CN103215300A - Method for producing trehalose synthase from integrated recombinant bacillus subtilis and manufacturing trehalose - Google Patents
Method for producing trehalose synthase from integrated recombinant bacillus subtilis and manufacturing trehalose Download PDFInfo
- Publication number
- CN103215300A CN103215300A CN2013101746927A CN201310174692A CN103215300A CN 103215300 A CN103215300 A CN 103215300A CN 2013101746927 A CN2013101746927 A CN 2013101746927A CN 201310174692 A CN201310174692 A CN 201310174692A CN 103215300 A CN103215300 A CN 103215300A
- Authority
- CN
- China
- Prior art keywords
- trehalose
- subtilis
- trep
- bacillus subtilis
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Classifications
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02P—CLIMATE CHANGE MITIGATION TECHNOLOGIES IN THE PRODUCTION OR PROCESSING OF GOODS
- Y02P20/00—Technologies relating to chemical industry
- Y02P20/50—Improvements relating to the production of bulk chemicals
- Y02P20/52—Improvements relating to the production of bulk chemicals using catalysts, e.g. selective catalysts
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a method for producing trehalose synthase by taking integrated recombinant bacillus subtilis as a strain and producing trehalose from the trehalose synthase. The method specifically comprises the following steps of: integrating a trehalose synthase expression element in a bacillus subtilis chromosome to construct integrated recombinant bacillus subtilis, and fermenting in a nutrient culture medium to produce the trehalose synthase by taking the recombinant bacillus subtilis as a strain, wherein via simple separation, the trehalose synthase in the fermentation liquor can be directly used for manufacturing trehalose. The method disclosed by the invention has the advantages that the trehalose synthase is produced by virtue of a food safety expression system, the exogenous gene contained in the strain with integrated expression can be used for stable passage and expression, and the expressed trehalose synthase is secreted to the outside of cells, has no antimicrobial activity, and achieves the requirements of food applications for enzymic preparation, thus being beneficial to further manufacturing for trehalose.
Description
Technical field
The invention belongs to biological technical field, specifically is the method for TreP and manufacturing trehalose of producing with integrated recombined bacillus subtilis, and the TreP that production obtains is used to make the method for trehalose.
Background technology
Trehalose be by two molecule glucoses with α, α-1,1-glycosidic link link to each other and to form the natural sex disaccharides that is widespread in nature.Its self property is highly stable, and multiple biologically active substance is had provide protection.In recent years, discover that trehalose can be widely used in the delicate flavour maintenance and the improved texture of varieties of food items.Along with the progress of society and the raising of people's living standard, people pay attention to day by day to the quality and the mouthfeel of food, and this has strengthened the demand of people to trehalose.Therefore, large-scale Cheap highly effective is produced trehalose and is had great economic worth, also will more can popularize the use of trehalose at field of food simultaneously.
Research has found that occurring in nature has the plurality of enzymes system can trehalose synthesis.Wherein a kind of is the TreP (Trehalose Synthase) that can both find in many microorganisms.This endonuclease capable directly transforms into trehalose with maltose, the relatively more suitable suitability for industrialized production trehalose that is applied to.Research has found to derive from pimelobacter sp (Pimelobacter species), crooked thermomonospora fusca (Thermomonospora curvata), Corynebacterium glutamicum (Corynebacterium glutamicum), the TreP of radioresistens abnormal cocci (Deinococcus radiodurans) and aquatic thermophile bacteria (Thermus aquaticus) can transform into trehalose with maltose efficiently.At present, existing successfully report all is direct culture of isolated from original strain, perhaps utilizes recombinant plasmid at expression in escherichia coli.Culture of isolated often influences scale operation because the enzyme that original strain is expressed is lived not high from original strain, and also there are some defectives in escherichia expression system, as contain intracellular toxin, enterotoxin, be difficult to secreting, expressing, product need break born of the same parents' extraction etc., and, generally need to use microbiotic in process of production in order to keep the stability of plasmid.Residual antibiotics material is for the influence of food safety in the recombinant microorganism fermenting process, anti-microbial activity to microbe-derived zymin has strict restriction in the world, China stipulates clearly that also microbe-derived zymin must not detect anti-microbial activity in the food safety national standard (GB 25594-2010) of foodstuffs industry with zymin, this has higher requirement with zymin to food.
Subtilis has the history of long-term preparation leavened food, is nonpathogenic, does not produce intracellular toxin and pyrogenicity allergic protein matter, is a kind of bacterial classification of food safety.In addition, the subtilis expression system also has the following advantages: 1, have very strong protein secreting function, do not need smudge cells to extract protein, only need to handle fermented supernatant fluid more simply and can obtain purer target protein.2, do not have tangible codon-bias, expression product also is not easy to form inclusion body simultaneously.3, fermentation condition is simple.Therefore, development and use subtilis expression system production foodstuff additive have profound significance and vast market prospect.According to employing bearer type difference, the subtilis expression pattern can be divided into reproducible plasmid expression and chromosomal integration is expressed.Plasmid replication is not really stable in subtilis usually, and this has limited efficiently expressing of foreign gene.Also exist simultaneously and need to use antibiotic problem in process of production.Do not find also that at present utilizing integrated subtilis expression system to express produces TreP, and then utilize the TreP that obtains to make the research report of trehalose.
Summary of the invention
The purpose of this invention is to provide a kind of is that bacterial classification is produced TreP and utilized the TreP that obtains to make the method for trehalose with integrated recombined bacillus subtilis.Utilize integrated plasmid that the TreP Expression element is incorporated in the subtilis chromogene group, make up integrated recombined bacillus subtilis, utilize in this bacterium liquid medium within and ferment, obtain TreP.Through simple separation, the TreP in the fermented liquid can be directly used in the manufacturing of trehalose.
The technical scheme that the present invention solves the problems of the technologies described above is as follows:
1. the recombined bacillus subtilis bacterial strain that can express TreP in integrated mode is characterized in that its preparation method is:
The TreP Expression element is cloned on the subtilis integrated plasmid, and the recombinant plasmid transformed host subtilis that obtains selects foreign gene and is incorporated into recombined bacillus subtilis in the subtilis karyomit(e) by double exchange;
Described TreP Expression element comprises following component: can be in subtilis efficient promotor gene expression promoter, can be in subtilis proteic signal peptide dna segment of efficient secretory expression and trehalose synthesize enzyme gene;
Described can be in subtilis efficient promotor gene expression promoter is for deriving from the overlapping promotor P43 of subtilis (Bacillus subtilis), or derives from the promotor of Bacillus licheniformis (Baclicus lincheniformis) maltogenic amylase gene amyM;
Described can the proteic signal peptide dna segment of efficient secretory expression be to derive from the beta-amylase gene signal peptide dna segment that high temperature produces hydrogen sulfide clostridium (Clostridium thermosulfurogenes) in subtilis, or derives from ɑ-acetolactate decarboxylase gene signal peptide dna segment of bacillus brevis (Bacillus brevis);
Described trehalose synthesize enzyme gene is for deriving from the trehalose synthesize enzyme gene of Corynebacterium glutamicum (Corynebacterium glutamicum), derive from the trehalose synthesize enzyme gene of crooked thermomonospora fusca (Thermomonospora curvata), or derive from the trehalose synthesize enzyme gene of aquatic thermophile bacteria (Thermus aquaticus).
Described subtilis integrated plasmid is the integrated plasmid pMLK83 and the plasmid of deriving thereof;
Described host subtilis is subtilis 168 derivative strains, comprises 1A751, WB600, and WB800.
2. the utilization recombined bacillus subtilis bacterial strain of expressing TreP in integrated mode is produced TreP and is prepared the method for trehalose, it is characterized in that processing step is as follows:
1) preparation of one-level kind: connect above-mentioned bacillus subtilis genetic engineering bacterial strain list bacterium colony in 37 ℃ of 4ml LB liquid nutrient mediums, 220rpm overnight incubation from the LB flat board that contains Xin Meisu 20ug/ml, the bacterial classification of gained is the one-level kind;
2) preparation of secondary kind: the one-level kind is inoculated in 800ml LB liquid nutrient medium, and in 37 ℃, it is about 0.6 (about 4～5 hours) that 220rpm is cultured to OD600;
3) preparation of three grades of kinds: the secondary kind is inoculated in the 80L LB liquid fermentation tank, 37 ℃, control pH about 7.0 with citric acid, NaOH, ventilate and stir, dissolved oxygen is controlled at 20～30%, and being cultured to OD600 is about 0.6 (about 5～6 hours);
4) produce a jar fermentation: three grades of kinds are inoculated in the 3T fermentor tank, the LB liquid nutrient medium, 36～38 ℃, ventilate and stir, dissolved oxygen is controlled at 20～30%, controls pH 6～8 with citric acid, NaOH, cultivated about 26 hours, 10000g centrifugal force bactofugation behind molecular weight cut-off 5000～10000 ultra-filtration membrane concentrated supernatants, promptly gets TreP and concentrates stoste;
5) be raw material with malt syrup or starch slurry, produce the method for trehalose by conventional enzymatic conversion method and utilize above-mentioned reorganization TreP solution to make trehalose.
The present invention is incorporated into the TreP Expression element in the subtilis karyomit(e) first, with this bacterium as bacterial classification, conventional production technique, fermentative production TreP.The TreP of producing can be directly used in the manufacturing trehalose through the simple separation purifying.
Advantage of the present invention is: the present invention utilizes the expression system of food safety to produce TreP, the contained foreign gene of the bacterial strain of integrated expression can be stablized and goes down to posterity and express, the TreP of expressing is secreted into outside the born of the same parents, there is not antibiotic activity, reach the requirement of food applications zymin, help the manufacturing of next step trehalose.
Embodiment
Avoid that the unsettled effective way of plasmid is to use the subtilis integrated plasmid in the expression system, with exogenous origin gene integrator in subtilis karyomit(e), foreign gene duplicates with THE REPLICATION OF CHROMOSOME and expresses, and foreign gene can keep stability preferably in the host like this.The integrated plasmid pMLK83 that the present invention uses is available from the Bacillus of Ohio State Univ-Columbus USA heredity preservation center (BGSC, http://www.bgsc.org), this plasmid has two sections and subtilis amylase gene homologous dna sequence dna (homology arm), in these two sections homology arms neomycin resistance gene is arranged; Therefore this plasmid has the intestinal bacteria replicon and does not have the subtilis replicon in addition, can duplicate in intestinal bacteria and can not duplicate in subtilis.When plasmid is transformed into subtilis, select by neomycin resistance, the reorganization bacterium that only is incorporated in the subtilis karyomit(e) could grow, and so just filters out recon.
Below in conjunction with embodiment the present invention is further described.But need to prove that embodiment does not constitute the restriction to the claimed scope of the present invention.
Embodiment 1
This example will comprise and derive from the overlapping promotor P43 promotor of subtilis (Bacillus subtilis), and the monocistronic TreP Expression element of trehalose synthesize enzyme gene that derives from ɑ-acetolactate decarboxylase gene signal peptide dna segment of bacillus brevis (Bacillus brevis) and derive from Corynebacterium glutamicum (Corynebacterium glutamicum) is cloned into integrated plasmid pMLK83.
1. construction recombination plasmid pMLK83-P43
According to the promotor P43 sequence of note among the Genbank, the design upstream primer is that 5 ' attgctggacgcttatggac 3 ' and downstream primer are 5 ' cgggatccattcctctcttacctataat 3 '.PCR reaction system 100ul:DNA template (the total DNA of subtilis 1A751) 1ul (about 20ng), 5 * PrimeSTAR Buffer 20ul, 10pmol/ul dNTP 2ul, the forward and reverse primer of 10pmol/ul respectively are 2ul, 2.5U/ul PrimeSTAR HS archaeal dna polymerase 1ul adds ddH
2O to 100ul.PCR response procedures: 94 ℃ of 5min; 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 1min, 30 circulations; 72 ℃ of 10min; 4 ℃ of preservations.The PCR fragment carries out respectively being connected with the T4 ligase enzyme behind the double digestion with restriction enzyme BamH I, Hind III with plasmid pMLK83, is transformed among the bacillus coli DH 5 ɑ, obtains recombinant plasmid pMLK83-P43 through Screening and Identification.
2. construction recombination plasmid pMLK83-P43-cgTreS
The following dna segment of synthetic:
1?GGATCCATGA?AAAAAAATAT?CATCACTTCT?ATCACATCTC?TGGCTCTGGT
51?TGCCGGGCTG?TCTTTGACTG?CTTTTGCAGC?TACAACGGTG?CTGCAAACCT
101?CCTGGCATTT?CTCTATCCTG?GCAGGCATGA?CTGATACCTC?TCCGTTTGAA
151?TTCTCAGCCG?AGTGCAGATC?ACCACCCTGA?TCACGCGGCT?CGCCCAGTTC
201?TTGATGCCCA?CGGCTTGATC?GTTGAGCACG?AATCGGAAGA?GTTTCCAGTC
251?CCCGCACCCG?CTCCCGGTGA?ACAGCCCTGG?GAGAAGAAAA?ACCGCGAGTG
301?GTACAAAGAC?GCCGTTTTCT?ACGAAGTGCT?GGTTCGTGCC?TTCTACGATC
351?CAGAAGGCAA?CGGAGTCGGA?TCGTTGAAAG?GCCTGACCGA?AAAACTGGAT
401?TACATCCAGT?GGCTCGGCGT?GGATTGCATT?TAGATCCCAC?CGTTTTATGA
451?TTCCCCACTG?CGCGACGGCG?GTTACGATAT?CCGCAACTTC?CGTGAAATCC
501?TGCCCGAATT?CGGCACCGTC?GATGACTTCG?TGGAACTCGT?TGACCACGCC
551?CACCGCCGTG?GCCTGCGTGT?TATCACCGAC?TTGGTCATGA?ATCACACCTC
601?CGACCAGCAC?GCATGGTTCC?AAGAATCCCG?GCGCGACCCA?ACCGGCCCCT
651?ACGGAGATTT?CTATGTGTGG?AGCGATGATC?CCACCCTGTA?CAACGAAGCC
701?CGCATCATCT?TTGTAGATAC?AGAAGAATCC?AACTGGACCT?ATGATCCGGT
751?GCGTGGCCAG?TACTTCTGGC?ACCGCTTCTT?CTCCCACCAA?CCAGACCTCA
801?ACTACGACAA?CCCCGCAGTC?CAAGAGGCCA?TGCTAGATGT?CTTGCGTTTC
851?TGGCTGGACC?TGGGACTTGA?TGGTTTCCGA?CTAGATGCCG?TTCCTTATCT
901?TTTTGAACGC?GAAGGCACCA?ACGGCGAAAA?CCTCAAAGAA?ACCCACGATT
951?TCCTCAAACT?GTGTCGCTCT?GTCATTGAGA?AGGAATACCC?CGGCCGAATC
1001?CTGCTCGCAG?AAGCCAACCA?ATGGCCCCAA?GATGTGGTCG?AATACTTCGG
1051?TGAAAAAGAC?AAAGGCGATG?AATGCCACAT?GGCCTTCCAC?TTCCCTTTGA
1101?TGCCGCGCAT?CTTCATGGGA?GTTCGCCAAG?GTTCACGCAC?CCCGATCAGT
1151?GAGATCCTGG?CCAACACCCC?GGAGATTCCC?AAGACTGCCC?AATGGGGTAT
1201?TTTCCTGCGT?AATCATGATG?AGCTCACCCT?TGAAATGGTC?TCCGATGAGG
1251?AACGCAGCTA?CATGTACTCC?CAATTCGCCT?CCGAACCTCG?CATGCGCGCC
1301?AACGTAGGAA?TCCGCAGGCG?CCTTTCCCCA?CTGCTTGAAG?GCGACCGCAA
1351?CCAGCTGGAA?CTCCTTCACG?GTTTGTTGCT?GTCTCTACCT?GGCTCACCCG
1401?TGTTGTATTA?CGGTGATGAA?ATTGGCATGG?GCGACAATAT?CTGGCTCCAC
1451?GACCGCGACG?GAGTGCGCAC?CCCCATGCAG?TGGTCCAACG?ACCGCAACGG
1501?TGGTTTCTCC?AAAGCTGATC?CTGAACGCCT?GTACCTTCCA?GCGATCCAAA
1551?ATGATCAATA?CGGCTACGCC?CAAGTAAACG?TGGAAAGCCA?ACTCAACCGC
1601?GAAAACTCCC?TGCTGCGCTG?GCTCCGAAAC?CAAATCCTTA?TCCGCAAGCA
1651?GTACCGCGCA?TTTGGTGCCG?GAACCTACCG?TGAAGTGTCC?TCCACCAATG
1701?AGTCAGTGTT?GACATTTTTA?CGAGAACACA?AGGGCCAAAC?CATTTTGTGT
1751?GTCAACAACA?TGAGCAAATA?TCCTCAGGCA?GTCTCGCTTG?ATTTGCGTGA
1801?ATTTGCAGGA?CACACCCCTC?GAGAGATGTC?GGGCGGGCAG?CTGTTCCCTA
1851?CCATTGCTGA?ACGGGAGTGG?ATTGTCACTT?TAGCCCCTCA?CGGATTCTTC
1901?TGGTTTGATC?TCACCGCCGA?TGAAAAGGAC?GATATGGAAT?GACCGCGG
With synthetic dna fragmentation and plasmid pMLK83-P43 with restriction enzyme BamH I be connected with the T4 ligase enzyme after Sac II carries out double digestion, be transformed in the bacillus coli DH 5 ɑ competent cell, obtain recombinant plasmid pMLK83-p43-cgTreS. through Screening and Identification
Embodiment 2
This example will comprise and derive from the overlapping promotor P43 promotor of subtilis (Bacillus subtilis), derive from the monocistronic TreP Expression element of trehalose synthesize enzyme gene that high temperature produces the beta-amylase gene signal peptide dna segment of hydrogen sulfide clostridium (Clostridium thermosulfurogenes) and derive from crooked thermomonospora fusca (Thermomonospora curvata) and be cloned into integrated plasmid pMLK83.
The following dna segment of synthetic:
1?GGATCCATGA?TTGGAGCTTT?TAAAAGGTTG?GGTCAAAAAT?TGTTTTTGAC
51?ATTGTTAACG?GCATCATTAA?TTTTTGCATC?TTCTATAGTA?ACTGCTAATG
101?CAGTGCAGAT?GACCGGGGAC?CCCATCCCCG?ACACCTTCAC?CCACGAAAAG
151?CCGCGCGACC?CCTACTGGTA?CAAGCACGCG?GTCTTCTACG?AGGTGCTGGT
201?GCGCGGGTTC?AGCGACTCCA?ACGACGACGG?CACCGGAGAC?CTGCGCGGCC
251?TCATCAACCG?GCTGGACTAT?CTGCAGTGGC?TGGGCATCGA?CTGCATCTGG
301?CTGCTGCCGA?TCTACCAGTC?GCCGCTGCGG?GACGGCGGCT?ACGACATCAG
351?CGACTACACC?AAGATCCTGC?CGGAGTTCGG?CGATCTGGGC?GACTTCGTGG
401?AGCTGGTCGA?TGAGGCGCAC?CGGCGGGGCA?TCCGCGTCAT?CGCCGACCTG
451?GTGATGAACC?ACACCAGCGA?CCAGCACCCC?TGGTTCCAGG?CGTCCCGCAC
501?GGACCCCGAC?GGGCCGTACG?GCGACTTCTA?CATGTGGTCC?GACACCGACG
551?ACAAGTACCC?GGACGCGCGG?ATCATCTTCG?TCGACACCGA?GGTGTCCAAC
601?TGGACCTACG?ACCCGGTGCG?CGGCCAGTAC?TACTGGCACC?GCTTCTTCTC
651?CCACCAGCCG?GACCTCAACT?ACGACAACCC?GGCGGTGCAG?GAGGCGATGC
701?TGGAGGTGCT?GCGGTTCTGG?CTGGACCTGG?GCATCGACGG?GTTCCGGTTG
751?GACGCGGTGC?CCTACCTGTA?CGCCCGCGAG?GGCACCAACT?GCGAGAACCT
801?GCCGGAGACC?CACGCCTATC?TGAAGCGGGT?GCGCGCCGAA?GTGGACCGGC
851?TGTACCCGGA?CCGGGTGCTG?CTGGCCGAGG?CCAACCAGTG?GCCGGCCGAC
901?GTGGTGGAGT?ACTTCGGCGA?CCCGGCCACC?GGCGGGGACG?AGTGCCACAT
951?GGCCTTCCAC?TTCCCGGTGA?TGCCACGGAT?CTTCATGGCG?GTGCGGCGCG
1001?AGCAGCGCTA?CCCCATCTCC?GAGATCATGG?CGCAGACCCC?CAAGATCCCC
1051?GAGAACTGCC?AGTGGGGCAT?CTTCCTGCGC?AACCACGATG?AGCTGACGCT
1101?GGAGATGGTC?ACCGACGAAG?AGCGGGACTA?CATGTACGCC?GAGTACGCCA
1151?AGGACCCACG?GATGAAGGCC?AACATCGGCA?TCCGGCGCCG?GCTGGCCCCG
1201?CTGCTGGACA?ACGACCGCAA?CCAGCTGGAG?CTGTTCACCG?CGCTGCTGCT
1251?GTCGCTGCCG?GGATCGCCGG?TGCTGTACTA?CGGCGACGAG?ATCGGCATGG
1301?GCGACAACAT?CTGGCTGGGC?GACCGCGACA?GCGTGCGCAC?CCCGATGCAG
1351?TGGACGCCCG?ACCGCAACGC?CGGCTTCTCC?CGCTGCGACC?CGGCCCGGCT
1401?CTACCTGCCG?GTGATCATGG?ACCCGATCTA?CGGGTACCAG?GCGGTCAACG
1451?TGGAGGCCCA?GCAGCGCAAC?CCCGGCTCGC?TGCTGAACTG?GACCCGCAAG
1501?ATGATCGAGA?TCCGCAAGCG?GCACCCGGTG?TTCGGGCTGG?GCTCGTATGT
1551?GGAGCTGCCG?GCCTCCAACC?CCAGCGTGCT?GGCCTTCGTG?CGCGAGTACG
1601?GCGACGACCG?GGTGCTGTGC?GTCAACAACC?TCTCGCGCTT?CCCGCAGCCG
1651?GTGGAGCTGG?ACCTGCGCCG?CTTCGAAGGC?TGCACCCCGG?TGGAGTGCAT
1701?GGGCGGGGTG?CAGTTCCCGG?CGATCGGCGA?GCTGCCCTAC?CTGCTCACCC
1751?TGCCCGGTCA?CGGCTTCTAC?TGGTTCGTGC?TGCCGCCGCC?GCCCGGCGGC
1801?TGGCCCGACG?GCTCCGGCGC?CGCCGAGCAG?TCACTGCGGG?AACAGTCCGA
1851?CCGGGGTGCG?GACTTCCCCG?CAGATCCCTC?GCAGGAGACC?CGGCAGACGG
1901?CGAAGTAACC?GCGG
With synthetic dna fragmentation and plasmid pMLK83-P43 with restriction enzyme BamH I be connected with the T4 ligase enzyme after Sac II carries out double digestion, be transformed in the bacillus coli DH 5 ɑ competent cell, obtain recombinant plasmid pMLK83-p43-tcTreS. through Screening and Identification
Embodiment 3
This example will comprise the promotor that derives from Bacillus licheniformis (Baclicus lincheniformis) maltogenic amylase gene amyM, and the ɑ-acetolactate decarboxylase gene signal peptide dna segment that derives from bacillus brevis (Bacillus brevis) is cloned into integrated plasmid pMLK83 with the monocistronic TreP Expression element of trehalose synthesize enzyme gene that derives from aquatic thermophile bacteria (Thermus aquaticus).
1. construction recombination plasmid pMLK83-amyM
According to the promotor amyM sequence of note among the Genbank, the design upstream primer is that 5 ' cccaagcttctgtacacttgcgtcctcca 3 ' and downstream primer are 5 ' cgggatcctctcctcccctttcaatgtg 3 '.PCR reaction system 100ul:DNA template (Bacillus licheniformis ATCC 14580 total DNA) 1ul (about 20ng), 5 * PrimeSTAR Buffer 20ul, 10pmol/ul dNTP 2ul, the forward and reverse primer of 10pmol/ul respectively is 2ul, 2.5U/ul PrimeSTAR HS archaeal dna polymerase 1ul adds ddH
2O to 100ul.PCR response procedures: 94 ℃ of 5min; 94 ℃ of 30s, 60 ℃ of 30s, 72 ℃ of 30s, 30 circulations; 72 ℃ of 10min; 4 ℃ of preservations.The PCR fragment carries out respectively being connected with the T4 ligase enzyme behind the double digestion with restriction enzyme BamH I, Hind III with plasmid pMLK83, is transformed among the bacillus coli DH 5 ɑ, obtains recombinant plasmid pMLK83-amyM through Screening and Identification.
2. construction recombination plasmid pMLK83-amyM-taTreS
The following dna segment of synthetic:
1?GGATCCATGA?AAAAAAATAT?CATCACTTCT?ATCACATCTC?TGGCTCTGGT
51?TGCCGGGCTG?TCTTTGACTG?CTTTTGCAGC?TACAACGGTG?GACCCCCTCT
101?GGTACAAGGA?CGCGGTGATC?TACCAGCTCC?ACGTCCGCTC?CTTCTTTGAC
151?GCCAACAACG?ACGGCTACGG?GGACTTTGAG?GGCCTGAGGC?GGAAGCTTCC
201?CTACCTGGAG?GAGCTCGGGG?TCAACACCCT?CTGGCTCATG?CCCTTCTTCC
251?AGTCCCCCTT?GAGGGACGAC?GGGTACGATA?TCTCCGACTA?CTACCAGATC
301?CTCCCCGTCC?ACGGGACCCT?GGAGGACTTC?ACCGTGGACG?AGGCCCACGG
351?CCGGGGGATG?AAGGTGATCA?TTGAGCTCGT?CCTGAACCAC?ACCTCCATTG
401?ACCACCCTTG?GTTCCAGGAG?GCGAGGAAGC?CGAATAGCCC?CATGCGGGAC
451?TGGTACGTGT?GGAGCGACAC?CCCGGAGAAG?TACAAGGGGG?TCCGGGTCAT
501?CTTCAAGGAC?TTTGAAACCT?CCAACTGGAC?CTTTGACCCC?GTGGCCAAGG
551?CCTACTACTG?GCACCGCTTC?TACTGGCACC?AGCCCGACCT?CAACTGGGAC
601?AGCCCCGAGG?TGGAGAAGGC?CATCCACCAG?GTCATGTTCT?TCTGGGCCGA
651?CCTGGGGGTG?GACGGCTTCC?GCCTGGACGC?CATCCCCTAC?CTCTACGAGC
701?GGGAGGGGAC?CTCCTGCGAG?AACCTCCCCG?AGACCATTGA?GGCGGTGAAG
751?CGCCTGAGGA?AGGCCCTGGA?GGAGCGCTAC?GGCCCCGGGA?AGATCCTCCT
801?CGCCGAGGTC?AACATGTGGC?CGGAGGAGAC?CCTCCCCTAC?TTCGGGGACG
851?GGGACGGGGT?CCACATGGCC?TACAACTTCC?CCCTGATGCC?CCGGATCTTC
901?ATGGCCCTAA?GGCGGGAGGA?CCGGGGTCCC?ATTGAAACCA?TGCTCAAGGA
951?GGCGGAGGGA?ATCCCCGAAA?CCGCCCAGTG?GGCCCTCTTC?CTCCGCAACC
1001?ACGACGAGCT?CACCCTGGAG?AAGGTCACGG?AGGAGGAGCG?GGAGTTCATG
1051?TACGAGGCCT?ACGCCCCCGA?CCCCAAGTTC?CGCATCAACC?TGGGAATCCG
1101?CCGCCGCCTC?ATGCCCCTCC?TCGGGGGCGA?CCGCAGGCGG?TACGAGCTCC
1151?TCACCGCCCT?CCTCCTCACC?CTAAAGGGCA?CGCCCATCGT?CTACTACGGG
1201?GACGAGATCG?GCATGGGGGA?CAACCCCTTC?CTCGGGGACC?GGAACGGTGT
1251?CAGGACCCCC?ATGCAGTGGT?CCCAAGACCG?CATCGTCGCC?TTCTCCCGCG
1301?CCCCCTACCA?CGCCCTCTTC?CTTCCCCCCG?TGAGCGAGGG?GCCCTACAGC
1351?TACCACTTCG?TCAACGTGGA?GGCCCAGCGG?GAAAACCCCC?ACTCCCTCCT
1401?GAGCTTCAAC?CGCCGCTTCC?TCGCCCTGAG?GAACCAGCAC?GCCAAGATCT
1451?TCGGCCGGGG?GAGCCTCACC?CTTCTCCCCG?TGGAGAACCG?GCGCGTCCTC
1501?GCCTACCTGA?GGGAGCACGA?GGGGGAGCGG?GTCCTGGTGG?TGGCCAACCT
1551?CTCCCGCTAC?ACCCAGGCCT?TTGACCTCCC?CTTGGAGGCC?TACCAAGGCC
1601?TCGTCCCCGT?GGAGCTCTTC?TCGCAGCAAC?CCTTCCCCCC?GGTGGAGGGG
1651?CGCTACCGCT?TGACCCTGGG?CCCCCACGGC?TTCGCCCTCT?TCGCCCTGAA
1701?GCCCGTGGAG?GCGGTGCTCC?ACCTCCCCTC?CCCCGACTGG?GCCGAGGAGC
1751?CCGCCCCCGA?GGAGGCCGAC?CTGCCCCGGG?TCCACATGCC?CGGGGGGCCG
1801?GAGGTCCTCC?TGGTGGACAC?CCTGGTCCAC?GAAAGGGGGC?GGGAGGAGCT
1851?CCTAAACGCC?CTCGCCCAGA?CCCTGAAGGA?GAAGAGCTGG?CTCGCCCTCA
1901?AGCCGCAGAA?GGTGGCCCTC?CTGGACGCCC?TCCGCTTCCA?GAAGGACCCG
1951?CCCCTTTACC?TCACCCTGCT?CCAGCTGGAG?AACCACAGGA?CCCTCCAGGT
2001?CTCCCTCCCC?CTCCTCTGGT?CCCCCCAGAG?GCGGGAAGGC?CCCGGCCTCT
2051?TCGCCCGCAC?CCACGGCCAG?CCCGGCTACT?TCTACGAGCT?CTCCTTGGAC
2101?CCAGGCTTCT?ACCGCCTCCT?CCTCGCCCGC?CTTAAGGAGG?GGTTTGAGGG
2151?GCGGAGCCTC?CGGGCCTACT?ATCGCGGCCG?CCACCCGGGT?CCCGTGCCCG
2201?AGGCCGTGGA?CCTCCTCCGG?CCGGGACTCG?CGGCGGGGGA?GGGGGTCTGG
2251?GTCCAGCTCG?GCCTCGTCCA?AGACGGGGGC?CTGGACCGCA?CGGAGCGGGT
2301?CCTCCCCCGC?CTGGACCTCC?CCTGGGTTCT?CCGGCCCGAA?GGGGGCCTCT
2351?TCTGGGAGCG?GGGCGCCTCC?AGAAGGGTCC?TCGCCCTCAC?GGGAAGCCTC
2401?CCCCCGGGCC?GCCCCCAGGA?CCTCTTCGCC?GCCCTGGAGG?TCCGGCTCCT
2451?GGAAAGCCTT?CCCCGCCTCC?GGGGGCACGC?CCCCGGGACC?CCAGGCCTCC
2501?TTCCCGGGGC?CCTGCACGAG?ACCGAAGCCC?TGGTCCGCCT?CCTCGGGGTG
2551?CGCCTCGCCC?TCCTCCACCG?GGCCCTTGGG?GAGGTGGAGG?GGGTGGTGGG
2601?GGGCCACCCC?CTCCTAGGAC?GCGGCCTCGG?GGCCTTCCTG?GAGCTGGAGG
2651?GGGAGGTGTA?CCTCGTGGCC?CTGGGCGCGG?AAAAGCGGGG?CACGGTGGAG
2701?GAGGACCTGG?CCCGCCTGGC?CTACGACGTG?GAGCGGGCCG?TGCACCTCGC
2751?CCTCGAGGCC?CTGGAGGCGG?AGCTTTGGGC?CTTTGCCGAG?GAGGTGGCCG
2801?ACCACCTCCA?CGCCGCCTTC?CTCCAAGCCT?ACCGCTCCGC?CCTCCCCGAG
2851?GAGGCCCTGG?AGGAGGCGGG?CTGGACGCGG?CACATGGCCG?AGGTGGCGGC
2901?GGAGCACCTC?CACCGGGAGG?AAAGGCCCGC?CCGCAAGCGC?ATCCACGAGC
2951?GCTGGCAGGC?CAAGGCCGGA?AAAGCCTAGC?CGCGG
With synthetic dna fragmentation and plasmid pMLK83-amyM with restriction enzyme BamH I be connected with the T4 ligase enzyme after Sac II carries out double digestion, be transformed in the bacillus coli DH 5 ɑ competent cell, obtain recombinant plasmid pMLK83-amyM-taTreS. through Screening and Identification
Embodiment 4
Integrative plasmid pMLK83-p43-cgTreS, pMLK83-p43-tcTreS and the pMLK83-amyM-taTreS conversion in subtilis
Getting one completely encircles subtilis 1A751 glycerol stock and draws LB flat board (LB substratum: peptone 1%, yeast extract paste 0.5%, NaCl1%, flat board adds 1.5%Agar), 37 ℃ of incubator overnight incubation.Transform and choose single bacterium colony to 3ml LB substratum night the day before yesterday, 37 ℃, the 250rpm overnight incubation, the next morning gets 160 μ l nutrient solutions and is forwarded to (the SPI substratum: it is 50%(W/V that SP salt adds 1% volumetric concentration) glucose solution in the 8ml SPI substratum, 1% volume, 100 * CAYE solution; SP salts solution: contain 1.96g/L (NH
2) 2SO
4, 13.72g/L K
2HPO
4, 5.88g/L KH
2PO
4, 0.196g/L MgSO
4.7H
2O(sterilizes separately) and the 0.98g/L Trisodium Citrate; 100 * CAYE solution: contain 20g/L casamino acids and 100g/L yeast extract), 37 ℃, 250rpm is cultured to logarithmic growth latter stage (about 4～5 hours); Getting 0.2ml grows to the nutrient solution in logarithm latter stage (the SPII substratum: the SPI substratum adds 1% volume 50mmol/L CaCl to 2ml SPII substratum
2Solution, 1% volume 250mmol/L MgCl
2Solution), 37 ℃, 100 rpm cultivated 90 minutes; Add 20ul 10mmol/L EGTA in the thalline of above-mentioned SPII substratum, again in 37 ℃, 100rpm cultivated 10 minutes; Bacterium liquid after the above-mentioned processing is distributed into the every pipe of 0.5ml, add 5ul pMLK83-p43-cgTreS plasmid (50ng/ul), again in 37 ℃, 250rpm cultivated 90 minutes, get bacterium liquid coating Xin Meisu (20ug/ml) LB flat board, screening amylase disappearance transformant promptly is bacillus subtilis genetic engineering bacterial strain 1A751[p43-cgTreS].
With with quadrat method with pMLK83-p43-cgTreS, pMLK83-p43-tcTreS or pMLK83-amyM-taTreS plasmid transform subtilis WB600 and WB800, can get WB600[p43-cgTreS], WB600[p43-tcTreS], WB600[amyM-taTreS], WB800[p43-cgTreS], WB800[p43-tcTreS] or WB800[amyM-taTreS].
Embodiment 5
The production of TreP, operation steps is as follows:
1) preparation of one-level kind: connect above-mentioned bacillus subtilis genetic engineering bacterial strain list bacterium colony in 37 ℃ of 4ml LB liquid nutrient mediums, 220rpm overnight incubation from the LB flat board that contains Xin Meisu 20ug/ml, the bacterial classification of gained is the one-level kind.
2) preparation of secondary kind: the one-level kind is inoculated in 800ml LB liquid nutrient medium, and in 37 ℃, it is about 0.6 (about 4～5 hours) that 220rpm is cultured to OD600.
3) preparation of three grades of kinds: the secondary kind is inoculated in the 80L LB liquid fermentation tank, 37 ℃, control pH about 7.0 with citric acid, NaOH, ventilate and stir, dissolved oxygen is controlled at 20～30%, and being cultured to OD600 is about 0.6 (about 5～6 hours).
4) produce a jar fermentation: three grades of kinds are inoculated in the 3T fermentor tank, the LB liquid nutrient medium, 36～38 ℃, ventilate and stir, dissolved oxygen is controlled at 20～30%, controls pH 6～8 with citric acid, NaOH, cultivated about 26 hours, 10000g centrifugal force bactofugation behind molecular weight cut-off 5000～10000 ultra-filtration membrane concentrated supernatants, promptly gets TreP and concentrates stoste.
The mensuration that the TreP enzyme is lived is carried out as follows.Get suitably enzyme liquid+0.6ml 10% maltose substrate of dilution (with the preparation of 50mM pH6.5 phosphoric acid buffer) of 0.6ml, react 30min at 37 ℃ behind the mixing, reaction solution 10000rpm is centrifugal, and 3min gets supernatant, measure reducing sugar content with pressing reducing sugar test method (3,5-dinitrosalicylic acid colorimetry).0.6ml10% maltose substrate+0.6ml 50mM pH6.5 phosphoric acid buffer is then got in contrast, 37 ℃ of reaction 30min, and 10000rpm is centrifugal, and 3min gets supernatant, and the same method is measured reducing sugar content.
Unit of activity (U) is defined as 1ml enzyme liquid at pH6.5, and under 37 ℃ of conditions, it is that non-reducing sugar is a TreP unit of activity that per minute transforms 1ug maltose.Method of calculation are as follows: U(μ g/ml.min)=and (V
1* M * (OD
1-OD
2)/OD
1)/(T * V
2)=(0.6ml * 100mg/ml * (OD
1-OD
2)/OD
1* 1000)/(30min * 0.6ml)
(V
1: substrate volume (ml), V
2: participate in the enzyme liquid long-pending (ml) of reaction, M: concentration of substrate (mg/ml), OD
1: the light absorption value when in the same old way surveying reducing sugar, OD
2: sample is surveyed the light absorption value of reducing sugar, and 1000:mg converts the coefficient of μ g to, T: the enzyme reaction time (min)).
After measured, after fermenation raw liquid was centrifugal, the highest enzyme work of each bacillus subtilis genetic engineering bacterial strain fermentation expression saw Table 1.
Table 1
| Bacterial strain | Total enzyme (U) alive | Extracellular enzyme (U) alive |
| 1A751[p43-cgTreS] | 542 | 428 |
| WB600[p43-cgTreS] | 1085 | 923 |
| WB600[p43-tcTreS] | 1426 | 980 |
| WB600[amyM-taTreS] | 1240 | 1010 |
| WB800[p43-cgTreS] | 968 | 812 |
| WB800[p43-tcTreS] | 1522 | 1028 |
| WB800[amyM-taTreS] | 1434 | 1225 |
Embodiment 6
The preparation of trehalose
1, malt syrup is converted into trehalose
Get the solution that 100L contains 30mg/ml maltose, regulating pH with phosphoric acid buffer is that the final concentration of 6.9(damping fluid is 5mM).The WB800[amyM-taTreS that adds 10L 1000U] enzyme liquid that bacterial strain is expressed, reaction is 32 hours under 25 ℃ of conditions.But the content of measuring the trehalose in 32 hours afterreaction liquid of principal reaction with high performance liquid chromatograph is 17.2mg/ml, and maltose is 8.6mg/ml, and glucose is that the transformation efficiency that the total maltose of 2.9mg/ml. is converted into trehalose is: 17.2X1.1/30=63.1%.
2, tapioca (flour) is converted into trehalose
At first tapioca (flour) is generated maltose after α-Dian Fenmeiyehua is handled by beta-amylase again, then the maltose that obtains is converted into trehalose with aforesaid method.Experiment shows that 100 kilograms of starch can obtain about 40 kilograms of trehaloses.
Claims (2)
1. the recombined bacillus subtilis bacterial strain that can express TreP in integrated mode is characterized in that its preparation method is:
The TreP Expression element is cloned on the subtilis integrated plasmid, and the recombinant plasmid transformed host subtilis that obtains selects foreign gene and is incorporated into recombined bacillus subtilis in the subtilis karyomit(e) by double exchange;
Described TreP Expression element comprises following component: can be in subtilis efficient promotor gene expression promoter, can be in subtilis proteic signal peptide dna segment of efficient secretory expression and trehalose synthesize enzyme gene;
Described can be in subtilis efficient promotor gene expression promoter is for deriving from the overlapping promotor P43 of subtilis (Bacillus subtilis), or derives from the promotor of Bacillus licheniformis (Baclicus lincheniformis) maltogenic amylase gene amyM;
Described can the proteic signal peptide dna segment of efficient secretory expression be to derive from the beta-amylase gene signal peptide dna segment that high temperature produces hydrogen sulfide clostridium (Clostridium thermosulfurogenes) in subtilis, or derives from ɑ-acetolactate decarboxylase gene signal peptide dna segment of bacillus brevis (Bacillus brevis);
Described trehalose synthesize enzyme gene is for deriving from the trehalose synthesize enzyme gene of Corynebacterium glutamicum (Corynebacterium glutamicum), derive from the trehalose synthesize enzyme gene of crooked thermomonospora fusca (Thermomonospora curvata), or derive from the trehalose synthesize enzyme gene of aquatic thermophile bacteria (Thermus aquaticus)
Described subtilis integrated plasmid is the integrated plasmid pMLK83 and the plasmid of deriving thereof;
Described host subtilis is subtilis 168 derivative strains, comprises 1A751, WB600, and WB800.
2. one kind is utilized the described recombined bacillus subtilis bacterial strain of claim 1 to produce TreP and prepares the method for trehalose, it is characterized in that processing step is as follows:
1) preparation of one-level kind: connect above-mentioned bacillus subtilis genetic engineering bacterial strain list bacterium colony in 37 ℃ of 4ml LB liquid nutrient mediums, 220rpm overnight incubation from the LB flat board that contains Xin Meisu 20ug/ml, the bacterial classification of gained is the one-level kind;
2) preparation of secondary kind: the one-level kind is inoculated in 800ml LB liquid nutrient medium, and in 37 ℃, it is about 0.6 (about 4～5 hours) that 220rpm is cultured to OD600;
3) preparation of three grades of kinds: the secondary kind is inoculated in the 80L LB liquid fermentation tank, 37 ℃, with about citric acid, NaOH control pH7.0, ventilate and stir, dissolved oxygen is controlled at 20～30%, and being cultured to OD600 is about 0.6 (about 5～6 hours);
4) produce a jar fermentation: three grades of kinds are inoculated in the 3T fermentor tank, the LB liquid nutrient medium, 36～38 ℃, ventilate and stir, dissolved oxygen is controlled at 20～30%, controls pH 6～8 with citric acid, NaOH, cultivated about 26 hours, 10000g centrifugal force bactofugation behind molecular weight cut-off 5000～10000 ultra-filtration membrane concentrated supernatants, promptly gets TreP and concentrates stoste;
5) be raw material with malt syrup or starch slurry, produce the method for trehalose by conventional enzymatic conversion method and utilize above-mentioned reorganization TreP solution to make trehalose.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310174692.7A CN103215300B (en) | 2013-05-13 | 2013-05-13 | Method for producing trehalose synthase from integrated recombinant bacillus subtilis and manufacturing trehalose |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310174692.7A CN103215300B (en) | 2013-05-13 | 2013-05-13 | Method for producing trehalose synthase from integrated recombinant bacillus subtilis and manufacturing trehalose |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103215300A true CN103215300A (en) | 2013-07-24 |
| CN103215300B CN103215300B (en) | 2015-04-08 |
Family
ID=48813455
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310174692.7A Active CN103215300B (en) | 2013-05-13 | 2013-05-13 | Method for producing trehalose synthase from integrated recombinant bacillus subtilis and manufacturing trehalose |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103215300B (en) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105039381A (en) * | 2015-07-21 | 2015-11-11 | 齐鲁工业大学 | Maltose inducible trehalose synthase synthesis engineering bacterium, method for preparing same and application |
| CN106282221A (en) * | 2016-08-16 | 2017-01-04 | 齐鲁工业大学 | The construction method of a kind of secreting, expressing trehalose synthase gene engineering bacteria and application |
| CN106635942A (en) * | 2016-12-05 | 2017-05-10 | 齐鲁工业大学 | Engineering bacterium capable of stably displaying trehalose synthase on surfaces of spores and construction method of engineering bacterium |
| CN109679887A (en) * | 2018-12-06 | 2019-04-26 | 齐鲁工业大学 | A method of trehalose is produced using double enzymes fusion enzyme coupled fermentation of efficient secretory expression |
| CN110643552A (en) * | 2019-11-22 | 2020-01-03 | 河南省科学院生物研究所有限责任公司 | Bacterial strain for preparing seaweed syrup by using soluble starch and application thereof |
| CN111172089A (en) * | 2020-02-14 | 2020-05-19 | 江南大学 | Method for synthesizing trehalose by using recombinant trehalose synthase |
| CN111996208A (en) * | 2020-05-25 | 2020-11-27 | 南宁邦尔克生物技术有限责任公司 | Method for producing nicotinamide mononucleotide by utilizing recombinant bacillus subtilis |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101948821A (en) * | 2010-09-03 | 2011-01-19 | 南宁邦尔克生物技术有限责任公司 | Method for producing alpha-acetolacetate decearboxylase by using integrated recombinant bacillus subtilis as strain |
-
2013
- 2013-05-13 CN CN201310174692.7A patent/CN103215300B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101948821A (en) * | 2010-09-03 | 2011-01-19 | 南宁邦尔克生物技术有限责任公司 | Method for producing alpha-acetolacetate decearboxylase by using integrated recombinant bacillus subtilis as strain |
Non-Patent Citations (1)
| Title |
|---|
| 海藻糖合酶的分子生物学研究进展: "朱明 等", 《微生物学报》, vol. 49, no. 1, 4 January 2009 (2009-01-04), pages 6 - 12 * |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105039381A (en) * | 2015-07-21 | 2015-11-11 | 齐鲁工业大学 | Maltose inducible trehalose synthase synthesis engineering bacterium, method for preparing same and application |
| CN106282221A (en) * | 2016-08-16 | 2017-01-04 | 齐鲁工业大学 | The construction method of a kind of secreting, expressing trehalose synthase gene engineering bacteria and application |
| CN106282221B (en) * | 2016-08-16 | 2019-12-10 | 齐鲁工业大学 | Construction method and application of genetic engineering bacteria for secretory expression of trehalose synthase |
| CN106635942A (en) * | 2016-12-05 | 2017-05-10 | 齐鲁工业大学 | Engineering bacterium capable of stably displaying trehalose synthase on surfaces of spores and construction method of engineering bacterium |
| CN106635942B (en) * | 2016-12-05 | 2020-05-29 | 齐鲁工业大学 | Engineering bacterium for stably displaying trehalose synthase on surface of spore and construction method thereof |
| CN109679887A (en) * | 2018-12-06 | 2019-04-26 | 齐鲁工业大学 | A method of trehalose is produced using double enzymes fusion enzyme coupled fermentation of efficient secretory expression |
| CN109679887B (en) * | 2018-12-06 | 2020-12-22 | 齐鲁工业大学 | Method for producing trehalose by coupling fermentation of double-enzyme fusion enzyme with efficient secretory expression |
| CN110643552A (en) * | 2019-11-22 | 2020-01-03 | 河南省科学院生物研究所有限责任公司 | Bacterial strain for preparing seaweed syrup by using soluble starch and application thereof |
| CN111172089A (en) * | 2020-02-14 | 2020-05-19 | 江南大学 | Method for synthesizing trehalose by using recombinant trehalose synthase |
| CN111996208A (en) * | 2020-05-25 | 2020-11-27 | 南宁邦尔克生物技术有限责任公司 | Method for producing nicotinamide mononucleotide by utilizing recombinant bacillus subtilis |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103215300B (en) | 2015-04-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103215300B (en) | Method for producing trehalose synthase from integrated recombinant bacillus subtilis and manufacturing trehalose | |
| EP1831386B1 (en) | Acid fungal protease in fermentation of insoluble starch substrates | |
| Zambare | Solid state fermentation of Aspergillus oryzae for glucoamylase production on agro residues | |
| CN101084308B (en) | Heterologous alpha amylase expression in aspergillus | |
| Battan et al. | High-level xylanase production by alkaliphilic Bacillus pumilus ASH under solid-state fermentation | |
| EP2561083B1 (en) | Use of Humicola grisea glucoamylase in an SSF process at neutral pH | |
| CN102787130B (en) | Acid and high temperature resistant alpha-amylase, and its gene, engineering bacterium and preparation method | |
| CN101948821B (en) | Method for producing alpha-acetolacetate decearboxylase by using integrated recombinant bacillus subtilis as strain | |
| CN103224949B (en) | Bacillus subtilis for high-efficiency expression of recombination pullulanase and obtaining method thereof | |
| Singh et al. | Production of starch-gel digesting amyloglucosidase by Aspergillus oryzae HS-3 in solid state fermentation | |
| CN105339494A (en) | Pullulanase chimeras and polynucleotides encoding same | |
| AU2006202609A1 (en) | Use of corn with low gelatinization temperature for production of fermentation based products | |
| CN109385413B (en) | Glucoamylase TlGA1931 and gene and application thereof | |
| CN103834629A (en) | Recombinant high-temperature pullulanase and preparation method thereof | |
| CN102127529B (en) | Method for recombinant expression of beta-amylase in bacillus subtillis in integrated mode | |
| WO2015021601A1 (en) | Simultanenous liquifaction and malto-saccharification | |
| CN102409006B (en) | Strain and process method for producing acidic thermophilic amylase | |
| Adefisoye et al. | Production of Glucoamylase by Aspergillus niger in Solid State Fermentation | |
| CN110804620B (en) | Efficient expression and application of recombinant isoamylase for maltose production | |
| CN112771069B (en) | Saccharomyces cerevisiae strains expressing exogenous glucoamylase and xylanase and their use in bioethanol production | |
| Kaur et al. | Enzymatic Process for Corn Dry‐Grind High‐Solids Fermentation | |
| CN102676476B (en) | Dextranase with improved enzyme activity and thermal stability | |
| Abdel-Rahman et al. | Optimization of α-amylase and amyloglucosidase productions from some amylolytic yeast strains. | |
| CN104583385A (en) | Fungal cells that produce decreased amounts of peptaibols | |
| CN101503660A (en) | Engineering bacteria expressing thermophilic saccharifying enzyme and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |