CN103215226A - Method for co-culturing with nerve stem cell to inducing rASCs to be DA Neuron by Lmx1a mediation - Google Patents
Method for co-culturing with nerve stem cell to inducing rASCs to be DA Neuron by Lmx1a mediation Download PDFInfo
- Publication number
- CN103215226A CN103215226A CN2012105434008A CN201210543400A CN103215226A CN 103215226 A CN103215226 A CN 103215226A CN 2012105434008 A CN2012105434008 A CN 2012105434008A CN 201210543400 A CN201210543400 A CN 201210543400A CN 103215226 A CN103215226 A CN 103215226A
- Authority
- CN
- China
- Prior art keywords
- cell
- lmx1a
- rascs
- plasmid
- days
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
A method for co-culturing with nerve stem cells to inducing rASCs to be DA Neurons by Lmx1a mediation, belongs to a method for treating Parkinson's disease by inducing stem cells to replacing defective Neuron cells. The method of the invention comprises steps of: building Lmx1a gene clone, recombining plasmid, building, packaging and recombining adenovirus Ad-Lmx1a, and co-culturing rASCs and NSCs which are infected by Ad-Lmx1a to differentiating them to be DA Neurons; and culturing rASCs and NSCs passage cells. Protein marker for expressing dopaminergic neuron cells can be differentiated from inducted neuron-like cells in the invention, and the inducted cells can transmit electric signal or secrete neurotransmitters, to prove that the inducted cells are the Neuron cells.
Description
Technical field
The invention belongs to molecular cytobiology, particularly induced dry-cell substitutes damaged neuronal cell to treat parkinsonian method.
Background technology
Parkinson's disease (Parkinson ' s disease, PD) be the common chronic neurological degeneration diseases of a kind of person in middle and old age, main pathological characters is that the black substance Dopamine HCL (Dopamine, DA) lose and remain in neurone and include a large amount of α-synapse nucleoproteins (the Louis corpusculum (Lewy bodies) of compositions such as α-synuclein), synphilin-1 and Parkin forms for Parkinson's disease by the selectivity sex change of serotonergic neuron.Clinical treatment is many can not fundamentally remove the cause of disease based on pharmacological agent, can not delay the process of disease, and along with long-term prescription and advancing of disease, the decline of carrying out property of effect, side effect is on the rise.Increase cerebrovascular patient, contact with chemical substance with heavy metal that environmental pollution causes and multiple factor affecting such as life stress under, Parkinson's disease show a rising trend, and rejuvenation occurs, the patient is more and more heavier with social burden.
The cell replacement treatment is the weave construction of rebuilding the injured nerve system, recovers a kind of available strategy of nervous function.According to traditional concept, (central nervous system CNS) belongs to tissue after the complete mitotic division to the central nervous system of Adult Mammals, does not have the ability of self and reparation.Therefore, the investigator utilizes fetal brain tissue transplantation's treatment nervous system disorders animal model and patient in the transplanting that focuses on embryonic tissue of rebuilding nervous function, has obtained successful experience in experiment and clinical study.But the transplanting embryo tissue exists teratomatous risk of formation and ethics requirement, has limited the widespread use of transplantation treatment.Therefore, comparatively the ideal method is exactly to find the cell that can produce Dopamine HCL maybe can be divided into the stem cell of dopaminergic neuron, the source that fundamentally solves the dopaminergic neuron cell.
Research is early stage, the researchist is grafted directly to embryonic stem cell in the parkinsonian mouse model body, embryonic stem cell can partly be divided into TH male neurone, but low dose of embryo stem cell transplantation to parkinsonian mouse model black substance nuclear group, in the brain of about 20% mouse teratoma is appearred after several weeks.The key issue that the especially parkinsonian cell therapy of cell replacement therapy will solve is to select suitable alternative cell.Mescenchymal stem cell is owing to the ideal candidates cell that has tissue repair characteristic, self and proliferation and differentiation, characteristics such as simple, the aboundresources of drawing materials become the treatment of PD cell replacement.
At present,, be subjected to the researchist and pay attention to, the revealed gradually and understanding of its molecular mechanism although the mesodermal mesenchyme stem cell does not still have induction method very efficiently to DA serotonergic neuron directed differentiation.Grow outside born of the same parents under the inducing of signal, (Rhesus adipose stem cells rASCs) can induce differentiation to other clone to adipose-derived mescenchymal stem cell, but its differentiation molecular mechanism is known little about it.Studies show that Lmx1a is the crucial regulatory factor in the dopaminergic neuron growth course, can start the development program of neuronal cell, make mouse embryo stem cell be divided into dopaminergic neuron.But the differentiation of dopaminergic neuron is multifactor, the rapid inductive complex process of multistep, needs cell interior and outside many signal paths in the different time coordinative role, activates multiple transcription factor, causes the cell variation of gene expression profile widely.
(Neural stem cells is to be present in the adult stem cell that has self and multidirectional differentiation potential in the central nervous system NSCs) to neural stem cell.Except being divided into neurone, astroglia cell nuclear oligodendrocyte in vivo, can also secrete a large amount of nutritional factor, as GDNF, Neuturin etc., neuronal cell is carried out the nutrition protection.
Summary of the invention
The objective of the invention is with the rhesus monkey is research object, provides a kind of fat mesenchymal stem cell of gathering rhesus monkey to carry out vitro culture, and then cultivates the method that the rASCs commentaries on classics is divided into the DA serotonergic neuron altogether with neural stem cell under the Lmx1a mediation.
Lmx1a of the present invention mediation with NSCs co-culturing, inducing rASCs be the method for DA serotonergic neuron, may further comprise the steps:
Step (1): make up Lmx1a gene clone and recombinant plasmid
With Lmx1a whole transcript cDNA(NM_138396) be template, primer is:
P1?up:5′-GCGTCGACGTACCATGCTGGACGGCCTAAAG-3′,
P1?down:5′-CGGGATCCCGCTTATCAAGATGTGAAGTAAG-3′,
By the dna fragmentation of pcr amplification acquisition band SalI and EcoR V restriction enzyme site, this fragment is inserted among the pShuttle-CMV, identify that by SalI and EcoR V double digestion obtain recombinant shuttle plasmid pShuttleCMV-Lmx1a, order-checking is also consistent with notional result;
Step (2): make up and packing recombinant adenovirus Ad-Lmx1a
Recombinant shuttle plasmid pShuttleCMV-Lmx1a successively carries out 5 ' dephosphorylation with linearization of PmeI and CIAP with step (1), purified back of its product and adenoviral gene group pAdEasy-1 electricity commentaries on classics simultaneously competent cell BJ-5183, get homology pAdEasy-1 recombinant plasmid, screening positive clone, the clone who successfully carries out homologous recombination with pAdEasy-1 can be cut out the fragment of 3.0kb or 4.5kb by the PacI enzyme;
The pAdEasy-1 recombinant plasmid that filters out transforms XL-10 (Gold) after identifying, amplification, extraction plasmid, make plasmid concentration reach 0.1 μ g/ μ L, with transfection HEK-293 cell behind the plasmid linearization, make recombinant adenovirus plasmid in the HEK-293 cell, pack recombinant adenovirus recombinant adenovirus Ad-Lmx1a, cytopathy comes off and is beading after 10 days, floats in the supernatant liquor, collects adenovirus particles;
Step (3): will infect the rASCs of Ad-Lmx1a and NSCs and cultivate altogether and be divided into the DA serotonergic neuron
(a) induce before, get rASCs s-generation cell, be inoculated in and be placed with six well culture plates that slide and bag are crossed poly-lysine, nutrient solution is the L-DMEM that contains 10%FBS; The NSCs that cultivates is inoculated in the transwell cell, and nutrient solution is the Neural Basal nutrient solution that contains 2% B27.
(b) infect rASCs with the Ad-Lmx1a of best MOI, and nutrient solution is replaced by the Neural Basal nutrient solution that contains 2% B27, changing liquid again after making the cell attachment rate maintain 85%, three day is that DMEM/F12 induced liquid I induces in advance, and the part cell begins to assemble;
(c) inoculation there is the transwell cell of NSCs put into six orifice plates that inoculation has the product cell of (b), NSCs cultivates 24h with product cell (b) altogether in containing the Neural Basal nutrient solution of 2% B27, the cell number showed increased, after 3 days induced liquid being changed liquid is the formal induced liquid II of Neural Basal, changed induced liquid II one time every 3 days, until 21 days;
Above DMEM/F12 induced liquid I is grouped into by following one-tenth:
2%FBS,
1.7?μM?SHH,
20?ng/mLbFGF,
6 mM beta-mercaptoethanols,
The DMEM/F12 substratum.
The formal induced liquid II of above Neural Basal is grouped into by following one-tenth:
2%B27,
1.7?μM?SHH,
100?ng/mLFGF-8,
20?ng/mLbFGF,
1%?N2?supplement,
20?μM?β-NADP,
Neural Basal substratum.
Described method is the cultivation of rASCs s-generation cell in the step (3):
(a) Patients Under Ketamine Anesthesia rhesus monkey is got the adult rhesus monkey greater omentum fatty tissue 1 ~ 2g of 6kg under the aseptic condition.Remaining bloodstain is removed in washing among the PBS, separating blood vessel and fibre composition, 0.1%I Collagen Type VI enzyme, 37 ℃ of digestion 1h;
(b) after digestion is finished, add and the isopyknic L-DMEM nutrient solution termination digestion that contains 10% new calves calf serum of type i collagen enzyme, filter, centrifugal 3 min of 1500 r/min abandon supernatant, draw bottom settlings and are used for the rASCs cultivation;
(c) with 1 * 10
6Be inoculated in the T-25 culturing bottle, 37 ℃, 5%CO
2Cultivated in the cell cultures 4 days under the condition, to monolayer adherence cell attachment rate near 90% o'clock, 0.25% tryptic digestion, 1:2 goes down to posterity, and during afterwards with cell amplification to 90%, is commissioned to train foster by 1:2 durative unofficial biography.
Described method is the cultivation of NSCs in the step (3):
Get pregnant 14 days SD rat, under aseptic condition, take out the uterus and place the Hanks damping fluid of precooling, isolate SD tire mouse, under dissecting microscope, get veutro midbrain district, add 0.025% pancreatin, 37 ℃ of digestion 10 min stop digestion with DMEM/F12, blow even, centrifugal 10 min of 1500 r/min, DMEM/F12 re-suspended cell with containing 20 ng/mL bFGF and 2%B27 is seeded to the T-25 culturing bottle, suspension culture;
Change liquid once every 48h half amount, 1:2 went down to posterity once in per 4 days, treated that it is the fresh Neural Basal substratum that contains 2% B27 that cell mass propagation is changed liquid.
The invention has the beneficial effects as follows:
The cell that the present invention obtains after to the adherent differentiation of clone ball is identified, find at least 60% cell expressing tyrosine hydroxylase (TH), illustrate that we separate the easier dopaminergic neuron cell that is divided into of NSCs that obtains from midbrain, can more discharge the promotion cytodifferentiation is the cytokine of dopaminergic neuron, and the NCM that contains cytokine plays good inducing action whole inducing in the process.
As everyone knows, the iuntercellular contact is very important to the growth of culturing cell, and the method for the culture of neural stem cells neural that adopts in the document was that clone ball is separated into individual cells in the past, and this method causes the physical abuse of cell, makes more cell dead in the back of going down to posterity.We show that what separate the neural stem cell key is the dynamics of piping and druming cell in test.The present invention has reduced necrocytosis with reference to the Clive isolation cultivation method, has kept the iuntercellular contact preferably, and the clone ball cell mass is more, rate of propagation is very fast, can obtain more stem in a short time, the stem cell propagating method that Clive is adopted is suitable for neural stem cell research.
Previously studies show that the ideal gene transfer vector is the key of carrying out genetic modification and treatment.With other mescenchymal stem cell ratios, mescenchymal stem cell is not expressed or the low immunological rejection mark of correlation of expressing, immunogenicity is low, it is a para-immunity deficient cells, must not use through strict pairing, heteroplastic transplantation does not have immunological rejection, is suitable for the transplanting between the Different Individual, and this point is seeming particularly important aspect the treatment nervous system disorders.Rhesus monkey is as non-human primate, and it is more approaching to separate the fat mesenchymal stem cell and the mankind that obtain, compares with rodent research, and obtained research data is more precious.The present invention is a raw material with ASCs, draw materials convenient and vitro culture simple to operate, can provide competent cell source for possible clinical and experimental study in the future.
Multipotential stem cell is divided into specific histocyte type and the associated molecule Mechanism Study is the important directions of stem-cell research always, and especially Study on Molecular Mechanism is less.Studies show that the SHH/Lmx1a/Msx1 signal path plays very important regulating and controlling effect in the DA neurone differentiation and maturation process in early days, but in fat mesenchymal stem cell is divided into neurone research, yet there are no report.Originally researching and proposing the SHH/Lmx1a/Msx1 signal path cultivates altogether in conjunction with NSCs and multipotential stem cell is divided into neuronal cell has vital role and more belong to the first.
The present invention proves by experiment, in being total to culture environment, by adenovirus the Lmx1a gene being passed to rASCs and can making rASCs be differentiated to form the dopaminergic neuron cell.Lmx1a regulates and control the differentiation direction of rASCs, after cultivating altogether with the NSCs that derives from tire mouse midbrain, under pointed induction scheme, the neuron cell that differentiation is come out can be expressed multiple specific expressed protein marker in the dopaminergic neuron cell, and can estimate and induce rASCs is the dopaminergic neuron cell.
Cell after the present invention induces can conducting electrical signals or secretory nerve mediator, proves that inducing cell is a neuronal cell.
Description of drawings
Fig. 1 is Lmx1a gene clone and recombinant shuttle plasmid pShuttleCMV-Lmx1a The selection result (A) 1 thereof, DNA marker DL, 2000; 2, Lmx1a PCR product (1149bp); (B) 1,
Sal IAnd
EcoR VRestriction analysis recombinant plasmid pShuttleCMV-Lmx1a; 2, DNA marker DL, 15000.
Fig. 2 is the screening of recombinant adenovirus plasmid pAdEasy-Lmx1a and pAdEasy-NGF/NTN.
1, the 2, the 3rd, recombinant adenovirus plasmid is cut through Pac I enzyme, produces the fragment of 4.5kb and 3.0 kb respectively; 4, DNA marker DL, 15000.
Fig. 3 is cytopathy (200 *) and the transmission electron microscope observing recombinant adenovirus negative staining result that the packing of recombinant adenovirus in HEK-293 produces.(A) control cells (B) sick cell (C) recombinant adenovirus negative staining result.
Fig. 4 is rASCs morphologic observation and BrdU fluorescent dye.
Fig. 5 is a transmission electron microscope observing rASCs multipotential cell feature.
To be rASCs induce differentiation and identify (A) rASCs after becoming fat to induce to adipocyte and scleroblast Fig. 6; (B) oil red O stain is identified adipocyte; (C) scleroblast is identified in ALP dyeing; (D) scleroblast is identified in sodium alizarinsulfonate dyeing.
Fig. 7 is NSCs and by the neuronic evaluation of NSCs inductive.
Fig. 8 is that rASCs infects Ad-Lmx1a and NSCs co-culturing, inducing scheme and cellular form variation synoptic diagram.
Fig. 9 is that RT-PCR and immunofluorescence detect the rASCs specificity neuronal protein transcript and expression situation of inducing: (A) immunofluorescence result; (B) RT-PCR result; (C) neuronal specificity protein immunization fluorescence statistics.
Figure 10 is that rASCs Dopamine HCL release conditions is induced in the ELISA detection.
The present invention will be further described below in conjunction with accompanying drawing.
Embodiment
One, Lmx1a mediation with neural stem cell co-culturing, inducing rASCs be the method for DA serotonergic neuron
(1) Lmx1a gene clone and construction of recombinant plasmid
With Lmx1a whole transcript cDNA(NM_138396) be template, primer is:
P1?up:5′-GCGTCGACGTACCATGCTGGACGGCCTAAAG-3′,
P1?down:5′-CGGGATCCCGCTTATCAAGATGTGAAGTAAG-3′,
By the dna fragmentation of pcr amplification acquisition band SalI and EcoR V restriction enzyme site, the agarose gel electrophoresis check and analysis by 1%, the band of amplification and theoretical molecular coincide, and the results are shown in Figure 1A.Amplified fragments is inserted among the pShuttle-CMV, identify, obtain recombinant shuttle plasmid pShuttleCMV-Lmx1a, the results are shown in Figure 1B by Sal I and EcoR V double digestion.Recombinant clone checks order, and sequencing result is consistent with notional result.
Above Lmx1a whole transcript cDNA(NM_138396) buys from GeneCopoeiaTM company.Buy.
(2)The structure of recombinant adenovirus and packing
Recombinant shuttle plasmid pShuttleCMV-Lmx1a successively carries out 5 ' dephosphorylation with linearization of PmeI and CIAP with step (1), purified back of its product and adenoviral gene group pAdEasy-1 electricity commentaries on classics simultaneously competent cell BJ-5183, get homology pAdEasy-1 recombinant plasmid, coating contains the LB plate screening positive colony of kantlex, the clone who successfully carries out homologous recombination with pAdEasy-1 can be cut out the fragment of 3.0kb or 4.5kb by the PacI enzyme, the results are shown in Figure 2.
The pAdEasy-1 recombinant plasmid that filters out transforms XL-10 (Gold) after identifying, amplification, extraction plasmid, make plasmid concentration reach 0.1 μ g/ μ L, with transfection HEK-293 cell behind the plasmid linearization, make recombinant adenovirus plasmid in the HEK-293 cell, pack recombinant adenovirus recombinant adenovirus Ad-Lmx1a, after 10 days, cytopathy comes off and is beading, float in the supernatant liquor, collect adenovirus particles, visible typical adenovirus particles under transmission electron microscope.See Fig. 3.
(3) rASCs of infection Ad-Lmx1a and NSCs cultivate altogether and are divided into dopaminergic neuron
(a) induce before, get rASCs s-generation cell, be inoculated in and be placed with six well culture plates that slide and bag are crossed poly-lysine, nutrient solution is the L-DMEM that contains 10%FBS; The NSCs that cultivates is inoculated in the transwell cell, and nutrient solution is the Neural Basal nutrient solution that contains 2% B27.
(b) according to the induction scheme of Fig. 8, Ad-Lmx1a with best MOI infects rASCs, the rASCs growth conditions is good, the a few cell levitating appears, and nutrient solution is replaced by the Neural Basal nutrient solution that contains 2% B27, changing liquid after making the cell attachment rate maintain 85%, three day again is that DMEM/F12 induced liquid I induces in advance, and the part cell begins to assemble;
Above DMEM/F12 induced liquid I is grouped into by following one-tenth:
2%FBS,
1.7?μM?SHH,
20?ng/mLbFGF,
6 mM beta-mercaptoethanols,
The DMEM/F12 substratum.
(c) inoculation there is the transwell cell of NSCs put into six orifice plates that inoculation has the product cell of (b), NSCs cultivates 24h with product cell (b) altogether in containing the Neural Basal nutrient solution of 2% B27, the cell number showed increased, after 3 days induced liquid being changed liquid is the formal induced liquid II of Neural Basal, changed induced liquid II one time every 3 days, until 21 days;
The formal induced liquid II of above Neural Basal is grouped into by following one-tenth:
2%B27,
1.7?μM?SHH,
100?ng/mLFGF-8,
20?ng/mLbFGF,
1%?N2?supplement,
20?μM?β-NADP,
Neural Basal substratum.
After inducing 21 days, send elongated cynapse, interconnect be cross-linked to form at last network-like, induce the back cell survival better, the result is as shown in Figure 8.
(2) evaluation of the dopaminergic neuron of the product of the inventive method
1) RT-PCR detects the neuronal specificity genetic transcription situation of inducing the back cell
Total RNA of cell after extraction is induced and control cells, extraction step is undertaken by the test kit operation instructions.After extracting gained cell total rna uses colorimetric method for determining RNA concentration, utilize cDNA synthetic agent box to carry out the synthetic of cDNA first chain respectively.Utilize all gene primers shown in the table 1 that the cDNA that reverse transcription becomes is carried out PCR, 1% agarose electrophoresis detects the PCR product, and Taking Pictures recording.The result shows: compare with β-actin, contrasting the rASCs cell and inducing in the rASCs cell, Nurr1 and β-tubulin III all transcribes.When inducing 21 days, induce Nurr1 in the group, β-tubulin III, Nefm, nestin, GFR α 2 gene transcription levels to raise, nestin occur to raise inducing in back 14 days, and to transcribe also appear in dopaminergic neuron specific gene TH, and the result is shown in Fig. 9 B.
2) immunofluorescence detects the neuronal specificity protein expression of inducing the back cell
RASCs behind the co-culturing, inducing is carried out neuronal specificity protein N SE, β-tubulinIII and the detection of TH immunofluorescence.Compare with control cells, behind co-culturing, inducing 21 days the time, induce group cell specific expression NSE, β-tubulin III and TH albumen, do not detect the expression of MAP-2, after the fluorescin positive cell added up, discovery is with the prolongation of induction time, and the expression rate of NSE, β-tubulin III and TH constantly increases (Fig. 9 A).
3) induce back neuronal cell Dopamine HCL secretion to measure
Utilize the Dopamine HCL detection kit, whether the rASCs that measures after inducing can the release neurotransmitters Dopamine HCL.The result shows that under induction scheme of the present invention, the rASCs of Lmx1a transduction is about 180pg/10 at the Dopamine HCL of inducing the back than 1.2 times of the rASCs of the Lmx1a that the do not transduce secretions of Duoing
5Cell, and in the metainfective not inductive of Ad-LacZ rASCs, can not detect the release (Figure 10) of Dopamine HCL.
Two, the cultivation of rASCs of the present invention and evaluation
Under the aseptic condition, the Patients Under Ketamine Anesthesia rhesus monkey is got rhesus monkey greater omentum fatty tissue.PBS flushing 4 times separates visible blood vessel and fibre composition, 0.1% type i collagen enzyme, and 37 oC digest 1 h.After digestion is finished, add and the isopyknic L-DMEM nutrient solution termination digestion that contains 10% foetal calf serum (FBS) of type i collagen enzyme, filter, centrifugal 3 min of 1500 r/min abandon supernatant, draw bottom settlings and are used for the rASCs cultivation.The fat stem cell major part of cultivating is promptly adherent in 24 h, observes under inverted microscope, and attached cell is fusiformis, and endochylema is abundant, nuclear is big, kernel is obvious, and visible cell is the growth of clone's sample.After going down to posterity, visible fibroblast-like cells form under inverted microscope, cell is be arranged in parallel growth or swirl shape growth, and is similar with the MSCs of derived from bone marrow on form, mixing experiment detection rASCs proliferation index by BrdU is 40%(Fig. 4).
In order to identify the versatility of rASCs, we get rASCs first-generation cell PBS and wash the centrifugal 10min of twice, 1500 r/min, and 2.5% glutaraldehyde-0.2 mol/L cacodylic acid is fixed, transmission electron microscope observing nucleus and organoid feature.Cell surface has many microvilluss, is distributed in cell space one side, and karyon is irregular, and organoid is abundant, and endochylema internal ribosome, plastosome, rough surface endoplasmic reticulum, golgi body, lysosome are more, meet multipotential cell feature (Fig. 5).
In order to identify that the rASCs that our separation and Culture obtains has multidirectional differentiation potential, we induce rASCs to adipocyte and scleroblast.Induction method is as follows:
1) become fat to induce: to get rASCs third generation cell, be inoculated in six orifice plates that are placed with slide.When cell converges rate and reaches 95%, change liquid for containing 10%FBS, 1 μ M dexamethasone, the H-DMEM of 10 μ g/mL Regular Insulin and 0.5 mM 3-isobutyl-1-methylxanthine.Changing liquid after four days is H-DMEM (containing 10%FBS), 1 μ M dexamethasone, 10 μ g/mL Regular Insulin, 0.5 mM 3-isobutyl-1-methylxanthine and 200 μ M indomethacins.Changed a not good liquor every 3 days, in the time of 18 days, identify with oil red O stain.
2) osteogenic induction: get rASCs third generation cell, be inoculated in six orifice plates that are placed with slide.When cell converged rate and reaches 95%, changing liquid was H-DMEM, contains 10%FBS, 10 nM dexamethasone, 10 mM β Sodium Glycerophosphates and 150 μ M L xitix-2-tricresyl phosphate sodium salts.Changed a not good liquor every 3 days, in the time of 21 days, ALP and sodium alizarinsulfonate dyeing are identified.
The result shows that rASCs can have multidirectional differentiation potential (Fig. 6) to adipocyte and osteoblast differentiation under above-mentioned inductive condition.
Three, the cultivation of NSCs of the present invention and evaluation
Get pregnant 14 days SD rat, under aseptic condition, take out in the Hanks damping fluid of uterus as for precooling, isolate SD tire mouse, under dissecting microscope, find veutro midbrain district, add 0.025% pancreatin, 37 ℃ of digestion 10 min stop digestion with DMEM/F12, blow even, centrifugal 10 min of 1500 r/min, with DMEM/F12 (bFGF and the 2%B27 that contain 20 ng/ml) re-suspended cell, be seeded to the T-25 culturing bottle, suspension culture.Change liquid once every 48h half amount, 1:2 went down to posterity once in per 4 days, and when treating that cell mass is bred to certain number, changing liquid is fresh Neural Basal substratum (containing 2% B27).
The isolating neural stem cell growth conditions of tire mouse midbrain is good, begins to observe the cell fission phenomenon at the former foster 3d that is commissioned to train, and impurity is more; Can see when cultivating the 7th day that diameter is about the clone ball of 100 μ m, clone ball is in good condition, adheres to the individual cells of the circle of clear-cut around the ball, and impurity reduces gradually; Most clone ball diameters reach 200 μ m when cultivating 10d; Along with the prolongation gradually of incubation time, the blackening gradually of clone ball center, the clone ball adherent growth that has has cell to be the growth of radiation sample around the ball.Cultured cell line propagation is more former is commissioned to train and supports soon, can form the clone ball of the about 200 μ m of diameter when cultivating the 7th day going down to posterity.
In order to identify that the present invention separates whether the cell that obtains is neural stem cell, the neural stem cell clone ball that we will cultivate through mono-clonal is together with the substratum one logical 50ml centrifuge tube of pouring into, the centrifugal 5min of 1000r/min, outwell supernatant liquor after, with DMEM/F12 substratum resuspended its cell precipitation.Behind the trypan blue counting, be inoculated on the slide that is positioned over six well culture plates that is coated with poly-lysine, the culture medium culturing of increase serum is not after 3 days again, and neural ball is adsorbed on the slide, neural ball is carried out the nestin immunofluorescence detect detected result positive (Fig. 7).Simultaneously, in the different culture hole of same six hole culture hole, it is the DMEM/F12 substratum that contains 10%FBS that serum free medium DMEM/F12 (bFGF that contains 2%B27 and 20ng/ml) is changed liquid, carries out external evoked to neural stem cell.After inducing 10 days, carry out the identified by immunofluorescence of TH to inducing NSCs, detected result positive (Fig. 7) proves that separating the cell mass that obtains is neural stem cell, and can neuralward unit cytodifferentiation.
Specification sheets Nucleotide and aminoacid sequence table
<110〉China Medical Sciences Academy Medical Biology Institute
<120〉Lmx1a mediation with neural stem cell co-culturing, inducing rASCs be the method for DA serotonergic neuron
〈160〉2
〈170〉Patent?Version?1
〈210〉1
〈211〉31
〈212〉DNA
<213〉artificial sequence
〈220〉
〈221〉misc-feature
〈222〉(1)…(31)
<223〉clone Lmx1a upstream region of gene primer sequence
〈400〉1
GCGTCGACGTACCATGCTGGACGGCCTAAAG
〈210〉2
〈211〉31
〈212〉DNA
<213〉artificial sequence
〈220〉
〈221〉misc-feature
〈222〉(1)…(31)
<223〉the downstream primer sequence of clone Lmx1a gene
〈400〉2
CGGGATCCCGCTTATCAAGATGTGAAGTAAG
Claims (3)
1.Lmx1a the mediation with neural stem cell co-culturing, inducing rASCs be the method for DA serotonergic neuron, may further comprise the steps:
Step (1): make up Lmx1a gene clone and recombinant plasmid
With Lmx1a whole transcript cDNA(NM_138396) be template, primer is:
P1?up:5′-GCGTCGACGTACCATGCTGGACGGCCTAAAG-3′,
P1?down:5′-CGGGATCCCGCTTATCAAGATGTGAAGTAAG-3′,
By the dna fragmentation of pcr amplification acquisition band SalI and EcoR V restriction enzyme site, this fragment is inserted among the pShuttle-CMV, identify that by SalI and EcoR V double digestion obtain recombinant shuttle plasmid pShuttleCMV-Lmx1a, order-checking is also consistent with notional result;
Step (2): make up and packing recombinant adenovirus Ad-Lmx1a
Recombinant shuttle plasmid pShuttleCMV-Lmx1a successively carries out 5 ' dephosphorylation with linearization of PmeI and CIAP with step (1), purified back of its product and adenoviral gene group pAdEasy-1 electricity commentaries on classics simultaneously competent cell BJ-5183, get homology pAdEasy-1 recombinant plasmid, screening positive clone, the clone who successfully carries out homologous recombination with pAdEasy-1 can be cut out the fragment of 3.0kb or 4.5kb by the PacI enzyme;
The pAdEasy-1 recombinant plasmid that filters out transforms XL-10 (Gold) after identifying, amplification, extraction plasmid, make plasmid concentration reach 0.1 μ g/ μ L, with transfection HEK-293 cell behind the plasmid linearization, make recombinant adenovirus plasmid in the HEK-293 cell, pack recombinant adenovirus Ad-Lmx1a, cytopathy comes off and is beading after 10 days, floats in the supernatant liquor, collects adenovirus particles;
Step (3): will infect the rASCs of Ad-Lmx1a and NSCs and cultivate altogether and be divided into the DA serotonergic neuron
(a) induce before, get rASCs s-generation cell, be inoculated in and be placed with six well culture plates that slide and bag are crossed poly-lysine, nutrient solution is the L-DMEM that contains 10%FBS; The NSCs that cultivates is inoculated in the transwell cell, and nutrient solution is the Neural Basal nutrient solution that contains 2% B27;
(b) infect rASCs with the Ad-Lmx1a of best MOI, and nutrient solution is replaced by the Neural Basal nutrient solution that contains 2% B27, changing liquid again after making the cell attachment rate maintain 85%, three day is that DMEM/F12 induced liquid I induces in advance, and the part cell begins to assemble;
Above DMEM/F12 induced liquid I is grouped into by following one-tenth:
2%FBS,
1.7?μM?SHH,
20?ng/mLbFGF,
6 mM beta-mercaptoethanols,
The DMEM/F12 substratum;
(c) inoculation there is the transwell cell of NSCs put into six orifice plates that inoculation has the product cell of (b), NSCs cultivates 24h with product cell (b) altogether in containing the Neural Basal nutrient solution of 2% B27, the cell number showed increased, after 3 days induced liquid being changed liquid is the formal induced liquid II of Neural Basal, changed induced liquid II one time every 3 days, until 21 days;
The formal induced liquid II of above Neural Basal is grouped into by following one-tenth:
2%B27,
1.7?μM?SHH,
100?ng/mLFGF-8,
20?ng/mLbFGF,
1%?N2?supplement,
20?μM?β-NADP,
Neural Basal substratum.
2. method according to claim 1 is characterized in that the cultivation of rASCs s-generation cell in the step (3):
(a) Patients Under Ketamine Anesthesia rhesus monkey is got the adult rhesus monkey greater omentum fatty tissue 1 ~ 2g of 6kg under the aseptic condition,
Remaining bloodstain is removed in washing among the PBS, separating blood vessel and fibre composition, 0.1%I Collagen Type VI enzyme, 37 ℃ of digestion 1h;
(b) after digestion is finished, add and the isopyknic L-DMEM nutrient solution termination digestion that contains 10% new calves calf serum of type i collagen enzyme, filter, centrifugal 3 min of 1500 r/min abandon supernatant, draw bottom settlings and are used for the rASCs cultivation;
(c) with 1 * 10
6Be inoculated in the T-25 culturing bottle, 37 ℃, 5%CO
2Cultivated in the cell cultures 4 days under the condition, to monolayer adherence cell attachment rate near 90% o'clock, 0.25% tryptic digestion, 1:2 goes down to posterity, and during afterwards with cell amplification to 90%, is commissioned to train foster by 1:2 durative unofficial biography.
3. method according to claim 1 is characterized in that the cultivation of NSCs in the step (3):
Get pregnant 14 days SD rat, under aseptic condition, take out the uterus and place the Hanks damping fluid of precooling, isolate SD tire mouse, under dissecting microscope, get veutro midbrain district, add 0.025% pancreatin, 37 ℃ of digestion 10 min stop digestion with DMEM/F12, blow even, centrifugal 10 min of 1500 r/min, DMEM/F12 re-suspended cell with containing 20 ng/mL bFGF and 2%B27 is seeded to the T-25 culturing bottle, suspension culture;
Change liquid once every 48h half amount, 1:2 went down to posterity once in per 4 days, treated that it is the fresh Neural Basal substratum that contains 2% B27 that cell mass propagation is changed liquid.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2012105434008A CN103215226A (en) | 2012-12-16 | 2012-12-16 | Method for co-culturing with nerve stem cell to inducing rASCs to be DA Neuron by Lmx1a mediation |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN2012105434008A CN103215226A (en) | 2012-12-16 | 2012-12-16 | Method for co-culturing with nerve stem cell to inducing rASCs to be DA Neuron by Lmx1a mediation |
Publications (1)
Publication Number | Publication Date |
---|---|
CN103215226A true CN103215226A (en) | 2013-07-24 |
Family
ID=48813390
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN2012105434008A Pending CN103215226A (en) | 2012-12-16 | 2012-12-16 | Method for co-culturing with nerve stem cell to inducing rASCs to be DA Neuron by Lmx1a mediation |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN103215226A (en) |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114441413A (en) * | 2022-01-24 | 2022-05-06 | 南京医科大学 | Analysis method for single vesicle storage in dopaminergic neuron induced and differentiated by iPSC technology |
CN115591025A (en) * | 2022-11-09 | 2023-01-13 | 深圳先进技术研究院(Cn) | Nerve regulation device, preparation method and application thereof |
-
2012
- 2012-12-16 CN CN2012105434008A patent/CN103215226A/en active Pending
Non-Patent Citations (3)
Title |
---|
CHUNLONG KE ET AL.: "Differentiation of embryonic versus adult rat neural stem cells into dopaminergic neurons in vitro", 《NEURAL REGENERATION》 * |
NEURAL REGENERATION RESEARCH: "Differentiation of rhesus adipose stem cells into dopaminergic neurons.", 《NEURAL REGENERATION RESEARCH》 * |
ZHOU Y ET AL.: "Recovery of behavioral symptoms in hemi-parkinsonian rhesus monkeys through combined gene and stem cell therapy", 《CYTOTHERAPY》 * |
Cited By (3)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN114441413A (en) * | 2022-01-24 | 2022-05-06 | 南京医科大学 | Analysis method for single vesicle storage in dopaminergic neuron induced and differentiated by iPSC technology |
CN115591025A (en) * | 2022-11-09 | 2023-01-13 | 深圳先进技术研究院(Cn) | Nerve regulation device, preparation method and application thereof |
CN115591025B (en) * | 2022-11-09 | 2024-01-02 | 深圳先进技术研究院 | Nerve regulation device, preparation method and application thereof |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN104450611B (en) | A kind of primary isolation and culture method of human amnion mesenchymal stem cell | |
CN104946590B (en) | The induction of Muse cell is the method for neural precursor in Adult Human Bone Marrow | |
CN110747163B (en) | Method for improving adipogenic differentiation of human adipose-derived mesenchymal stem cells and special culture medium thereof | |
CN104726406A (en) | Method for inducing dental pulp mesenchymal stem cells to be differentiated into nerve cells | |
US20210355439A1 (en) | Differentiation medium and method for preparing oligodendrocyte precursor | |
CN103881971B (en) | Culture medium and culture method for culturing and/or amplifying mesenchymal stem cells | |
CN109988746A (en) | A kind of mescenchymal stem cell adipogenic induction differentiation method | |
CN104232574A (en) | Method for in-vitro directional differentiation inducing of mesenchymal stem cell towards melanocyte | |
CN106929470A (en) | It is a kind of for derived mesenchymal stem cells in vitro culture and amplification serum free medium | |
CN106350521A (en) | Preparation method of ALS (Amyotrophic Lateral Sclerosis) patient specific motor neuron | |
CN106854638A (en) | A kind of method that inducing mesenchymal stem cell is divided into islet-like cells | |
CN107287156A (en) | A kind of isolated culture method of fat mesenchymal stem cell and its application | |
CN110564681B (en) | Isolated culture and nerve directional differentiation method of deciduous tooth pulp stem cells | |
CN109266610A (en) | A method of promotion Derived from Mesenchymal Stem Cells is neuron | |
CN106119191A (en) | A kind of placental villi plate mescenchymal stem cell and clinicization preparation method | |
CN110229790A (en) | Immortal human derived neural stem cell line, preparation method, recombinant viral vector and application | |
CN107083359A (en) | Stem cell media and method for separating stem cell | |
CN101294146B (en) | System for inducing nerve stem cell differentiation and inducing method thereof | |
CN108070558B (en) | Preparation method of clinical-grade neural stem cells | |
CN109554351A (en) | The application of Rspo1 inducing bone mesenchymal stem cell Cardiocytes differentiation | |
CN103215226A (en) | Method for co-culturing with nerve stem cell to inducing rASCs to be DA Neuron by Lmx1a mediation | |
CN105087475B (en) | A kind of method that cell culture fluid and its application and induction dental pulp stem cell break up to neural-like cells | |
Chen et al. | Trophic factor induction of human umbilical cord blood cells in vitro and in vivo | |
CN103013918A (en) | Method for separating and subculturing primary neural stem cell of human embryo midbrain | |
CN111304167B (en) | Neuron precursor cells derived from human adipose-derived stem cells, and preparation method and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20130724 |