5r：

5'- GTGTATTTAAATTAAAGGAGTTATTCTTCTCCTAAGATAGGATAGTAAAATC-3'。

neo4_f：5'-GAATAACTCCTTTAATTTAAATACAC-3'；

neo4_r：5'-GCATTTTTCCAGTAAAAATTTG-3'。

CYP5013C2neo_3f：

5'- CAAATTTTTACTGGAAAAATGCATGATTATTATTAATTATTATAATTT-3'；

CYP5013C2_3r：5'-ATCGGCTAAATAAATATCTGATAATG-3'

CYP5013C2nest_f：5'-CATCTACTTTCTTCAACCATTCAATAA-3'；

CYP5013C2nest_r：5'-ATGATGAGCATGAAATAATAGGAAATA-3'。

Underscore mark neo4 gene bridging part among the CYP5013C2neo_5r.CYP5013C2_5f and CYP5013C2neo_5r form primer to A, and CYP5013C2 gene 5' flanking region is used to increase.

Neo4_f and neo4_r form primer to C, and the neo4 gene is used to increase.

Underscore mark neo4 gene bridging part among the 5'-CYP5013C2neo_3f.CYP5013C2neo_3f and CYP5013C2_3r form primer to B, and CYP5013C2 gene 3' flanking region is used to increase.

The primer of CYP5013C2nest_f and CYP5013C2nest_r composition is to being used to be connected CYP5013C2 gene 5' flanking region, neo4 gene and CYP5013C2 gene 3' flanking region.

1, the genomic DNA with tetrahymena thermophila SB210 strain system is a template, with the 5' flanking region of primer to A amplification CYP5013C2 gene.

2, the genomic DNA with tetrahymena thermophila SB210 strain system is a template, with the 3' flanking region of primer to B amplification CYP5013C2 gene.

3, be template with the pNeo4 carrier, with primer to C amplification neo4 gene.

4, be template with the pcr amplification product of step 1, the pcr amplification product of step 2 and the pcr amplification product of step 3 simultaneously, the primer of forming with CYP5013C2nest_f and CYP5013C2nest_r is to carrying out pcr amplification, obtain specific DNA fragment (sequencing result shows, specific DNA fragment as sequence 3 from shown in 5 ' terminal the 1st to 4141 nucleotides).

Two, the structure of tetrahymena CYP5013C2 gene silencing strain

The specific DNA fragment that step 1 is obtained by particle gun imports tetrahymena thermophila B2086 strain system, obtains the strain of tetrahymena CYP5013C2 gene silencing by the paromomycin screening.

The primer that adopts CYP5013C2nest_f and CYP5013C2nest_r composition if show the specific band of about 4141bp, illustrates that tetrahymena to be measured is the strain of tetrahymena CYP5013C2 gene silencing to identifying the strain of tetrahymena CYP5013C2 gene silencing.Tetrahymena thermophila B2086 strain system adopts above-mentioned primer to identifying the band that shows about 3717bp.

The structure of embodiment 6, the strain of tetrahymena CYP5013C2 gene overexpression

One, makes up recombinant expression carrier

1, tetrahymena thermophila SB210 strain ties up to and grows to exponential phase (～2 * 10 early in the SPP culture medium ⁵Cells/mL), then with the p of 4mg/L, p'-DDT handled 24 hours, and extracting total RNA and reverse transcription then is cDNA.

2, the cDNA that obtains with step 1 is a template, and the primer of forming with F2 and R2 obtains pcr amplification product to carrying out pcr amplification.

F2：5'-C GGATCCATCTTCGAATTGATATTGATTGCTG-3'；

R2：5'-A GGCGCGCCTCATTATTTTCTTAAGGTTAGTTATAAGG-3'。

3, with the pcr amplification product of restriction enzyme BamHI and AscI double digestion step 2, reclaim enzyme and cut product.

4, use restriction enzyme BamHI and AscI double digestion carrier PXS75(carrier PXS75 shown in the sequence 4 of sequence table; In the sequence 4 of sequence table, 2210-2215 position nucleotides is the recognition sequence of restriction enzyme SacII, 2224-3280 position nucleotides is mtt1 gene 5' homologous recombination arm, 3281-4741 position nucleotides is the neo2 selection markers, 4760-5640 position nucleotides is the mtt1 gene promoter, 5641-5643 position nucleotides is mtt1 gene start codon ATG, 5650-5706 position nucleotides is 2 * HA label, 5707-5712 position nucleotides is the recognition sequence of restriction enzyme BamHI, 5713-6543 position nucleotides is the HTAY gene order, 6544-6551 position nucleotides is the recognition sequence of restriction enzyme AscI, 6552-7069 position nucleotides is mtt1 gene 3' homologous recombination arm, 7097-7102 position nucleotides is the recognition sequence of restriction enzyme XhoI), the carrier framework of the about 7kb of recovery.

5, the carrier framework of the enzyme of step 3 being cut product and step 4 is connected, and obtains recombinant plasmid OECYP5013C2_PXS(structural representation and sees Fig. 5).According to sequencing result, recombinant plasmid OECYP5013C2_PXS is carried out structure be described below, between the BamHI of carrier PXS75 and AscI restriction enzyme site, inserted the double chain DNA molecule shown in the sequence 2 of sequence table.

Two, the structure of tetrahymena CYP5013C2 gene overexpression strain

1,, reclaims the dna fragmentation (sequence 4 that is about to sequence table is carried out the dna molecular that following transformation obtains from the double chain DNA molecule shown in 5 ' terminal the 2216th to 7096 nucleotides: sequence 4 is substituted by the nucleotides shown in the sequence 2 of sequence table from the 5713rd nucleotides to 6543 nucleotides of 5 ' end) of about 5.5kb with restriction enzyme XhoI and SacII double digestion recombinant plasmid OECYP5013C2_PXS.

2, the dna fragmentation that step 1 is obtained by particle gun imports tetrahymena thermophila B2086 strain system, obtains the strain of tetrahymena CYP5013C2 gene overexpression by the paromomycin screening.

The primer that adopts MTT1_f and MTT1_r composition if be shown as the band of 1803bp, illustrates that tetrahymena to be measured is the strain of tetrahymena CYP5013C2 gene overexpression to identifying the strain of tetrahymena CYP5013C2 gene overexpression; If do not show any band, illustrate that tetrahymena to be measured is tetrahymena thermophila B2086.

MTT1_f:5'-ATTCACGATTTATGCAATGATCC-3'(is positioned on the MTT1 promoter);

MTT1_r:5'-GCATTTATTTGCCTTATTTGAGC-3'(is positioned on the MTT1 terminator).

Embodiment 7, the strain of tetrahymena CYP5013C2 gene silencing, tetrahymena CYP5013C2 gene overexpression strain and tetrahymena thermophila B2086 strain system are to the tolerance of DDT

The tetrahymena CYP5013C2 gene silencing strain (being called for short reticent strain) that respectively embodiment 5 is obtained, the tetrahymena CYP5013C2 gene overexpression strain (being called for short the expression strain) that embodiment 6 obtains and tetrahymena thermophila B2086 strain system (abbreviation wild type) carry out following operating procedure:

1, with p, p'-DDT is dissolved in DMSO, obtains the mother liquor that concentration is 0.1M, and 4 ℃ keep in Dark Place.

2, the tetrahymena to be measured with 2mL exponential phase morning is seeded in the 20mL SPP culture medium, and the cell concentration that makes tetrahymena to be measured is 3 * 10 ⁴Individual cell/mL.

3, the mother liquor of step 1 preparation is added in the system that step 2 obtains, make p, the concentration of p'-DDT is 256mg/L, and adds CdCl ₂, making its concentration is 0.05 μ g/mL.

4,30 ℃ of the systems that step 3 is obtained, 90rpm shaken cultivation respectively at sampling 200 μ L after 0,3,6,9 or 12 hour, are counted with cell counter, make growth curve.

Growth curve is seen Fig. 6.The increment of tetrahymena CYP5013C2 gene overexpression strain is greater than the increment of tetrahymena thermophila B2086 strain system, and the increment of tetrahymena thermophila B2086 strain system is greater than the increment of tetrahymena CYP5013C2 gene silencing strain.

Tetrahymena just has been forwarded in the new culture medium, growth retardation period can occur, and time span is about 0-3 hour, and the growth model computing formula of this moment is: N _B=N _A* exp (k ₁* t), wherein: N _BBe illustrated in the cell density of B time point, N _ABe illustrated in the cell density of A time point, k ₁Expression growth rate parameter (h ^-1), t represents a specific time point; In case the growth activation of tetrahymena, cell can enter the exponential type growth pattern immediately, corresponding growth model computing formula is: N _C=N _B* 2 ^T/G, wherein: G represent the generation time (hour), N _CBe illustrated in the cell density of C time point, the result is as shown in table 2.From the growth model of table 2, find, the average generation time of tetrahymena CYP5013C2 gene silencing strain is 7.3 hours, the average generation time of tetrahymena thermophila B2086 strain system is 4.66 hours, the average generation time of tetrahymena CYP5013C2 gene overexpression strain is 3.84 hours, this explanation CYP5013C2 gene helps coercing of DDT in the tetrahymena antagonism environment, has confirmed hypothesis " may exist relevant gene to resist coercing of DDT " in the tetrahymena body supposition.

The growth model of table 2 tetrahymena under the DDT of 256mg/L environmental exposure

Embodiment 8, the strain of tetrahymena CYP5013C2 gene silencing, tetrahymena CYP5013C2 gene overexpression strain and tetrahymena thermophila B2086 strain are to p, the degradation capability of p'-DDT

The tetrahymena CYP5013C2 gene silencing strain (being called for short reticent strain) that respectively embodiment 5 is obtained, the tetrahymena CYP5013C2 gene overexpression strain (being called for short the expression strain) that embodiment 6 obtains and tetrahymena thermophila B2086 strain system (abbreviation wild strain) carry out following operating procedure:

1, tetrahymena to be measured is cultured to exponential phase (3 * 10 early in the SPP culture medium ⁵Individual cell/mL).

2, collect the tetrahymena that step 1 obtains, be forwarded to the CdCl that 200mL contains 0.05 μ g/mL ₂The SPP culture medium in, the cell concentration that makes tetrahymena is 3 * 10 ⁴Individual cell/mL.

3, in the system of step 2, add p, p'-DDT, making its concentration is 256mg/L.

4,30 ℃ of the systems that step 3 is obtained, 90rpm shaken cultivation are respectively at the 20mL that takes a sample after 0.5,1 or 4 hour.

5, the centrifugal 3min of sample liquid 1500rpm room temperature that step 4 is got collects supernatant and cell precipitation respectively.

6, adding 40 μ L concentration in the supernatant that step 5 obtains is that the Heptachlor epoxide (Inst. of Environment Protection ﹠ Scientific Research Monitor, Ministry of Agric's product) of 1 μ g/mL is as interior mark.

7, add the 5mL ultra-pure water in the precipitation that step 5 obtains, use 200W ultrasonic wave (Ningbo Xin Zhi Science and Technology Ltd. product) broken wall 5 * 1min then, the Heptachlor epoxide that adds 40 μ L concentration then and be 1 μ g/mL is as interior mark.

8, in the liquid that step 6 or step 7 obtain, add the 40mL acetonitrile respectively, add 5g sodium chloride behind the vortex vibration 1min, vortex vibration 1min again, the centrifugal 5min of 3000rpm room temperature gets supernatant 20mL then.

9, Envi-18 post (Supelco company product) is put into fixed mount, earlier with 10mL acetonitrile prewashing pillar, connect the heart bottle down before the application of sample; Go up the supernatant that sample step 8 obtains then; Use 15mL acetonitrile wash-out then, collected the eluent behind the post, in 40 ℃ of water-baths, be concentrated into about 1mL by rotary evaporation.

10, (150W, the 1min) sample bottle of the Rotary Evaporators in the step 9 are collected cleaning solution to carry out ultrasonic washing for 3 times with 2mL acetonitrile-methylbenzene mixed liquor (volume ratio of acetonitrile and toluene is 3:1) branch.

11, in Envi-Carb post (Supelco company product), add the high anhydrous sodium sulfate of about 2cm, this post is connected Sep-Pak aminopropyl post (Supelco company product) top, and columns in series is put into down on the fixed mount that connects the heart bottle; Earlier with 4mL acetonitrile-methylbenzene mixed liquor (volume ratio of acetonitrile and toluene is 3:1) washing pillar, when liquid level arrives the top of sodium sulphate, rapid sample on the concentrate that step 9 is obtained, sample on the cleaning solution that step 10 is obtained then, with 25mL acetonitrile-methylbenzene mixed liquor (volume ratio of acetonitrile and toluene is 3:1) wash-out columns in series, collected the eluent behind the post, in 40 ℃ of water-baths, be concentrated into about 1mL by rotary evaporation.

12, add the 5mL n-hexane in the concentrate that step 11 obtains, in 40 ℃ of water-baths,, be concentrated into about 1mL by the Rotary Evaporators rotary evaporation.

13, add the 5mL n-hexane in the concentrate that step 12 obtains, in 40 ℃ of water-baths,, be concentrated into about 2mL by the Rotary Evaporators rotary evaporation.

14, adopt nitrogen to dry up the solution that instrument treatment step 13 obtains, obtain the 1mL concentrate.

15, the concentrate that step 14 is obtained is analyzed with the gas chromatography-mass spectrometry analysis instrument.

The chromatographic column of installing in the gas chromatography-mass spectrometry analysis instrument (Varian company product) is DB-1701(30m * 0.25mm * 0.25 μ m) quartz capillary column (Agilent company product); Chromatographic column intensification condition: 40 ℃ keep 1min, with 30 ℃/min temperature programming to 130 ℃, keep 1min then, are warming up to 250 ℃ with 5 ℃/min again, keep 1min, are warming up to 300 ℃ with 10 ℃/min again, keep 5min.

The gas chromatography-mass spectrometry analysis condition: (a) use helium as carrier gas, flow velocity is 1.2mL/min; (b) injector temperature, interface temperature, ion source temperature are respectively: 290 ℃, 280 ℃, 200 ℃; (c) input mode is no split sampling; (d) sample size is 1 μ L; (e) ion bombardment source is 70eV; (f) appearance time of the appraisal basis retention time of sample, mass spectral database and contrast standard specimen (p'-DDE, p, p'-DDD and Heptachlor epoxide are Inst. of Environment Protection ﹠ Scientific Research Monitor, Ministry of Agric's product for p, p'-DDT, p).

P, p'-DDT, p, p'-DDE, p, the peak result that goes out the when retention time of p'-DDD and Heptachlor epoxide is measured according to GC-MS determines.Quota ion, qualitative ion result determine (seeing Table 3) according to State Standard of the People's Republic of China (GB/T19648-2005).

Table 3GC-MS measures retention time, quota ion, the qualitative ion of compound

The making of calibration curve: with standard items (p, p'-DDT, p, p'-DDE or p p'-DDD) are added in 6 conical flasks that the 20mLSPP culture medium is housed, final concentration is a series of concentration gradients (1,5,10,20,50,100mg/L), with reference to above-mentioned steps, to mass concentration production standard curve, obtain p with the absworption peak area, p'-DDT, p, p'-DDE, p, the linear equation and the coefficient correlation thereof of these 3 kinds of compounds of p'-DDD, (seeing Table 4).

Table 4p, p'-DDT, p, p'-DDE, p, the calibration curve of p'-DDD and coefficient correlation thereof

Compound	Calibration curve	Coefficient correlation
			p,p′-DDT	Y=152829x+23618	0.9967
p,p'-DDE	Y=265983x+166409	0.9738
			p,p′-DDD	Y=304IO6x+69971	0.9816

The concentration of Y representation compound, unit is mg/L, x represents peak area.

The results are shown in Figure 7.Reticent strain, wild strain, the intracellular p of mistake expression strain, p'-DDT and metabolite p thereof, p'-DDE and p, the blank histogram graph representation of p'-DDD, the p in reticent strain, wild strain, mistake expression strain extracellular (being in the nutrient solution), p'-DDT and metabolite p thereof, p'-DDE and p, p'-DDD is with being with the some histogram graph representation.

From Fig. 7 a as can be known, add p, after p'-DDT4 hour, reticent strain, wild strain, mistake are expressed the inside and outside p of strain cell, p'-DDT concentration summation is respectively 127mg/L, 76mg/L, 22mg/L, promptly reticent strain, wild strain, crosses the expression strain p that degraded in 4 hours, and the ability of p'-DDT is respectively 50%, 70%, 91%, be that tetrahymena CYP5013C2 albumen helps the p that degrades, p'-DDT.From Fig. 7 b as can be known, p, p'-DDE in reticent strain, wild strain, cross the concentration of expressing in the strain and almost do not change this explanation: tetrahymena CYP5013C2 albumen and p, the metabolism of p'-DDE is irrelevant.From Fig. 7 c as can be known, p, p'-DDD does not have significant change in reticent strain and wild type, on a declining curve in crossing the expression strain, this explanation: tetrahymena CYP5013C2 albumen and p, the metabolism of p'-DDD also has relation.Above-mentioned discovery shows: the transgenosis tetrahymena of CYP5013C2 gene overexpression has the p that degrades the most efficiently, the ability of p'-DDT, thereby confirm the supposition of hypothesis " tetrahymena CYP5013C2 albumen may participate in exogenous compounds at intracellular biotransformation ", also illustrate that having important use aspect the DDT that the transgenosis tetrahymena of CYP5013C2 gene overexpression pollutes in the efficient degradation water environment is worth simultaneously.

Claims (10)

1. cross the application of tetrahymena in degraded DTT of expressing the CYP5013C2 gene; Described CYP5013C2 gene is the gene of coding CYP5013C2 albumen; Described CYP5013C2 albumen is following (a) or (b):

(a) protein of forming by the amino acid sequence shown in the sequence in the sequence table 1;

(b) with the amino acid sequence of sequence 1 through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and have the protein of deriving by sequence 1 of identical function.

2. application as claimed in claim 1 is characterized in that: described CYP5013C2 gene is following 1) or 2) or 3) dna molecular:

1) dna molecular of code area shown in sequence in the sequence table 2;

2) under stringent condition with 1) the dna sequence dna hybridization that limits and coding dna molecular with albumen of identical function;

3) with 1) dna sequence dna that limits has the dna molecular that 90% above homology and coding have the albumen of identical function.

3. application as claimed in claim 1 or 2 is characterized in that: the tetrahymena that described mistake is expressed the CYP5013C2 gene is to import the reorganization tetrahymena that the dna fragmentation that contains described CYP5013C2 gene obtains in the tetrahymena that sets out.

4. application as claimed in claim 3 is characterized in that: the described tetrahymena that sets out is tetrahymena thermophila B2086 strain system.

5.CYP5013C2 the application of gene in promoting tetrahymena degraded DTT; Described CYP5013C2 gene is the gene of coding CYP5013C2 albumen; Described CYP5013C2 albumen is following (a) or (b):

(a) protein of forming by the amino acid sequence shown in the sequence in the sequence table 1;

(b) with the amino acid sequence of sequence 1 through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and have the protein of deriving by sequence 1 of identical function.

6. application as claimed in claim 5 is characterized in that: described CYP5013C2 gene is following 1) or 2) or 3) dna molecular:

1) dna molecular of code area shown in sequence in the sequence table 2;

2) under stringent condition with 1) the dna sequence dna hybridization that limits and coding dna molecular with albumen of identical function;

3) with 1) dna sequence dna that limits has the dna molecular that 90% above homology and coding have the albumen of identical function.

7. the dna fragmentation, recombinant vector or the reorganization tetrahymena that contain the CYP5013C2 gene; Described CYP5013C2 gene is the gene of coding CYP5013C2 albumen; Described CYP5013C2 albumen is following (a) or (b):

(a) protein of forming by the amino acid sequence shown in the sequence in the sequence table 1;

(b) with the amino acid sequence of sequence 1 through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and have the protein of deriving by sequence 1 of identical function.

8. dna fragmentation as claimed in claim 7, recombinant vector or reorganization tetrahymena, it is characterized in that: described CYP5013C2 gene is following 1) or 2) or 3) dna molecular:

1) dna molecular of code area shown in sequence in the sequence table 2;

2) under stringent condition with 1) the dna sequence dna hybridization that limits and coding dna molecular with albumen of identical function;

3) with 1) dna sequence dna that limits has the dna molecular that 90% above homology and coding have the albumen of identical function.

9. protein, for following (a) or (b):

(a) protein of forming by the amino acid sequence shown in the sequence in the sequence table 1;

(b) with the amino acid sequence of sequence 1 through the replacement of one or several amino acid residue and/or disappearance and/or interpolation and have the protein of deriving by sequence 1 of identical function.

10. the gene of coding claim 9 described protein is following 1) or 2) or 3) dna molecular:

1) dna molecular of code area shown in sequence in the sequence table 2;

2) under stringent condition with 1) the dna sequence dna hybridization that limits and coding dna molecular with albumen of identical function;

3) with 1) dna sequence dna that limits has the dna molecular that 90% above homology and coding have the albumen of identical function.

Images