CN103205429B - Promoter and applications thereof - Google Patents
Promoter and applications thereof Download PDFInfo
- Publication number
- CN103205429B CN103205429B CN201310146067.1A CN201310146067A CN103205429B CN 103205429 B CN103205429 B CN 103205429B CN 201310146067 A CN201310146067 A CN 201310146067A CN 103205429 B CN103205429 B CN 103205429B
- Authority
- CN
- China
- Prior art keywords
- promotor
- plant
- promoter
- tobacco
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a damage-induced type promoter, and the nucleotide sequence of the promoter is SEQ ID NO: 1. The promoter can be used for constructing a eukaryotic expression vector which is used for expressing a foreign gene in a plant. The separation and identification of the high-efficiency tobacco induction type starter can provide experiment and technology support for the research and development of a tobacco bioreactor. By taking tobacco as the bioreactor, the high-efficiency induction type starter is utilized for expressing vaccine, antibody, other pharmaceutical protein and the like, thereby being capable of breaking through the traditional agricultural category and extending to the medical field.
Description
Technical field
The invention belongs to genetically engineered field, be specifically related to a kind of promotor and application thereof, a kind of plant promoter, coerces the lower expression that can start regulatory gene in damage.
Background technology
In genetically engineered research, external source goal gene is expressed in receptor biological, to improve the resistance of crop to environment-stress such as arid, salt, alkali and disease and pests, or improve crop quality and Crop Improvement economical character etc., become a kind of important means of current improvement of crop cultivar.In recent years, separation and the research about promotor becomes one of focus of domestic and international research.Huge contribution has been made in the engineered research that develops into crop disease-resistant insect pest research and plant bioreactor.But, how to control foreign gene high efficient expression at regular time and quantity, be the important factor that restriction gene engineering is effectively applied aspect crop genetic improvement.Except finding effective goal gene, finding the effectively promotor of control exogenous gene expression becomes the major issue that needs solution in genetically engineered improvement.Use constitutive promoter to order about exogenous gene expression, not only cause the wasting of resources, also directly affect growing and normal physiological metabolism of plant, and use inducible promoter not only can not cause the waste of various resources, can strengthen again plant materials resistance to external world, impact (the Zhu Liping etc. of minimizing on growth and development of plants and other pathways metabolisms, 2010, heredity 32,229-234).Therefore, study and utilize inducible promoter, for the adversity gene engineering of studying the various physiological Mechanism of coercing of plant responding and research farm crop, have important meaning, aspect fundamental research and Plant Biotechnology, also having broad application prospects.
Promotor is roughly divided into three kinds of constitutive promoter, tissue-specific promoter and inducible promoters according to its function and efficacy mode.Constitutive promoter can promotor gene in all Organ and tissues continuous expression, do not possess Space-time speciality.Most widely used in plant is at present from cauliflower mosaic virus (CaMV) 35S promotor, a constitutive promoter of latest find is the poly ubiquitin McUBI1 gene promoter from ice plant, and it is also more stable than 35S promotor in transient expression is analyzed.Other corn ubiquitin Ubiquitin promotor (Streatfield etc. in addition, 2004, Transgenic Res 13,299-312), paddy rice RuBQ2 promotor (Wang etc., 2003, Plant Cell Rep 22,129-134), paddy rice SUI I promotor (Wei Jing etc., 2012, Hua Zhong Agriculture University's journal 31,139-146) etc.Such promoter activity is higher, but because causing foreign gene, it at the different sites of the whole growth period of transgenic plant, expresses, affect growing and normal physiological metabolism of plant, some product may cause toxic action, be unfavorable for the raising of quality and yield, even can cause the death of plant.Therefore,, for the expression of regulating plant gene better, the research of Idiotype promotor and inducible promoter and application are more and more subject to people and pay attention to.
Organizing specific type promotor refers to that gene only expresses in some specific organ or tissue, often has and grows the feature regulating, and promoter region contains the cis-acting elements of kind, different amts.Very extensive to the separation of Idiotype promotor and research at present, as tobacco root-specific TobRB7 promotor (Qu Bo etc., 2008, Jilin agricultural science and technology institute journal 17, 9-15), tobacco anther-specific TA29 promotor (Huanghai Sea spring etc., 2012, Jiangsu agricultural sciences 40, 26-28), tobacco leaf specificity rbcS promotor (Sun Jiali etc., 2010, Chinese tobacco journal 16, 80-85), maize leaf specificity PPCA1 promotor (Gowik etc., 2004, Plant Cell 16, 1077-1090), strawberry fruit specificity GalUR promotor (Agius etc., 2005, J Exp Bot 56, 37-46) etc.The further investigation of such promotor contributes to illustrate the basic theory of growth and development of plants and physiological metabolism, and is with a wide range of applications.
Inducible promoter refers under standard state and does not express or low expression, is subject to the stimulation of some physics or chemical signal, can improve significantly the expression level one class promotor of gene.According to induction factor, inducible promoter can be divided into photoinduction type promotor, temperature-induced type promotor, wound inducement type promotor, hormone induction type promotor and fungal induction type promotor etc.Be characterized in: be subject to the induction of physics or chemical factor; Contain several functions element, the collaborative activity that strengthens or reduce promotor; Part inducible promoter has the feature of tissue-specific promoter simultaneously.Kasuga etc. utilize induction type rd29A promotor to replace CaMV35S promotor arabidopsis thaliana transformation, improved the drought resistance of transgenic arabidopsis, reduced composing type crosses and expresses that the plant strain growth causing is stagnated or the generation (Narusaka etc. of dwarfism simultaneously, 2003, Plant J 34,137-148).Other inducible promoters are subject to the induction (Huda etc. of arid, cold, methyl jasmonate and dormin as paddy rice plasma membrane CaATPase promotor, 2013, PLoS One 8), Suaeda liaotungensis kitag beet BADH promotor is also salt inducible promoter (Li Qiuli etc., 2006, biotechnology journal 22,77-81); Arabidopis thaliana RBCS-1A promotor is photoinduction type promotor, have simultaneously tissue specificity (practise rain beautiful jade etc., 2012, Acta Agronomica Sinica 38,1561-1569); Swede type rape MAPK7 gene family and promotor thereof are subject to the induction (Zhu Bin etc., Acta Agronomica Sinica, 2013) of high temperature, damage and plant hormone.For inducible promoter, goal gene only just can be expressed after accepting inducement signal, not only can not cause the waste of various resources, can strengthen again plant materials resistance to external world, reduces the impact on growth and development of plants and other pathways metabolisms.Therefore, study and utilize inducible promoter, for the adversity gene engineering of studying the various physiological Mechanism of coercing of plant responding and research farm crop, have important meaning, aspect fundamental research and Plant Biotechnology, also having broad application prospects.Yet up to the present,, about the but still aobvious weak and hysteresis of research of tobacco wound inducement expressing gene promotor, this has also restricted its biological function explore and application exploratory development to a certain extent.
Summary of the invention
The object of this invention is to provide a kind of promotor and application thereof, i.e. a kind of tobacco the wound inducement type promotor that can express at plant camber of deriving from.
An object of the present invention is to provide a kind of wound inducement type promotor, its nucleotides sequence is classified SEQ ID NO:1 as.
Second object of the present invention is to provide a kind of wound inducement type promoter eucaryon expression vector for Plant Transformation, and the promotor of this carrier is the promotor that nucleotides sequence is classified SEQ ID NO:1 as; This expression vector can make the high efficient expression of external source goal gene.
The present invention further provides a kind of in plant the method for expression alien gene, be to use above-mentioned recombinant expression vector, external source goal gene is imported to this carrier, conversion of plant, the expression that the conversion of plant of acquisition can induction exogenous gene by physical abuse.
The isolation identification of the present invention to the efficient inducible promoter of tobacco, can provide for the research and development of biological tobacco reactor experiment and technical support.Utilize efficient inducible promoter, using tobacco as bio-reactor, express vaccine, antibody and other pharmaceutical proteins etc., can break through traditional agriculture category, extend to medical field.
Accompanying drawing explanation
Fig. 1: NtLOX3 promotor of the present invention connects T vector plasmid PCR and identifies electrophorogram;
Fig. 2: NtLOX3 promotor of the present invention connects pCAMBIA1301 plasmid PCR electrophorogram;
Fig. 3: NtLOX3 promotor of the present invention connects pCAMBIA1301 enzyme and cuts evaluation electrophorogram;
Fig. 4: plant expression vector construction schematic diagram of the present invention;
Fig. 5: pCAMBIA1301::NtLOX3-Promoter of the present invention transforms Agrobacterium PCR and identifies electrophorogram;
Embodiment
Below in conjunction with accompanying drawing, method of the present invention is described in detail, but object described below is exemplary, rather than limits the scope of the invention.
Embodiment 1: the separation of tobacco lipoxygenase gene NtLOX3 promotor
1.1, the preparation of tobacco gene group DNA
Get and plant the bimestrial tobacco in greenhouse, get its tender leaf, adopt CTAB method to extract genomic dna, after agarose gel electrophoresis detects, preserve with-20 ℃.
The clone of 1.2 NtLOX3 promotors and sequential analysis
The tobacco gene group DNA of take is template, upstream primer is: GGGGTACCGCCAGGTCTAAGGAAGG (SEQ ID NO:2), downstream primer is: GAAGATCTAATAATAATAGTTCTCTCTTCAATT (SEQ ID NO:3), by pcr amplification, obtain NtLOX3 promotor candidate regions, PCR reaction conditions is: 94 ℃ of denaturation 4min, 94 ℃ of sex change 4min, 49.3 ℃ of annealing 45s, 72 ℃ are extended 2min, totally 28 circulations, 4 ℃ of preservations.PCR product is connected to pEASY-T1 carrier, clones and carry out plasmid PCR detection (plasmid called after pEASY-T1::NtLOX3-Promoter) (Fig. 1), and order-checking obtains the NtLOX3 promotor that length is 1847bp, its sequence is SEQ ID NO:1.Then use PLACE software (
http:// www.dna.affrc.go.jp/PLACE/) cis-acting elements in promoter sequence is carried out to forecast analysis, find basic conservative elements T ATA-box and CAAT-box that this promotor contains promoter in eukaryote, also containing possible damage and MeJA response element GT-box (GTGTGCA), CATG-box (CATG) and W-box (TCACC/T) element etc.And by transgenosis, test to show to damage and can induce the high level of this promotor active.
Embodiment 2: the structure of plant injury inducible expression vector
After pCAMBIA1301 carrier is cut with Kpn I/Bgl II enzyme, reclaim large fragment stand-by.By the pEASY-T1::NtLOX3-Promoter plasmid in embodiment 1, after Kpn I/Bgl II enzyme is cut, reclaiming length is the promotor object fragment of 1847bp.In 10 μ l systems, object fragment is connected with T4 DNA ligase with carrier segments, by PCR, identify that (Fig. 2) and enzyme cut evaluation (Fig. 3) and be defined as positive recombinant.Thereby make the CaMV35S promotor on promotor replacement vector pCAMBIA1301 of the present invention, with Gus gene fusion, obtain expressing plant recombination expression vector pCAMBIA1301::NtLOX3-Promoter(Fig. 4 of Gus gene).
Embodiment 3: the activity of identifying tobacco wound inducement type promotor
3.1 agriculture bacillus mediated Plant Transformation
By electric shock conversion method, during the plant recombination expression vector pCAMBIA1301::NtLOX3-Promoter of the expression Gus gene building in embodiment 2 is transformed into Agrobacterium in EHA105, extract the plasmid performing PCR of going forward side by side and identify (Fig. 5), determine real being transferred in Agrobacterium of plasmid.
Get tobacco seed, utilize after the sterilization of alcohol and clorox and be seeded into and send out on seedling substratum, wait young plant to grow to 0.5cm left and right and forward to and transplant seedlings on substratum.When treating that blade grows to 5-8 sheet leaf, choose green blade, carrying out the above-mentioned Agrobacterium that has proceeded to pCAMBIA1301::NtLOX3-Promoter infects, concrete is exactly by the Agrobacterium of 28 ℃ of cultivations, OD600=0.8, the AS(Syringylethanone that adds 20mg/L), utilize leaf disc transformation method transformation of tobacco, and by selecting substratum to screen.
3.2 transfer-gen plant Gus expression activities are analyzed
Get transgene tobacco T1 and carry out Gus histochemical stain for blade.When transgenic tobacco plant grows to the blade of 6 left and right, get a slice leaf and injure processing, the vein of blade and blade edge are damaged, then carry out the detection of Gus histological chemistry.Gus staining fluid composition is: 0.1M phosphoric acid buffer, 50mM K
3fe (CN)
6, 50mM K
4fe (CN)
6, 0.5M Na
2eDTA, 1%Triton, 20mM X-Gluc.By the blade 37 ℃ of soaked overnight in Gus staining fluid after damage, then use 70% ethanol rinsing, again add 70% ethanol decolorization, under inverted microscope, observe dyeing situation, and Taking Pictures recording.
Result shows, the active strong very dark blueness that demonstrates of Gus, represents that without blue Gus activity is lower.At unmarred blade position, Gus low expression level detected or do not express, and at the damage location of blade, NtLOX3 promoters driven Gus there is obvious high level expression, damage field shows very dark blueness.The above results shows that promotor of the present invention has the activity of very strong wound inducement.The activity research of other indicator also promotor of formal the present invention's screening to wound inducement.
Claims (4)
1. a promotor, is characterized in that, the nucleotides sequence of described promotor is classified SEQ ID NO:1 as.
2. the application of promotor claimed in claim 1 in preparing carrier for expression of eukaryon.
3. a carrier for expression of eukaryon, the promotor of described carrier for expression of eukaryon is promotor claimed in claim 1.
4. a method for expression alien gene in plant, is that external source goal gene is imported to carrier for expression of eukaryon claimed in claim 3, conversion of plant, and by physical abuse mode, carry out the expression of induction exogenous gene; Wherein said plant is tobacco.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310146067.1A CN103205429B (en) | 2013-04-24 | 2013-04-24 | Promoter and applications thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310146067.1A CN103205429B (en) | 2013-04-24 | 2013-04-24 | Promoter and applications thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103205429A CN103205429A (en) | 2013-07-17 |
| CN103205429B true CN103205429B (en) | 2014-04-16 |
Family
ID=48752835
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310146067.1A Expired - Fee Related CN103205429B (en) | 2013-04-24 | 2013-04-24 | Promoter and applications thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103205429B (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111304203B (en) * | 2020-03-02 | 2022-07-19 | 山东农业大学 | Promoter Pro-BIUTNT for efficiently driving target gene to be stably expressed in apple protoplast cells |
| CN112280779B (en) * | 2020-10-28 | 2022-03-04 | 中国农业科学院烟草研究所 | Promoter pNtab3450 and expression vector and application thereof |
-
2013
- 2013-04-24 CN CN201310146067.1A patent/CN103205429B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN103205429A (en) | 2013-07-17 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Pd EPF 1 regulates water‐use efficiency and drought tolerance by modulating stomatal density in poplar | |
| Pei et al. | GhABP19, a novel germin-like protein from Gossypium hirsutum, plays an important role in the regulation of resistance to Verticillium and Fusarium wilt pathogens | |
| Fujino et al. | Molecular identification of a major quantitative trait locus, qLTG3–1, controlling low-temperature germinability in rice | |
| Feng et al. | Target of tae-miR408, a chemocyanin-like protein gene (TaCLP1), plays positive roles in wheat response to high-salinity, heavy cupric stress and stripe rust | |
| Banerjee et al. | An intergenic region shared by At4g35985 and At4g35987 in Arabidopsis thaliana is a tissue specific and stress inducible bidirectional promoter analyzed in transgenic Arabidopsis and tobacco plants | |
| US8546647B2 (en) | Pathogen inducible plant thehalose-6-phophate phophatase gene promoters and regulatory elements | |
| Liu et al. | Mulberry transcription factor MnDREB4A confers tolerance to multiple abiotic stresses in transgenic tobacco | |
| CN103740731B (en) | Alfalfa stress response gene M sNAC3 and application thereof | |
| CN102191254A (en) | CBF transcription factor capable of regulating plant stress resistance, and coded gene and application thereof | |
| KR100781059B1 (en) | An inducible promoter activated by environmental stresses and a method for the generation of transgenic plants producing a target protein specifically in plant guard cells using the promoter | |
| CN103205429B (en) | Promoter and applications thereof | |
| Xu et al. | Expressional and regulatory characterization of Arabidopsis RNA-dependent RNA polymerase 1 | |
| Gao et al. | A novel Sugarcane bacilliform virus promoter confers gene expression preferentially in the vascular bundle and storage parenchyma of the sugarcane culm | |
| US20130247252A1 (en) | Compositions, organisms, systems, and methods for expressing a gene product in plants | |
| Zhou et al. | Targeted transgene expression in rice using a callus strong promoter for selectable marker gene control | |
| Sa et al. | The promoter of an antifungal protein gene from Gastrodia elata confers tissue-specific and fungus-inducible expression patterns and responds to both salicylic acid and jasmonic acid | |
| Chang et al. | Cloning of the promoter of rice brown planthopper feeding‐inducible gene OsTPS31 and identification of related cis‐regulatory elements | |
| CN102242119A (en) | Rice root-specific promoter Os03g01700 and application thereof | |
| CN104450708B (en) | Retrotransposon promoter PCb-RARE induced by high salt and salicylic acid and application of retrotransposon promoter PCb-RARE | |
| CN114672487A (en) | Vascular bundle tissue specific promoter P from sugarcane bacilliform virusSCBV-GT127And applications | |
| US9631199B2 (en) | Stem-specific promoter from sugarcane dirigent gene | |
| Hsieh et al. | Transformation of nad7 into the nuclear genome rescues the slow growth3 mutant in Arabidopsis | |
| Dong et al. | Cloning and characterization of a multifunctional promoter from Maize (Zea mays L.) | |
| Lai et al. | RPW8 promoter is involved in pathogen‐And stress‐inducible expression from Vitis pseudoreticulata | |
| CN104195138A (en) | Low-temperature inducible promoter and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140416 Termination date: 20150424 |
|
| EXPY | Termination of patent right or utility model |