CN103194461B - Green muscardine fungus destroys element synthesis related gene and application thereof - Google Patents

Abstract

The present invention relates to green muscardine fungus and destroy element synthesis related gene and application thereof.Specifically, the invention discloses the destruction element synthetic gene bunch (gene cluster) of green muscardine fungus, described gene cluster includes the related genes such as dtxS1 (Nonribosomal Peptide Synthetases), dtxS2 (cytochrome P 450 monooxygenases), dtxS3 (aldehyde ketone reductase) and dtxS4 (glutamate decarboxylase).Present invention also offers the described application destroying element synthesis related gene.

Description

Green muscardine fungus destroys element synthesis related gene and application thereof

Technical field

The invention belongs to biological technical field, in particular it relates to green muscardine fungus destroys element synthesis related gene and application thereof.

Background technology

The interaction of pathogenic fungi and insecticide is the key areas of insecticide disease prevention and treatment.Insect pathogenic fungus can produce Life is substantial amounts of has different bioactive secondary metabolite, including the destruction element of 29 kinds of six ring-type lipopeptid classes (destruxins, dtxs).Destroy element and include a hydroxy isocaproic acid (HIC) and five amino acid residue (Fig. 1).Known broken Bad element can be divided into six big classes, i.e. dtx A-F and derivant thereof.There is presently no a fungal species or bacterial strain can produce institute Some destruction element kinds.Metarhizium is main destruction element producing strains, and Metarhizium has ten several kinds, including host's wide spectrum The locust green muscardine fungus that Robert green muscardine fungus and locust specially change.Wherein, Robert green muscardine fungus can produce most destruction element composition. Additionally, muscardine Beauveria felina, long spore Verticillium Lecanicillium longisporum and seat shell spore class fungus Also some element, plant pathogenic fungi alternaria brassica Alternaria brassicae and Ophiosphaerella can be destroyed Herpotricha report can produce destruction element B (i.e. dtxB) and derivant thereof.Studies have reported that green muscardine fungus produces the energy destroying element Power is relevant with its host speciality.

Destroy element and can cause the cytotoxicity of insecticide, cause insecticide Muscle paralysis and spasm, the cytotoxicity master of initiation Want principle to be, destroy element and act on calcium channel and the ATP enzyme of vacuole type.In addition to there is insecticidal activity, destroy element also There is medical function, for cancer, osteoporosis, senile dementia and hepatitis B therapeutic activity the most in various degree.

Identify although the destruction element with insecticidal activity has obtained in 1961, but be responsible for the gene of dtx synthesis the most not Clear.Full artificial chemistry synthesis destroys element and has reported, but complicated owing to destroying the structure of element, the efficiency of synthetic Extremely low, and productivity is the lowest.

In sum, element synthesis related gene is destroyed in the urgent need to research green muscardine fungus in this area, in order to improves and destroys element Production method.

Summary of the invention

It is an object of the invention to provide green muscardine fungus and destroy plain biosynthetic related gene.

It is a further object of the present invention to provide the function and application of described gene.

In a first aspect of the present invention, it is provided that a kind of method that host cell is transformed, including step:

A () measures expression and/or the activity belonging to each related gene destroying element synthetic gene bunch in described host cell；

B (), according to measurement result, imports the related gene destroying element synthetic gene bunch in described host cell, thus carries It is high/to recover the ability that described host cell generation destruction is plain,

Wherein, the related gene of described gene cluster includes one or more following genes: dtxS1 gene, dtxS2 base Cause, dtxS3 gene and dtxS4 gene.

In another preference, described host cell is green muscardine fungus.

In another preference, described host cell includes Robert green muscardine fungus, locust green muscardine fungus, it is preferred that described Robert green muscardine fungus is that the Robert of described some or multiple gene inactivation or the activity decrease destroying element synthetic gene bunch is green Stiff bacterium.

In another preference, when dtxS4 gene inactivation or the activity decrease of described gene cluster, further comprise the steps of:

Beta-alanine is added, to promote to destroy the formation of element in cultivating system.

In a second aspect of the present invention, it is provided that a kind of method of ability improving Robert green muscardine fungus generation destruction element, Including step:

In described Robert green muscardine fungus, import the related gene destroying element synthetic gene bunch, thus improve described sieve primary Special green muscardine fungus produces the ability destroying element, and wherein, the related gene of described gene cluster includes one or more following genes: DtxS1 gene, dtxS2 gene, dtxS3 gene and dtxS4 gene.

In a third aspect of the present invention, it is provided that one prepares destruction element method, including step:

I (), in the condition of applicable cultivation and in the case of adding Beta-alanine, cultivates the host producing destruction plain thin Born of the same parents, thus produce destruction element；With

(ii) isolated or purified goes out described destruction element.

In another preference, described host cell is Robert green muscardine fungus.

In another preference, described Robert green muscardine fungus is wild type Robert green muscardine fungus or dtxS4 gene inactivation Or the Robert green muscardine fungus of activity decrease.

In another preference, described host cell is introduced into external source and destroys the green deadlock of Robert of element synthesis related gene Bacterium, wherein said gene is selected from lower group: dtxS1 gene, dtxS2 gene, dtxS3 gene and dtxS4 gene.

In a fourth aspect of the present invention, it is provided that a kind of sieve lacked selected from the related gene destroying element synthetic gene bunch Bert green muscardine fungus, wherein said gene includes one or more following genes: dtxS1 gene, dtxS2 gene, dtxS3 base Cause and dtxS4 gene.

In another preference, described Robert green muscardine fungus has lacked described destruction element the 1 of synthetic gene bunch, 2,3 or 4 Individual gene.

In another preference, described Robert green muscardine fungus only lacks dtxS2 gene, but do not lack dtxS1 gene, DtxS3 gene and dtxS4 gene.

In a fifth aspect of the present invention, it is provided that a kind of B class that produces destroys plain method, under conditions of applicable cultivation, Cultivating Robert green muscardine fungus, thus produce B class and destroy element, wherein said Robert green muscardine fungus only lacks dtxS2 gene, but not Disappearance dtxS1 gene, dtxS3 gene and dtxS4 gene.

In another preference, described Robert green muscardine fungus is by wild type Robert green muscardine fungus is carried out dtxS2 Gene knockout and the engineering bacteria that produces.

In another preference, described B class is destroyed element and is included: dtxB, dtxB₂, demethyl B.

In a sixth aspect of the present invention, it is provided that a kind of green muscardine fungus, described green muscardine fungus contains importing, external source being selected from Destroying the related gene of element synthetic gene bunch, the related gene of wherein said gene cluster includes one or more following genes: DtxS1 gene, dtxS2 gene, dtxS3 gene and dtxS4 gene.

In another preference, described green muscardine fungus is Robert green muscardine fungus.

In another preference, described green muscardine fungus is the wild type Robert green muscardine fungus that can produce and destroy element.

In another preference, described Robert green muscardine fungus contains the 1 of importing, 2,3 or 4 and closes selected from the described element that destroys Become the gene of gene cluster.

In a seventh aspect of the present invention, it is provided that a kind of generation destroys plain method, under conditions of applicable cultivation, cultivate Green muscardine fungus described in a sixth aspect of the present invention thus produce destruction element.

In should be understood that within the scope of the present invention, above-mentioned each technical characteristic of the present invention and having in below (eg embodiment) Can be combined with each other between each technical characteristic that body describes, thus constitute new or preferred technical scheme.As space is limited, exist This tires out the most one by one states.

Accompanying drawing explanation

Drawings below is used for illustrating specific embodiments of the present invention, rather than limits and to be defined by the claims The scope of the invention.

Fig. 1 shows the structure destroying element.

Fig. 2 shows the Nonribosomal Peptide Synthetases (nonrobiosomal of Robert green muscardine fungus and locust green muscardine fungus Peptide synthetase, NRPS) albumen cluster analysis result, Fig. 2 A is green for using adenosine domain sequence to analyze Robert Stiff bacterium (genetic marker is MAA) and locust green muscardine fungus (genetic marker is MAC) result, with gene corresponding to the domain of black matrix mark Only exist in a kind of green muscardine fungus, i.e. exist a kind of green muscardine fungus and then do not exist in another kind of green muscardine fungus；Fig. 2 B is cluster analysis The polyadenylation A domain of DtxS1；Fig. 2 C is the condensation C-structure territory of cluster analysis DtxS1.

Fig. 3 shows Robert's green muscardine fungus wild type and various saltant fermented ingredient analysis result, wherein, using as Target gene carries out gene knockout, after wild strain ARSEF 23 cultivates one week in Sa Shi cultivates, can produce dtx A, dtx B And dtx E etc. 8 kinds destroys element (Fig. 3 A and Fig. 3 A ')；DtxS1 is Nonribosomal Peptide Synthetases (NRPS), deletion mutant Strain loses synthesis difference and destroys the ability (Fig. 3 B and Fig. 3 B ') of element；DtxS2 is cytochrome P 450 monooxygenases, and gene lacks Only produce (Fig. 3 C and Fig. 3 C ') such as dtxB after mistake；DtxS3 is aldehyde ketone reductase, and after gene knockout, green muscardine fungus can not synthesize any Destroy element, but when adding hydroxy isocaproic acid (hydroxyisocaproic acid, a HIC) in its culture medium, sudden change Bacterial strain recovers to produce destruction element (Fig. 3 D and Fig. 3 D ')；MAA_10046 is glutamate decarboxylase, i.e. dtxS4, is responsible for glutamic acid De-base obtains Beta-alanine, and for destroying last improper aminoacid of synthesis, after dtxS4 gene knockout, green muscardine fungus does not synthesizes Any element that destroys, but when adding Beta-alanine in its culture medium, mutant strain recovers to produce destroys element (Fig. 3 E and figure 3E’).Note: E-diol is: dtxE glycol；DtxE is for destroying element E；DtxC is for destroying element C；DtxD is for destroying element D；DtxA is broken Bad element A；DtxB2 is for destroying element B2；Desmethyl-DtxB is that demethyl destroys element B；DtxB is for destroying element B；HIC is that hydroxyl is different Caproic acid；β-Ala is Beta-alanine.

Fig. 4 shows that knocking out Robert's green muscardine fungus dtxS1 upstream gene MMA_10034-MAA_10042 fermented ingredient analysis ties Really, show that these genes are not involved in destroying biosynthesis or the modification of element.

Fig. 5 show Robert green muscardine fungus destroy element synthetic gene bunch (Fig. 5 A) and DTXS1 Nonribosomal Peptide Synthetases, DTXS2 cytochrome P 450 monooxygenases, DTXS3 aldehyde ketone reductase and DTXS4 glutamate decarboxylase participate in synthesis and destroy element Biological approach (Fig. 5 B).Note: abbreviation letter A represents polyadenylation domain in NRPS；T represents Thiolation domain；C represents condensation Change domain；E represents isomerization structure territory；NM represents that N-methylates domain；NRPS is Nonribosomal Peptide Synthetases (nonrobiosomal peptide synthetase)；Aldo-keto reductase is aldehyde ketone reductase；Aspartate- Decarboxylase is aspartate decarboxylase；α-hydroxyisocaproic acid is hydroxy isocaproic acid (HIC)；α- Ketoisocaprioc acid is the different acetic acid of α-one；Amino acid is aminoacid；Keto acid is keto acid； Transaminase is transaminase；Leucine is leucine；β-Alanine is Beta-alanine.

Fig. 6 shows insecticide bioassay results, and wherein, Robert's green muscardine fungus wild strain (WT) and mutant are trained at Cha Shi Supporting after cultivating 7 days in base, culture fluid is used for injecting silkworm 5 instar larvae (the 50 every cephalont of microlitre) after filtering, and Fig. 6 A shows, wild mushroom Strain fermentation liquid injection insecticide shows spasm symptom immediately, dead after a few minutes, and use Δ dtxS1 (Fig. 6 B, 1 × 10⁶Spore Son/ml, every 10 μ l) and Δ dtxS2 (Fig. 6 C, 1 × 10⁶Spore/ml, every 10 μ l) fermentation liquid injection silkworm be not poisoned Symptom；Fig. 6 D is comparison；Fig. 6 E and Fig. 6 F is the Antifeedant Effects result destroying element, Robert's green muscardine fungus wild strain (WT) and not After homogenic mutant cultivates 7 days in Czapek's medium, culture fluid coating Folium Mori surface, dtxS1 or dtxS2 gene delection is dashed forward The fermentation liquid coating Folium Mori of mutant can be taken food by silkworm (Fig. 6 E) in a large number, and wild strain fermentation liquid coating Folium Mori are not by silkworm Take food (Fig. 6 F).

Fig. 7 shows with Robert's green muscardine fungus wild strain (WT) and mutant injection locust and silkworm, the dead song of insecticide Line, after Fig. 7 A is for using WT, Δ dtxS1 and Δ dtxS2 and comparison (sterilized water) injection locust, the death curve of locust；Figure After 7B is for using WT, Δ dtxS1 and Δ dtxS2 and comparison (sterilized water) injection silkworm, the death curve of silkworm.

Fig. 8 shows exempting from of the growth in insect bodies of Real Time Observation wild strain and gene deletion mutants and host insect Epidemic disease reaction result, wherein, Fig. 8 A shows, after injecting 16 hours, wild strain spore (arrow indication) is sprouted and quickly escapes blood The encapsulation of cell；Fig. 8 B shows, Δ dtxS1 bacterial strain is by serious melanism, and mostly sprouting spore (arrow indication) can be by blood The lasting attack of cell, Fig. 8 B ' display Δ dtxS2 strains expressed goes out similar feature；Fig. 8 C shows, after injecting 36 hours, with Mutant is compared, wild strain can in insecticide haemocoele amount reproduction, generate hyphal body (HB) in the yeast mode of sprouting；Fig. 8 D Display, after injecting 48 hours, blood counting chamber statistics hyphal body and the quantity result of hemocyte；Fig. 8 E shows, with untreated Insecticide compares (4.2 × 10⁷Hemocyte/μ l), wild strain and Δ dtxS1 process the hemocyte mathematics of insecticide and have dropped 4 times, and Δ dtxS2 processes the hemocyte of insecticide and have dropped 3 times；Fig. 8 F shows, collects hemolymph now, and 80% wild strain infects elder brother The hemolymph of worm can not blackening, such as the fresh blood lymph just collected；But about 75% Δ dtxS1 and about 70% Δ dtxS2 processes elder brother The hemolymph of worm all can be by melanism.Note: HE is insect blood cell, and HB is hyphal body.

The synthesis of Fig. 9 tamper indicating element and the evolutionary relationship of green muscardine fungus, Fig. 9 A shows, the different green deadlock of efficient liquid phase chromatographic analysis Bacterium strain and bacterial strain produce the situation result destroying element, shown in bacterial strain and strain institute icon；Fig. 9 B display PCR method detection difference There is result in dtxS 1 gene in green muscardine fungus strain and bacterial strain.Note: M.robertsii is Robert green muscardine fungus；M.acridum For locust green muscardine fungus；M.anisopliae is Metarhizium anisopliae；M.guizhouense is Guizhou green muscardine fungus；M.pingshaense For flat sand green muscardine fungus；M.majus is big spore green muscardine fungus；M.brunneum is brown green muscardine fungus；M.album is white green muscardine fungus； M.frigidum is low temperature green muscardine fungus.

Detailed description of the invention

The present inventor, through extensively in-depth study, makes public for the first time one and destroys element synthetic gene bunch (gene Cluster), described gene cluster include dtxS1 (Nonribosomal Peptide Synthetases), dtxS2 (cytochrome P 450 monooxygenases), The related genes such as dtxS3 (aldehyde ketone reductase) and dtxS4 (glutamate decarboxylase).The invention also discloses and host cell is carried out The method of transformation, raising Robert green muscardine fungus generation are destroyed the method for element ability and produce the application such as the plain method of B class destruction. Complete the present invention on this basis.

Destroy element synthesis related gene and albumen

As used herein, the invention discloses a kind of destruction element synthetic gene bunch (gene cluster), described gene cluster Including: dtxS1 gene, dtxS2 gene, dtxS3 gene, and dtxS4 gene.

Wherein, dtxS1 gene code Nonribosomal Peptide Synthetases, and dtxS1 gene at least has selected from lower group Individual or multiple features:

(i) coding aminoacid sequence as shown in SEQ ID NO:5；(ii) coding amino as shown in SEQ ID NO:5 The polypeptide derivative by (i) that acid sequence replaces through one or several amino acid residue, lack or adds and formed；(iii) tool Just like the polynucleotide sequence shown in SEQ ID NO:6；(iv) have and many nucleoside of complementary shown in SEQ ID NO:6 Acid.

DtxS2 gene code cytochrome P 450 monooxygenases, and dtxS2 gene at least has selected from one of lower group or Multiple features: (i) coding aminoacid sequence as shown in SEQ ID NO:7；(ii) coding amino as shown in SEQ IDNO:7 The polypeptide derivative by (i) that acid sequence replaces through one or several amino acid residue, lack or adds and formed；(iii) tool Just like the polynucleotide sequence shown in SEQ ID NO:8；(iv) have and many nucleoside of complementary shown in SEQ ID NO:8 Acid.

DtxS3 gene code aldehyde ketone reductase, and dtxS3 gene at least has one or more features selected from lower group: (i) coding aminoacid sequence as shown in SEQ ID NO:9；(ii) coding aminoacid sequence warp as shown in SEQ ID NO:9 Cross the polypeptide derivative by (i) that one or several amino acid residue replaces, lacks or adds and formed；(iii) have such as SEQ Polynucleotide sequence shown in ID NO:10；(iv) have and the polynucleotide of complementary shown in SEQ IDNO:10.

DtxS4 gene code glutamate decarboxylase；And dtxS4 gene at least has the one or more spies selected from lower group Levy: (i) coding aminoacid sequence as shown in SEQ ID NO:11；(ii) coding aminoacid sequence as shown in SEQ ID NO:11 The polypeptide derivative by (i) that row replace through one or several amino acid residue, lack or add and formed；(iii) have as Polynucleotide sequence shown in SEQ ID NO:12；(iv) have and the polynucleotide of complementary shown in SEQID NO:12.

In the case of the amino acid fragment having obtained destruction element synthesis related gene, can construct according to it and encode its Nucleotide sequence, and design specific probe according to nucleotide sequence.Nucleotide full length sequence or its fragment generally can be used The method of PCR TRAP, recombination method or synthetic obtains.For PCR TRAP, can be according to nucleotide disclosed in this invention Sequence, especially open reading frame sequence design primer, and with commercially available cloud tints storehouse or by well known by persons skilled in the art often Cloud tints storehouse prepared by rule method, as template, expands and obtains relevant sequence.When sequence is longer, it is often necessary to carry out twice or many Secondary PCR expands, and the fragment that the most each time amplifies is stitched together by proper order.

As used herein, term " primer " refers to matching with template, can be with it for rising under the effect of archaeal dna polymerase Point carries out the general name of the oligonucleotide acid of the synthesis DNA complementary with template.Primer can be natural RNA, DNA, it is also possible to It it is any type of natural nucleotide.Primer can even is that non-natural nucleotide such as LNA or ZNA etc..Primer " generally " (or " substantially ") and a special complementary on a chain in template.Primer must be abundant with a chain in template Complementation could start to extend, but the sequence of primer need not be with the sequence complete complementary of template.Such as, mutual with template at one 3 ' end 5 ' ends of the primer mended add the sequence that the preceding paragraph is the most complementary with template, and such primer is generally the most complementary with template.As long as having Sufficiently long primer sufficiently can be combined with template, and non-fully complementary primer can also form primer-template with template and be combined Thing, thus expand.

Once obtain relevant sequence, it is possible to obtain relevant sequence in large quantity with recombination method.This is typically will It is cloned into carrier, then proceeds to cell, then by conventional method relevant sequence of isolated from the host cell after propagation. Additionally, can also be used with the method for synthetic to synthesize relevant sequence, when especially fragment length is shorter.Generally, by first synthesizing Multiple small fragments, are attached obtaining the fragment that sequence is the longest the most again.

At present, it is already possible to obtain nucleotide sequence (or its fragment, derivant) by chemosynthesis completely.Then This DNA sequence can be introduced in various existing DNA moleculars (such as carrier) as known in the art and cell.By conventional weight Group DNA technique, the polynucleotide sequence of the available present invention can be used to express or produce recombiant protein.In general there is following step Rapid:

(1). use polynucleotide (or variant), or convert with the recombinant expression carrier containing these polynucleotide or transduction conjunction Suitable host cell；(2). the host cell cultivated in suitable culture medium；(3). separation, purification from culture medium or cell Protein.

In the present invention, polynucleotide sequence can be plugged in recombinant expression carrier.In a word, as long as can replicate in host With stable, any plasmid and carrier can be used.One key character of expression vector is to usually contain origin of replication, startup Son, marker gene and translation control element.

Those skilled in the art can use known to method construction of expression vector.These methods include extracorporeal recombinant DNA Technology, DNA synthetic technology, In vivo recombination technology etc..The suitable startup that described DNA sequence can be effectively connected in expression vector On son, to instruct mRNA to synthesize.Expression vector also includes ribosome binding site and the transcription terminator of translation initiation.

Additionally, expression vector preferably comprises one or more selected marker, to provide for selecting conversion The phenotypic character of host cell, dihydrofolate reductase, neomycin resistance and the green fluorescence egg cultivated such as eukaryotic cell In vain (GFP), or for colibacillary tetracycline or amicillin resistance.

Comprise above-mentioned suitable DNA sequence and suitable promoter or control the carrier of sequence, may be used for converting and fit When host cell, allow it to marking protein.Host cell can be prokaryotic cell, such as bacterial cell；Or low etc. Eukaryotic cell, such as yeast cells；Or higher eucaryotic cells, such as mammalian cell.Representative example has: escherichia coli, chain The bacterial cell of mould Pseudomonas；Fungal cell's such as yeast；Plant cell；Insect cell；Zooblast etc..

Can carry out with routine techniques well known to those skilled in the art with recombinant DNA transformed host cell.When host is former When core biology is such as escherichia coli, the competent cell that can absorb DNA can be gathered in the crops at exponential growth after date, uses CaCl₂Method processes, institute Step generally well-known in the art.Another kind of method is to use MgCl₂.Also can be with the side of electroporation if it is required, convert Method is carried out.When host is eukaryote, can be selected for following DNA transfection method: calcium phosphate precipitation, conventional mechanical methods is such as Microinjection, electroporation, liposome packaging etc..

The transformant obtained can be cultivated by conventional method, expresses the polypeptide of the coded by said gene of the present invention.According to used Host cell, culture medium used in cultivation is selected from various conventional medium.Under conditions of being suitable to host cell growth Cultivate.When after host cell growth to suitable cell density, with suitable method (such as temperature transition or chemical induction) The promoter that induction selects, is further cultured for a period of time by cell.

Below in conjunction with specific embodiment, the present invention is expanded on further.Should be understood that these embodiments are merely to illustrate the present invention Rather than restriction the scope of the present invention.The experimental technique of unreceipted actual conditions in the following example, generally according to conventional strip Part, such as Sambrook et al., molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to the condition proposed by manufacturer.Unless otherwise indicated, no Then percentage ratio and number are percentage by weight and parts by weight.

Materials and methods

Fungal bacterial strain and condition of culture

The Robert green muscardine fungus ARSEF 23 of wild type is broad spectrum activity insect pathogenic fungus, and locust green muscardine fungus CQMa102 is locust Worm specially changes fungus, above fungus on Rhizoma Solani tuber osi is cultivated in 25 DEG C, dark culturing saves backup in 4 DEG C after fully product spore.

Nonribosomal Peptide Synthetases gene analysis and gene knockout

Robert green muscardine fungus ARSEF 23 and locust green muscardine fungus CQMa 102 is checked order, it is thus achieved that the genome number of order-checking According to, these data are compared genome analysis, finds the Nonribosomal Peptide Synthetases gene of non-homology.To this end, two kinds After the polyadenylation domain of all NRPS albumen in green muscardine fungus is extracted, compare and evolutionary analysis.

In order to analyze the function of gene, use homology replacement restructuring to carry out serial genes and knock out.Specifically, by different target After the flanking sequence of gene uses different primers amplification, it is linked in the binary vector of routine carry out Agrobacterium-mediated Transformation, this carrier In include cremart resistance marker.

Destroy element induction

In order to verify the function destroying element synthesis related gene dtxS2, dtxS3 and dtxS4, substrate dtxB, α-HIC and β- Ala is added in the culture fluid in corresponding mutant so that it is final concentration of 10mM.25 DEG C, cultivate 7 under 200rpm after, with vinegar Acetoacetic ester extracts and destroys element, after crude extract is dissolved in the methanol of 1ml, uses the film of 0.22 micron pore size to filter, then with efficiently Liquid chromatograph and LC-MS analysis.Whole experiment is repeated twice, each process three repetition.Produce to detect infection polypide Destroy the situation of element, carry out after green muscardine fungus metainfective silkworm larva Bombyx Batryticatus lyophilization destroying element extraction.

Chromatograph, mass spectrum and nmr analysis

The chromatography destroying element crude extract uses the LC-20AD HPLC system of Shimadzu Corporation, comprises anti-phase C18 post (pore size: 5 microns；Long: 4.6 × 250 millimeters) and the ultraviolet/visible light detector of a SPD-20A.Flowing uses line mutually Property gradient: the ratio 90: 102min of deionized water and methanol, 55: 452min, 39: 6122min, 5: 955min and 90: 108min, the flow velocity of 0.1 milliliter per minute, detects under 215 nano wave lengths.Use dtx A standard substance (Sigma), pure The dtx B changed and dtx E generates standard curve, and quantitative analysis different strains produces variety classes and destroys the content of element.Fungus sense Producing destruction element in dye Bombyx Batryticatus uses chromatography of ions to be analyzed.The molecular weight of different components uses Agilent G6520A to carry out LC-MS is analyzed.In order to verify the product of dtxS2 mutant, use Bruker ARX 600spectrometer (600/ 150MHz) carry out nmr analysis with Bruker AM-400 (400/100MHz) instrument.

Insecticide bioassay

Five age silkworm larva and locust adult be respectively used to and carry out bioassay.Every larva of silkworm, from the second abdomen Foot base portion injects the 5 × 10 of 10 microlitres⁵The wild type of spore/microlitre and mutant spore suspension；Locust is injected from interventral film 10 microlitres 5 × 10⁶The wild type of spore/microlitre and mutant spore suspension.Each process 3 repetition, often 10 elder brothers of repetition Worm, whole experiment is repeated twice.Every one insect death data of 12 hour record.Extra silkworm larva be injected after for Observe fungus developmental state in insect bodies.Lethal time of 50 LT₅₀SPSS 17 software is used to carry out statistical analysis.

PCR detection dtxS1 gene and phylogenetic analysis in different green muscardine funguss

In order to detect the dtxS1 gene presence or absence of different green muscardine fungus genome thing, use primer dtxF and dtxR to base Because group DNA carries out PCR amplification.Gap sequence is transcribed expand the rRNA gene of different green muscardine funguss with primer itsF with itsR in (ITS), with the ITS sequence of Fusarium oxysporum (Fusarium graminearum) for comparison, compare respectively and use MAGA 5.0 carries out evolution clustering analysis, thus it is speculated that the evolutionary relationship of different green muscardine funguss.Primer information is as follows:

DtxF (SEQ ID NO:1), sequence is: AGATTTGCCGCAGCTACCTA；

DtxR (SEQ ID NO:2), sequence is: CACCAGATGCGAGTTCTCAA；

ItsF (SEQ ID NO:3), its sequence is: TTACGTCCCTGCCCTTTGTA；

ItsR (SEQ ID NO:4), its sequence is: ACCTCACCAAAAGCATCCTC.

Embodiment 1 destroys the prediction of element synthetic gene

1. Robert's Metarhizium Strains ARSE 23 can produce in Cha Shi cultivates and destroy element, and locust Metarhizium Strains CQMa 102 can not produce.The present embodiment compares genome analysis to two kinds of funguses.

Result shows, Robert green muscardine fungus exists good co-linear relationship with the genome structure of locust green muscardine fungus, shows It is owing to not containing destruction element synthetic gene in its genome that locust green muscardine fungus does not produce destruction element.

2. 15 Robert green muscardine fungus and locust green muscardine fungus genome encoding are separately encoded and 13 NRPS albumen are carried out Cluster analysis, the results are shown in Table 1 and Fig. 2.

Table 1

Result (table 1 and Fig. 2) shows, MAA_10043 and MAA_06559 of Robert green muscardine fungus does not has in locust green muscardine fungus Homologous genes.Further module shows, MAA_06559 only comprises polyadenylation (A), Thiolation (T) and condensationization (C) Individual module, and MAA_10043 includes 6 ATC modules, meets the destruction element structure of synthesis 6 lipopeptids.

The present inventor is by named for MAA_10043 albumen DtxS1, and this albumen contains 7898 aminoacid, and its gene comprises Two introns, similar with the NRPS of other funguses, the gene cluster that dtxS1 gene is positioned at includes Cytochrome P450, aldehyde The gene such as ketoreductase and decarboxylase.

Embodiment 2 gene knockout and destruction element route of synthesis resolve

The present embodiment, in order to verify dtxS1 and build up the function of gene, is carried out serial genes based on homologous recombination and is knocked out. Owing to some analogs destroying element have identical molecular weight, therefore the present inventor uses LC-MS, nuclear-magnetism NMR and height The method that effect liquid phase chromatogram HPLC combines produces the situation of destruction element to detect wild type and different genes deletion mutation strain.

Table 2 shows that wild type and various saltant produce the situation destroying element E, A and B2.

Table 2

The testing result of nuclear-magnetism NMR is shown in Table 3.

Table 3

Result shows (Fig. 3), after wild strain ARSEF 23 cultivates one week in sabouraud medium, can produce dtx A, Dtx B and dtx E etc. 8 kinds destroys element (Fig. 3 A), and gene deletion mutants loses synthesis difference and destroys the ability (table 2 of element With Fig. 3 B).

Knock out dtxS1 upstream gene and do not affect the synthesis destroying element, these genes are described and destroy the uncorrelated (figure of element synthesis 4)。

Knock out dtxS1 downstream gene and have impact on the synthesis (Fig. 3 C-Fig. 3 E) destroying element.DtxS1 downstream gene MAA_10044 (Fig. 5 A), this gene is Cytochrome P450 oxidase, named dtxS2, modifies further after being responsible for dtxS1 synthesis dtx B Produce other kinds of destruction element, after gene knockout, only produce dtx B, B₂With demethyl B (Fig. 3 C).

Use gene knockout, it is thus achieved that double deletion mutation strains of dtxS1 and dtxS2, at Δ dtxS1 (dtxS2 has function) and When adding dtx B product in Δ dtxS1 Δ dtxS2 mutant culture fluid, dtx B can be converted into dtxE, C, D and A by Δ dtxS1 Deng, and the Δ dtxS1 dual-gene gene-deleted strain of Δ dtxS2 can not carry out the conversion (Fig. 3 B ' and Fig. 3 C ') of dtx B, meanwhile, both Mutant can not produce dtx B₂, but demethyl B can be produced.Result shows, dtxS1 Nonribosomal Peptide Synthetases is responsible for dtx B and B₂Synthesis, and Cytochrome P450 DtxS2 is responsible for dtx B, B₂It is converted into other derivants (Fig. 5 B).

It is the named dtxS3 of aldehyde ketone reductase by MAA_10045.By named for MAA_10046 dtxS4, take off for glutamic acid Carboxylic acid.α-ketoisocaproic acid is converted into α-hydroxyisocaproic acid (HIC) by DtxS3, and HIC is broken First substrate (Fig. 5 B) of bad element synthesis, after gene knockout, green muscardine fungus can not synthesize any element that destroys, but when in its culture medium During middle interpolation HIC, mutant strain recovers to produce destroys element (Fig. 3 D and Fig. 3 D ').DtxS4 is responsible for that glutamic acid is taken off base and obtains β-the third Propylhomoserin, for destroying last improper aminoacid (Fig. 5 B) of synthesis, after gene knockout, green muscardine fungus does not synthesize any destruction element, But when adding Beta-alanine in its culture medium, mutant strain recovers to produce destroys element (Fig. 3 E and Fig. 3 E ').Destroy element dtx E is unstable, and naturalness can be degraded to dtx E glycol.

Dtx B and B it is able to detect that in the culture fluid of dtxS2 mutant₂The A3 domain energy of DtxS1 protease is described Enough switch types select isoleucine (Ile, height tendency) to synthesize dtx B, or select figured silk fabrics ammonia enzyme (Val) to synthesize dtx B₂。 Evolutionary analysis shows, the clustering relationships of 6 polyadenylation domains of DtxS1 selects the structure height of substrate relevant to it, such as choosing It is a class (Figure 1B) that the A4 domain of the A3 domain and selection Val of selecting Ile/Val gathers.Nonribosomal Peptide Synthetases NRPS's The formation of condensation domain C catalysis peptide bond.The C-structure territory of DtxS1 and the clustering relationships of A domain inconsistent (Fig. 1 C).

Embodiment 3 destroys the element impact on fungus virulence

1. use the fermentation liquid injection silkworm children of the wild type (WT) of ARSEF 23, Δ dtxS1 and Δ dtxS2 mutant Worm.

Result shows: Robert's green muscardine fungus wild-type strain is cultivated 7 days in sabouraud medium, uses fermentation liquid injection (10 μ l) silkworm 5 instar larvae, it is possible to quickly kill insecticide, causes silkworm refusing to eat (Fig. 6 A) after coating Folium Mori；And dtxS2, DtxS3 and dtxS4 gene deletion strains fermentation liquid can not kill insecticide (Fig. 6 B-D), and fermentation liquid coating Folium Mori also will not cause elder brother The refusing to eat phenomenon (Fig. 6 E) of worm, it was demonstrated that destroy plain parasite killing and the refusing to eat effect for insecticide.

2., in order to verify the impact destroying element to Robert's green muscardine fungus insecticidal toxicity, the present inventor uses locust adult respectively (Fig. 7 A) and silkworm 5 instar larvae (Fig. 7 B) have carried out injection bioassay.

Wild type, Δ dtxS1 and Δ dtxS2 mutant is used to process the lethal time of 50 (LT of locust₅₀) respectively 105.4 ± 1.4,106.5 ± 1.7 and 112.4 ± 3.2 hours, significance test of difference showed, the difference between WT and Δ dtxS1 is the most notable (χ²=0.26, P=0.61), and WT and Δ dtxS2 (χ²=5.91, P=0.015), and Δ dtxS1 and Δ dtxS2 (χ²= 5.91, P=0.043) significant difference between.

Wild type, Δ dtxS1 and Δ dtxS2 mutant is used to process silkworm larva, LT₅₀It is respectively 79.3 ± 0.5,81.0 ± 0.6 and 88.0 ± 1.7 hour, but WT and Δ dtxS1 (χ²=4.92, P=0.027), WT and Δ dtxS2 (χ²=17.12, And Δ dtxS1 and Δ dtxS2 (χ P=0)²=15.13, P=0) difference the most notable.

Result shows, destroys element relevant to caste on the impact of fungus virulence.

3. destroy the plain immune defence result (Fig. 8) resisting host insect to show:

After injection silkworm, muscardine spore can quickly be wrapped up by insect blood cell, and wild type spore can be sprouted and soon Speed ground (16-20 hour) escapes the package action (Fig. 8 A) of hemocyte, but can not be very after Δ dtxS1 and Δ dtxS2 spore germination Fast escape hemocyte encapsulation (Fig. 8 B and Fig. 8 B ').Wild-type cell reproduction speed in insecticide haemocoele compares mutant Much faster (Fig. 8 C and Fig. 8 D).After injection treatment 48 hours, the wild-type cell in insecticide haemocoele is Δ dtxS1 and Δ respectively 4 times of dtxS2 and 8 times.Meanwhile, the hemocyte quantity of different disposal insecticide also differs (Fig. 8 E).It addition, be different from Δ The insect blood that dtxS1 and Δ dtxS2 processes, wild-type strain processes the blood loss of insecticide melanism function (Fig. 8 F).

In a word, destroy element (predominantly dtx A and E) and cell and the body wall immunity of insect host can be suppressed, thus promote Fungus determining in insect bodies is grown.

The synthesis of embodiment 4 green muscardine fungus toxin and the relation of fungus host speciality

The relation of element and dtxS 1 gene presence or absence, this reality is destroyed in order to study different green muscardine fungus kind synthesis further Execute the different strains that example uses 9 kinds of green muscardine funguss of high performance liquid chromatography and PCR Amplification Analysis.

Result shows, Robert green muscardine fungus, M.robertsii, Guizhou green muscardine fungus M.guizhouense, the green deadlock of chafer Bacterium M.anisopliae, flat sand green muscardine fungus M.pingshaense, brown green muscardine fungus M.brunneum can be in Czapek's medium Produce and destroy element, and locust green muscardine fungus M.acridum, big spore green muscardine fungus M.majus, white green muscardine fungus M.album and the green deadlock of low temperature Bacterium M.frigidum can not synthesize destruction element (Fig. 9 A).It is corresponding whether this exists dtxS1 gene with these green muscardine fungus genomes (Fig. 9 B), the i.e. green muscardine fungus without dtxS1 gene can not synthesize destruction element.Result shows that green muscardine fungus obtains during evolution Destroy element synthetic gene bunch relevant to the evolution of its host range.

The all documents mentioned in the present invention are incorporated as reference the most in this application, just as each document by individually It is incorporated as with reference to like that.In addition, it is to be understood that after the above-mentioned teachings having read the present invention, those skilled in the art can To make various changes or modifications the present invention, these equivalent form of values fall within the model that the application appended claims is limited equally Enclose.

Claims (6)

1. the method that host cell is transformed, it is characterised in that include step:

A () measures expression and/or the activity belonging to each related gene destroying element synthetic gene bunch in described host cell；

B (), according to measurement result, imports the related gene destroying element synthetic gene bunch in described host cell, thus recovers institute State host cell and produce the ability destroying element,

Wherein, the related gene of described gene cluster includes one or more following genes: dtxS1 gene, dtxS2 gene, DtxS3 gene, dtxS4 gene；

Described host cell is Robert green muscardine fungus；

Wherein,

DtxS1 gene code Nonribosomal Peptide Synthetases, and dtxS1 gene at least has the one or more spies selected from lower group Levy: (i) coding aminoacid sequence as shown in SEQ ID NO:5；(ii) there is the polynucleotide sequence as shown in SEQ ID NO:6 Row；

DtxS2 gene code cytochrome P 450 monooxygenases, and dtxS2 gene at least have selected from lower group one or more Feature: (i) coding aminoacid sequence as shown in SEQ ID NO:7；(ii) there are the polynucleotide as shown in SEQ ID NO:8 Sequence；

DtxS3 gene code aldehyde ketone reductase, and dtxS3 gene at least has one or more features selected from lower group: (i) compiles Code aminoacid sequence as shown in SEQ ID NO:9；(ii) there is the polynucleotide sequence as shown in SEQ ID NO:10；

DtxS4 gene code glutamate decarboxylase, and dtxS4 gene at least has one or more features selected from lower group: (i) Coding aminoacid sequence as shown in SEQ ID NO:11；(ii) there is the polynucleotide sequence as shown in SEQ ID NO:12.

2. the method for claim 1, it is characterised in that described Robert green muscardine fungus is described destruction element synthetic gene Bunch the Robert green muscardine fungus of less than one gene inactivation: dtxS1 gene, dtxS2 gene, dtxS3 gene, dtxS4 gene.

3. the method for claim 1, it is characterised in that when dtxS4 gene inactivation or the activity decrease of described gene cluster Time, further comprise the steps of: interpolation Beta-alanine in cultivating system, to promote to destroy the formation of element.

4. one kind is recovered Robert green muscardine fungus and produces the method for ability destroying element, it is characterised in that include step:

In described Robert green muscardine fungus, import the related gene destroying element synthetic gene bunch, thus it is green to recover described Robert Stiff bacterium produces the ability destroying element, and wherein, the related gene of described gene cluster includes one or more following gene: dtxS 1 Gene, dtxS2 gene, dtxS3 gene, dtxS4 gene；

Wherein, dtxS 1 gene code Nonribosomal Peptide Synthetases, and dtxS1 gene at least has selected from one of lower group or Multiple features: (i) coding aminoacid sequence as shown in SEQ ID NO:5；(ii) there is the multinuclear as shown in SEQ ID NO:6 Nucleotide sequence；

DtxS2 gene code cytochrome P 450 monooxygenases, and dtxS2 gene at least have selected from lower group one or more Feature: (i) coding aminoacid sequence as shown in SEQ ID NO:7；(ii) there are the polynucleotide as shown in SEQ ID NO:8 Sequence；

DtxS3 gene code aldehyde ketone reductase, and dtxS3 gene at least has one or more features selected from lower group: (i) compiles Code aminoacid sequence as shown in SEQ ID NO:9；(ii) there is the polynucleotide sequence as shown in SEQ ID NO:10；

DtxS4 gene code glutamate decarboxylase, and dtxS4 gene at least has one or more features selected from lower group: (i) Coding aminoacid sequence as shown in SEQ ID NO:11；(ii) there is the polynucleotide sequence as shown in SEQ ID NO:12.

5. the Robert green muscardine fungus lacked selected from the related gene destroying element synthetic gene bunch, it is characterised in that described The related gene of gene cluster include one or more following genes: dtxS1 gene, dtxS2 gene, dtxS3 gene, dtxS4 Gene；

Wherein,

DtxS1 gene code Nonribosomal Peptide Synthetases, and dtxS1 gene at least has the one or more spies selected from lower group Levy: (i) coding aminoacid sequence as shown in SEQ ID NO:5；(ii) there is the polynucleotide sequence as shown in SEQ ID NO:6 Row；

DtxS2 gene code cytochrome P 450 monooxygenases, and dtxS2 gene at least have selected from lower group one or more Feature: (i) coding aminoacid sequence as shown in SEQ ID NO:7；(ii) there are the polynucleotide as shown in SEQ ID NO:8 Sequence；

DtxS3 gene code aldehyde ketone reductase, and dtxS3 gene at least has one or more features selected from lower group: (i) compiles Code aminoacid sequence as shown in SEQ ID NO:9；(ii) there is the polynucleotide sequence as shown in SEQ ID NO:10；

DtxS4 gene code glutamate decarboxylase, and dtxS4 gene at least has one or more features selected from lower group: (i) Coding aminoacid sequence as shown in SEQ ID NO:11；(ii) there is the polynucleotide sequence as shown in SEQ ID NO:12.

6. one kind produces the method that B class destroys element, it is characterised in that under conditions of applicable cultivation, cultivates Robert green muscardine fungus, Thus produce B class and destroy element, wherein said Robert green muscardine fungus only lacks dtxS2 gene, but do not lack dtxS 1 gene, DtxS3 gene, dtxS4 gene；

Wherein,

DtxS1 gene code Nonribosomal Peptide Synthetases, and dtxS1 gene at least has the one or more spies selected from lower group Levy: (i) coding aminoacid sequence as shown in SEQ ID NO:5；(ii) there is the polynucleotide sequence as shown in SEQ ID NO:6 Row；

DtxS2 gene code cytochrome P 450 monooxygenases, and dtxS2 gene at least have selected from lower group one or more Feature: (i) coding aminoacid sequence as shown in SEQ ID NO:7；(ii) there are the polynucleotide as shown in SEQ ID NO:8 Sequence；

DtxS3 gene code aldehyde ketone reductase, and dtxS3 gene at least has one or more features selected from lower group: (i) compiles Code aminoacid sequence as shown in SEQ ID NO:9；(ii) there is the polynucleotide sequence as shown in SEQ ID NO:10；

DtxS4 gene code glutamate decarboxylase, and dtxS4 gene at least has one or more features selected from lower group: (i) Coding aminoacid sequence as shown in SEQ ID NO:11；(ii) there is the polynucleotide sequence as shown in SEQ ID NO:12.