CN103215252B

CN103215252B - Pretreatment method for extraction of microbial total DNA from composite contaminated river sediment

Info

Publication number: CN103215252B
Application number: CN201310089141.0A
Authority: CN
Inventors: 许玫英; 方云; 陈杏娟; 孙国萍
Original assignee: Guangdong Institute of Microbiology
Current assignee: Guangdong Detection Center of Microbiology of Guangdong Institute of Microbiology
Priority date: 2013-03-19
Filing date: 2013-03-19
Publication date: 2015-04-22
Anticipated expiration: 2033-03-19
Also published as: CN103215252A

Abstract

The invention discloses a pretreatment method for extraction of microbial total DNA from composite contaminated river sediment. The method includes: placing a composite contaminated river sediment sample in a rot removing reagent, conducting oscillation to mix them uniformly at 65DEG C, and then performing centrifugation to remove supernatant, and collecting the precipitated sediment; and then adding the precipitated sediment into the rot removing reagent, conducting oscillation to mix them uniformly, performing centrifugation to remove supernatant, and collecting the precipitated sediment, repeating washing in the way till the supernatant becomes colorless, thus obtaining the pretreated sample. The rot removing reagent comprises 0.1M EDTA, 0.1M Tris-HCl with pH of 8.0, 1.5M NaCl, 0.1M NaH2PO4, 0.1M Na2HPO4, and the balance water. In the invention, the conventional method is utilized to extract microbial total DNA from the pretreated composite contaminated river sediment, and complete and high quality microbial total DNA can be obtained, thus well meeting the relevant demands of subsequent microbial community structures and ecological function research thereof, and being conducive to subsequent molecular operation. Therefore, the invention provides technical support for monitoring and restoration research on contaminated rivers.

Description

The pre-treating process that a kind of combined pollution bed mud in river microorganism total DNA extracts

Technical field

The invention belongs to biological technical field, be specifically related to the pre-treating process that a kind of combined pollution bed mud in river microorganism total DNA extracts.

Background technology:

Microorganism in fluvial deposit can effectively be decomposed pollutent and transform, and reflects the pollution situation in river fast, delicately, plays an important role in river ecosystem restoration and health monitoring.Existing known can the microorganism that obtains of cultivation only account for total microbe population less than 1%.Along with the fast development of modern molecular biology, genomics, information biology, investigators can utilize the means exempting to cultivate to carry out the correlative study of microorganism, for the microbial technique understanding rivers health status and development Discussion On Measures of Rivers Pollution Treatment provides scientific basis and theoretical direction.Wherein, complete, high-quality, to be conducive to the microorganism total DNA of follow-up molecule manipulation acquisition is the important leverage of carrying out related work.

But, due to polluted river settling complicated component, pollutent composition wherein can not only to suppress in leaching process use the effect of reagent (SDS, N,O-Diacetylmuramidase, Proteinase K), affect the extraction rate was acquired of DNA, and the pollutent such as some humic acid similar to DNA sedimentation character can be separated out with DNA coprecipitation, cause the decline of its quality, thus affect the operation of its follow-up molecular level, even the reliability of experimental data.In DNA extraction process, how effectively to remove the pollutent in fluvial deposit, be the key ensureing fluvial deposit microorganism total DNA quality.

From environmental sample direct DNA isolation process in, the strategy removing the inhibition in sample has four kinds substantially: the first, be separated with DNA by inhibition before lysis.As by washing sample such as PBS, EDTA, Tween-20, or add CaCO ₃inhibition flocculation separation is made Deng flocculation agent.The second, lysis process adds reagent makes inhibition and DNA enter different phases, makes both be separated.As containing CTAB(cetyl trimethylammonium bromide), Triton X-100, PVPP (cross-linked polyvinylpyrrolidone), CaCl ₂deng lysis buffer extract DNA.Three, the DNA slightly carried is separated inhibition by methods such as gradient centrifugation, gel electrophoresis, Sephadex G-200 column chromatographies.When four, DNA being operated, sample is diluted or adds the effect that the reagent such as BSA (bovine serum albumin) reduce inhibition.In four kinds of strategies, the first strategy is that its advantage is apparent, before lysis, inhibition Pollution risk can be reduced to minimum in head step by DNA and isolation of inhibitors, improves the quality of DNA.

Summary of the invention:

The object of this invention is to provide the pre-treating process that a kind of combined pollution bed mud in river microorganism total DNA that is quick, simple and easy, low cost extracts, thus for complete, high-quality, to be conducive to follow-up molecule manipulation microorganism total DNA can be obtained, for polluted river monitoring and the research of repairing provide technical guarantee.

The pre-treating process that combined pollution bed mud in river microorganism total DNA of the present invention extracts, is characterized in that, combined pollution bed mud in river sample is placed in rotten reagent, 65 DEG C of vibration mixings, then centrifugally removes supernatant collecting precipitation bed mud; Add in rotten reagent again, vibration mixing, centrifugally removes supernatant collecting precipitation bed mud, repeated washing like this, until supernatant is colourless, namely obtains the sample after pre-treatment;

Described goes rotten reagent for containing 0.1M EDTA, pH8.00.1M Tris-HCl, 1.5M NaCl, 0.1M NaH ₂pO ₄with 0.1M Na ₂hPO ₄, surplus is water.

The method of the extraction STb gene conveniently again of the sample after pre-treatment extracts microorganism total DNA just.

65 DEG C of described vibration mixings, its duration of oscillation is preferably 15min.

Before the microorganism cells cracking of the present invention in combined pollution bed mud in river, spend rotten reagent wash bed mud, go rotten reagent effectively can remove soil ulmin in bed mud, humic acid, the inhibition such as heavy metal and organism, suitable temperature can increase reagent action intensity and unordered free diffusing power on the one hand, accelerate on the other hand some dissolving of undissolvable soil ulmin at a lower temperature and removal, thus enable the combined pollution bed mud in river after utilizing pre-treating process process of the present invention avoid heavy metal, the impact of the impurity such as humic acid and soil ulmin, microorganism total DNA in combined pollution bed mud in river after utilizing conventional DNA extraction method to extract pre-treatment, can obtain complete, high-quality microorganism total DNA, the related request of follow-up biological community structure and ecological functions research thereof can be met preferably, be conducive to follow-up molecule manipulation, for the research of polluted river monitoring and reparation provides technical guarantee, for the microbial technique understanding rivers health status and development Discussion On Measures of Rivers Pollution Treatment provides scientific basis and theoretical direction.

Accompanying drawing illustrates:

Fig. 1 is that difference goes rotten reagent washing by soaking bed mud situation, wherein a be soak bed mud centrifugal after situation, b be after washing 3 times bed mud centrifugal after situation;

Fig. 2 is the gel electrophoresis figure of the thick DNA of bed mud after different soaking temperature process;

Fig. 3 is the restriction enzyme mapping of the thick DNA of bed mud after different soaking temperature process;

Fig. 4 is the thick DNA16S rDNA V3 district PCR primer gel electrophoresis figure of the bed mud after different soaking temperature process.

Embodiment:

Following examples further illustrate of the present invention, instead of to control of the present invention.

Embodiment 1: the selection of removing rotten reagent

The bed mud sample gushing middle combined pollution from river, Rong Gui town, Fushan City, Guangdong Province is divided into 9 parts, every part of 0.25g (weight in wet base), adds 3ml respectively and remove rotten reagent S0: containing 0.1M EDTA, 0.1M Tris-HCl(pH8.0), 1.5M NaCl, 0.1M NaH ₂pO ₄with 0.1M Na ₂hPO ₄, surplus is water; Remove rotten reagent S1:0.1M EDTA, 0.1M Tris-HCl(pH8.0), 1.5M NaCl, 0.1M NaH ₂pO ₄with 0.1M Na ₂hPO ₄, 1%CTAB, surplus is water; Remove rotten reagent S2:0.1M EDTA, 0.1MTris-HCl(pH8.0), 1.5M NaCl, 0.1M NaH ₂pO ₄with 0.1M Na ₂hPO ₄, 0.05%Triton X-100,1%CTAB, surplus is water.Often kind of process 3 is parallel.After 25 ° of C water-bath concussion 10hrs, 12000rpm, 25 ° of C, centrifugal 5min, removes supernatant, then adds that corresponding to go rotten reagent 3ml to wash 2 times to supernatant be colourless respectively, add again after removing supernatant and correspondingly go rotten reagent 2ml resuspended, obtain the combined pollution bed mud in river sample after pre-treatment; Difference goes the combined pollution bed mud in river sample situation after the pre-treatment of rotten reagent washing by soaking as shown in Figure 1.Combined pollution bed mud in river sample microorganism total DNA extraction step traditionally after pre-treatment carries out.Specific as follows: combined pollution bed mud in river sample multigelation-80 ° of C10min after pre-treatment, 65 ° add 25 μ l N,O-Diacetylmuramidases (100mg/ml) after C5min3 time, add 10 μ l Proteinase Ks (20mg/ml) after 37 ° of C water-bath concussion 30min, 37 ° of C shake 30min; Then add 20% sodium laurylsulfonate (Sodium DodecylSulfate, SDS) of 220 μ l preheatings, 65 ° of C water-bath 2hrs, put upside down gently every 15-30min; 12000rpm, 25 ° of C, 10min collect supernatant liquor, then add equal-volume chloroform: primary isoamyl alcohol (24:1), and put upside down the rear 12000rpm of mixing, 25 ° of C, 10min collect supernatant liquor again, add the Virahol of 0.6 times of volume, precipitation DNA1hrs; Use 12000rpm again, 25 ° of C, 20min collected by centrifugation DNA precipitate.The DNA precipitation the obtained ethanol of 70% washes 2 times, adds 50 μ l deionized water dissolvings, obtain the thick DNA of the combined pollution bed mud in river sample after each pre-treatment thus after drying at room temperature.Adopt NanoDrop to measure thick DNA productive rate and quality, concrete outcome is as being shown in Table 1.

Table 1: thick DNA mass analysis table after different reagent washing by soaking bed mud

As can be seen from Table 1, the thick DNA through going rotten reagent S0 process to obtain is best in quality, therefore select S0 be soak and washing combined pollution bed mud in river remove rotten reagent, this goes rotten reagent to be: containing 0.1M EDTA, pH8.00.1M Tris-HCl, 1.5M NaCl, 0.1M NaH ₂pO ₄with 0.1M Na ₂hPO ₄, surplus is water.

Embodiment 2: the selection of soaking combined pollution bed mud in river temperature

The bed mud sample gushing middle combined pollution from river, Rong Gui town, Fushan City, Guangdong Province is divided into 12 parts, every part of 0.25g(weight in wet base), then add 3ml respectively and go rotten reagent S0(to contain 0.1M EDTA, pH8.00.1M Tris-HCl, 1.5M NaCl, 0.1MNaH ₂pO ₄with 0.1M Na ₂hPO ₄, surplus is water) in, then shake 15min at 25 ° of C, 37 ° of C, 50 ° of C, 65 ° of C respectively.Often organize process 3 parallel.12000rpm, 25 ° of C, centrifugal 5min, removes supernatant; Add rotten reagent S03ml again, concussion mixing, centrifugally removes supernatant collecting precipitation bed mud, and repeated washing like this 2 times is colourless to supernatant, and it is resuspended to add rotten reagent S02ml after removing supernatant again; Follow-up microorganism total DNA extraction step, with DNA extraction method traditional in embodiment 1, obtains the thick DNA of the combined pollution bed mud in river sample after pre-treatment thus.NanoDrop is adopted to measure thick DNA productive rate and quality, specifically as shown in table 2.

Table 2: thick DNA mass analysis table after different soaking temperature process

Get 5.0 μ l thick DNA1% agarose gel electrophoresis 100v20min, the results are shown in Figure 2.

The thick DNA sample of getting 2 μ l treatment of different temperature does EcoR I, Sau3A I collagenase treatment, the results are shown in Figure 3.System: EcoR I/Sau3A I0.5 μ l, 10 × H Buffer1 μ l, DNA2 μ l, ddH ₂06.5 μ l, control group is not enzyme-added supplies water, and 2, each sample is parallel, 37 ° of C water-bath 7hr.Digestion product gets 5.0 μ l1% agarose gel electrophoresis 100v20min.

16S rDNA V3 district Tap enzymatic amplification is done after the thick DNA sample for the treatment of of different temperature dilutes identical multiple.Primer sequence: F-CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAG CAG, R-ATTACCGCGGCTGCTGG.25 μ l systems: template DNA 1 μ l, 1 × PCR buffer (contain l.5mM MgC1 ₂), primers F and each 0.5 μM of R, dNTP200 μM, Tap enzyme 1U.Program: 95 ° of C denaturation 5min; 94 ° of C40s, 56 ° of C40s, 72 ° of C30s, 25 circulations; 72 ° of C extend 7min.PCR primer gets 5.0 μ l1% agarose gel electrophoresis 100v20min, the results are shown in Figure 4.

Can be obtained by above thick DNA mass analysis table (table 2) and restriction enzyme mapping (Fig. 3) and PCR primer gel electrophoresis spectrum (Fig. 4), 65 ° of C obtain thick DNA quality and molecule operability best, therefore select 65 ° of C as the temperature of washing by soaking bed mud.

Claims

1. the pre-treating process that extracts of combined pollution bed mud in river microorganism total DNA, it is characterized in that, combined pollution bed mud in river sample is placed in rotten reagent, 65 DEG C of vibration mixings, then centrifugally remove supernatant collecting precipitation bed mud; Add in rotten reagent again, vibration mixing, centrifugally removes supernatant collecting precipitation bed mud, repeated washing like this, until supernatant is colourless, namely obtains the sample after pre-treatment;

Described goes rotten reagent for containing 0.1M EDTA, pH8.0 0.1M Tris-HCl, 1.5M NaCl, 0.1M NaH ₂pO ₄with 0.1M Na ₂hPO ₄, surplus is water.

2. pre-treating process according to claim 1, is characterized in that, 65 DEG C of described vibration mixings, its duration of oscillation is 15min.