CN103194433B - Low-temperature lipase Lip1 as well as gene and application thereof - Google Patents

Abstract

The invention discloses a low-temperature lipase Lip1 and a gene thereof. An amino acid sequence of the low-temperature lipase is SEQ ID NO:2; and the gene is from Yersinia enterocolitica KM1 of a Kunming slaughter house refrigeration house. According to the invention, the low-temperature lipase is prepared from a recombinant expression vector containing the enzyme gene is used for preparing low-temperature lipase; the low-temperature lipase prepared from the expression vector has good activity and stability under the low-temperature condition, wherein the optimal acting temperature is 25 DEG C and the optimal acting pH value is 7.5, and therefore, the low-temperature lipase can be extensively applied to the industrial fields including detergent preparation and biodiesel preparation.

Description

Low-temperature lipase Lip1 and gene thereof and application

Technical field

The present invention relates to enzyme genetically engineered and enzyme engineering field, be specifically related to a kind of low-temperature lipase Lip1 and gene and application.

Background technology

Lipase (Lipase, EC 3.1.1.3) is the enzyme that class catalysis natural fats and oils (triglyceride) on oil-water interface is degraded to glycerine and free fatty acids, is extensively present in plant, animal and microorganism.Because having advantages of, it does not need the just positive reversed reaction of energy catalysis of coenzyme, in the last few years, lipase, as the catalyzer of the synthetic decomposition of lipoid cpd and transesterify, has been widely used in improvement, the degreasing of leather silk spinning, the biofuel preparation of fat hydrolysis, flavour of food products and fragrance and has made an addition in washing composition to improve soil removability etc.

The lipase of current industrial application is middle gentle high temperature lipase mostly, they are mostly by microorganisms, and are essentially extracellular enzyme, and the optimum temperuture of producing enzyme is many more than 30 ℃, and the optimal reactive temperature of enzyme is generally 40 ℃ of left and right or higher, near general loss of activity 0 ℃.The low-temperature lipase of current research is generally produced by psychrophile secretion, and the optimal reactive temperature of enzyme is general all lower than 40 ℃, and still the high enzyme of tool is alive at 0 ℃.Due to them, generally there is under low temperature the features such as enzyme activity is high, anti-organic solvent, thereby become the focus that enzymology and industrial application are explored in recent years.

Biofuel is the fatty acid ester material being generated by animal-plant oil and some short chain alcohol generation transesterification reactions, is a kind of novel free of contamination renewable energy source.The production method of biofuel has chemical method and biological process, and the catalyzer that chemical method is used mostly is acid base catalysator, easily causes secondary pollution; And biological process utilizes enzyme as catalyzer, there is the advantages such as reaction conditions gentleness, environmentally friendly, reaction process is simple and easy to control; Therefore the research of Production by Enzymes biofuel oneself be subject to extensive concern.Because Enzymatic Synthesis of Biodiesel is generally to carry out in organic solvent, consider the easy volatile of reaction substrate and product, under cold condition, be more conducive to the carrying out of enzyme reaction, and also can improve the characteristic (Juan etc. of biofuel simultaneously, EP1331260,2003).

In washing industry, the washing methods of China is to take cold washing as main, recently in order to save the energy, also there is the trend of wash temperature low temperature in American-European countries, middle temperature lipase is because enzyme under cold condition is alive poor, efficiency is low, does not reach best applications effect, only has the consumption of increasing just can reach best applications effect.Therefore desirable detergent use lipase is the lipase that also can play one's part to the full at low temperatures.

The suitableeest enzyme of low-temperature lipase is lived temperature generally below 40 ℃, and it is low that it has the suitableeest enzyme temperature alive, has at low temperatures the higher features such as catalytic efficiency.Thereby the superiority that industrial application has middle temperature lipase to replace such as prepare in washing composition, biofuel.

Oneself is separated from multiple different microorganism for lipase, and more existing low-temperature lipases from bacterium, as psychrophilic bacteria psychrobacter immobilisthe lipase producing, optimum temperuture is 55 ℃; Pseudomonas pseudomonas sp. the lipase optimum temperuture that B11 produces is for being 45 ℃; But yet there are no optimum temperuture lower than the report of 30 ℃ of low-temperature lipases.

Summary of the invention

Object of the present invention aims to provide a kind of new type low temperature lipase Lip1, and its aminoacid sequence is as shown in SEQ ID NO:2.

In the present invention, low-temperature lipase is the protein with SEQ ID NO:2 amino acid residue sequence, or there is at least 80% homology with the amino acid residue sequence of SEQ ID NO:2 and have with the identical activity of SEQ ID NO:2 protein by the derivative protein of SEQ ID NO.2, by the derivative protein of SEQ ID NO:2 be by the amino acid residue sequence of SEQ ID NO:2 through replacement, disappearance or the interpolation of one or several amino-acid residue and have with the identical activity of SEQ ID NO:2 albumen by the derivative protein of SEQ ID NO:2.

Another object of the present invention is to provide the gene of a kind of above-mentioned low-temperature lipase Lip1 that encodes.

The gene nucleotide series of the Lip1 of low-temperature lipase described in the present invention has the nucleotide sequence of 80% above homology as shown in SEQ ID NO:1 or with the nucleotide sequence of SEQ ID NO:1, and this sequence encoding identical function protein DNA sequence, or the polynucleotide of aminoacid sequence protein shown in coding SEQ ID NO:2.

Another object of the present invention is to provide the recombinant expression vector pET28a-that contains low-temperature lipase Lip1 gene lip1, by expression vector pET28a- lip1in importing Bacillus coli cells, by the induction of inductor IPTG, complete the expression of low-temperature lipase Lip1, thereby for utilizing this expression vector to prepare low-temperature lipase Lip1 and its industrial production based theoretical.

Another object of the present invention is that low-temperature lipase Lip1 is applied in the fatty acid ester catalysis of middle long-chain, and the present invention adopts sweet oil as the catalytic activity of substrate checking lipase.

In order to realize above-mentioned purpose of the present invention, this discovery provides following technical proposals:

1, the acquisition of low-temperature lipase Lip1 gene

(1) with Yersinia ( yersinia enterocolitica) this laboratory separation of KM1(is from Kunming meat processing combine freezer, bacterial strain on August 26th, 2008 " China Committee for Culture Collection of Microorganisms's common micro-organisms " center " preservation; preserving number is: genomic dna CGMCC No.2637) is that the following primer of template utilization carries out pcr amplification, and primer sequence is as follows:

lip1 R1：5’-CCGGAATTCTTACAGGCCTTTTGATTT-3’

5 ' end and 3 ' at upstream and downstream primer adds respectively restriction endonuclease ndei and ecoRi restriction enzyme site and protection base, extraction Yersinia ( yersinia enterocolitica) genomic dna of KM1, and take genomic dna and as template, utilize above-mentioned primer PCR amplification and obtain the gene of low-temperature lipase Lip1 lip1;

(2) glue reclaims goal gene lip1.

2, lip1the TA clone of gene and structure coli expression carrier pET28a- lip1

Use pMD18-T carrier to carry out TA clone, in 16 ℃ of connections of spending the night, transformed competence colibacillus cell bacillus coli DH 5 alpha, uses restriction endonuclease ndei and ecoRi enzyme carries out after double digestion checking and PCR checking, and positive colony is sent to order-checking company and checked order;

Use restriction enzyme ndei and ecoRi enzyme is to pET28a and the correct pMD18-of order-checking lip1carrier carries out double digestion, obtains respectively 5 ' and 3 ' end respectively with restriction endonuclease ndei and ecoRi restriction enzyme site lip1gene and pET28a carrier large fragment, reclaim respectively after agarose gel electrophoresis, reclaims product and connect 16h at 16 ℃, transform competent escherichia coli cell DH5 α, PCR checking, the order-checking of positive colony sample presentation, the compare of analysis that checks order, obtains coli expression carrier pET28a- lip1.

3, lip1the expression of gene

The competent cell of preparing e. coli bl21, is used chemical transformation that expression vector is transformed in Bacillus coli cells, by PCR, is proved to be successful and is obtained transforming bacterial strain, and picking mono-clonal is connected to Kan-LB liquid nutrient medium shaking culture and obtains seed liquor.According to 1% inoculum size switching bacterium liquid, to Kan-LB liquid nutrient medium, add IPTG inducible gene expression in after 37 ℃ of shaking culture 2h, use LB-rhodamine B substratum checking lipase activity.

4, the mensuration of the making of protein concentration typical curve and low-temperature lipase protein concentration

Utilize protein standard substance BSA and low-temperature lipase sample to be measured in BCA determination of protein concentration test kit, in microplate reader, measure protein standard substance and testing sample at 562nm(or 540-595nm wavelength) light absorption value under wavelength, according to protein standard substance concentration and light absorption value, make protein concentration typical curve, from the protein concentration of typical curve and diluted sample multiple calculating low-temperature lipase sample.

5, utilize the AKTA FPLC system purifying low-temperature lipase of Amersham company

Utilize the AKTA FPLC system purifying low-temperature lipase of Amersham company, obtain the higher low-temperature lipase of purity and carry out follow-up lipase zymologic property determination experiment.

6, adopt sweet oil as substrate, the application of checking low-temperature lipase Lip1 in the fatty acid ester catalysis of middle long-chain

The lipase gene of cloning in the present invention lip1be first from Yersinia ( yersinia enterocolitica) clone obtains in KM1, and (as BL21) expresses in intestinal bacteria, the engineering strain obtaining can significantly improve the output of low-temperature lipase with respect to wild type strain, for improving the industrial output of low-temperature lipase, has established molecular basis.

The present invention studies low-temperature lipase physico-chemical property, the multiple use of this low-temperature lipase in industrial production is provided, this gene expression product--low-temperature lipase Lip1 relatively in other warm lipase to have the suitableeest enzyme temperature of living low, there is at low temperatures higher catalytic efficiency, there is good activity and stability, optimum temperature is 25 ℃, action pH value is 7.5, and effectively save energy, can be applicable in detergent industry and other commercial runs; By usining sweet oil, as the middle long chain fatty acid ester catalytic activity of substrate, verify, proved that this low-temperature lipase has the activity of long chain fatty acid ester in catalysis, can apply to the catalyzed reaction of such ester.

Accompanying drawing explanation

Fig. 1 is the clone products electrophoresis schematic diagram of low-temperature lipase gene of the present invention, in figure: M is M-marker; Swimming lane 1 is the clone products that has signal peptide primer lip1;

Fig. 2 is clone gene of the present invention and expression vector double digestion result schematic diagram, in figure: M is M-marker; Swimming lane 2 is the clone products that have signal peptide lip1; Swimming lane 3 is pET28a plasmids;

Fig. 3 is that SDS-PAGE of the present invention detects expressing protein result schematic diagram, in figure: M is M-marker; Swimming lane 2 is clone genes lip1the supernatant of abduction delivering product; The 4th, lip1the precipitation of abduction delivering product;

Fig. 4 is the dull and stereotyped checking of rhodamine B of the present invention lipase activity result schematic diagram, in figure: the 3rd, clone gene lip1the supernatant of abduction delivering product; The 4th, lip1the precipitation of abduction delivering product;

Fig. 5 is that SDS-PAGE of the present invention detects expressing protein and results of comparison schematic diagram, in figure: M is M-marker; Swimming lane 1 is the precipitation that does not add inductor expression product; The 2nd, do not add the supernatant of inductor expression product; The 3rd, clone gene lip1the precipitation of abduction delivering product; The 4th, clone gene lip1the supernatant of abduction delivering product; The 5th, former fermented liquid contrast; The 6th, unloaded pET28a supernatant contrast; The 7th, the contrast of unloaded pET28a precipitation;

Fig. 6 is that SDS-PAGE of the present invention detects purification effect schematic diagram, in figure: M is M-marker; Swimming lane 1 is not add inductor contrast; The 2nd, the supernatant of unpurified induction expression protein; The 3rd, albumen 5 ul applied sample amounts after purifying; The 4th, protein 10 ul applied sample amount after purifying; The 5th, do not hang up pillar foreign protein;

Fig. 7 is abduction delivering low-temperature lipase protein concentration typical curve of the present invention;

Fig. 8 is the affect result schematic diagram of differential responses temperature of the present invention on lipase activity;

Fig. 9 is the affect result schematic diagram of temperature of the present invention on stability of lipase;

Figure 10 is the affect result schematic diagrams of the different pH of the present invention on lipase activity;

Figure 11 is the affect result schematic diagram of pH of the present invention on stability of lipase;

Figure 12 is the different salt ions of the present invention and the affect result schematic diagram of EDTA on lipase activity, and wherein 1 is contrast; The 2nd, NaCl; The 3rd, KCl; The 4th, CaCl ₂; The 5th, MgCl ₂; The 6th, BaCl ₂; The 7th, ZnCl ₂; The 8th, MnCl ₂; The 9th, CuCl ₂; The 10th, NiCl ₂; The 11st, EDTA;

Figure 13 is low-temperature lipase hydrolysis longer chain fatty acid (take sweet oil as substrate) result schematic diagram of the present invention.

Embodiment

Below by embodiment, the present invention is described in further detail, but content of the present invention is not limited to this, method all operations according to a conventional method if no special instructions in the present embodiment, the conventional reagent of agents useful for same employing if no special instructions or the according to a conventional method reagent of configuration.

The reagent adopting in the present embodiment is mainly molecular biology experiment reagent, various restriction enzymes, Taq archaeal dna polymerase, dNTP etc. are Dalian precious biotechnology company limited product, bacillus coli DH 5 alpha is TakaRa company limited, plasmid extraction kit is purchased from the limited technology company of raw work biotechnology in Shanghai, all the other reagent are domestic analytical pure, and instrument is molecular biology and genetically engineered laboratory apparatus & equipment in common use.

All primer sequences synthesize with gene sequencing all in Shanghai Sheng Gong Bioisystech Co., Ltd.

embodiment 1: the clone of low-temperature lipase gene, Expression and purification

1, the gene of pcr amplification coding low-temperature lipase Lip1

Employing CTAB method extraction Yersinia ( yersinia enterocolitica) the total DNA of KM1, concrete operations are as follows:

(1) under aseptic condition, the inoculum size access Yersinia according to 1% ( yersinia enterocolitica) KM1 to 5 ml

In fresh liquid substratum, 15 ℃ of shaking table constant temperature is shaking culture 15 hours significantly; Nutrient solution OD ₆₀₀light absorption value approximately 1.0 left and right, get 3ml bacterium liquid and collect thalline with centrifugal 10 min of 4000 * g, with the resuspended bacterial sediment of TE damping fluid of 567 μ l;

(2) add the Proteinase K of 10% the SDS of 30 μ l and the 20mg/ml of 3 μ l, fully mix and be placed on 37 ℃ of constant temperature incubations 1 hour;

(3) add the NaCl solution of 5 mol/L and the CTAB/NaCl solution of 80 μ l of 100 μ l, after fully mixing, be placed in again 65 ℃ of constant temperature incubation 10min;

(4) add isopyknic chloroform/primary isoamyl alcohol, after jog mixes, through centrifugal 10 min of 6000 * g;

(5) with rifle head, carefully draw upper strata clear water phase, then add isopyknic phenol/chloroform/primary isoamyl alcohol (25 ︰ 24 ︰ 1) mixing solutions, after jog mixes, with centrifugal 10 min of 6000 * g;

(6) repeat previous action until albumen impurity is precipitated completely;

(7) carefully draw upper strata aqueous favoring, add 3 M sodium acetates of 1/10 times of volume and the dehydrated alcohol of precooling, after-80 ℃ of standing 30min of refrigerator, through 12000 * g, 4 ℃, centrifugal 15min, abandons supernatant; Add 70% washing with alcohol DNA precipitation, with 12000 * g, 4 ℃ of centrifugal 2min, abandon supernatant, repeated washing once, by uncovered room temperature 10～20 min that are positioned over of centrifuge tube, with appropriate dd H ₂after O dissolution precipitation, save backup.

With Yersinia ( yersinia enterocolitica) genomic dna of KM1 is template, utilizes primer Lip1 F1(containing signal peptide), Lip1 R1 carries out pcr amplification, obtains amplified production lip1through 1% agarose gel electrophoresis, detect, as shown in Figure 1, the present embodiment primer sequence used is as follows for result:

Lip1 F1：GGGTTTCATATGATGTCTACAAATTCAACTTTGAAATATCCAGTCGTATTAGTT

Lip1 R1：CCGGAATTCTTACAGGCCTTTTGATTT

2, the structure of expression vector

Use pMD18-T carrier to carry out TA clone, linked system is 0.5 μ l pMD18-T carrier, 3ul pcr amplification product lip1, the T4 DNA ligase of 2.5 μ l, in 16 ℃ of connections of spending the night, obtains recombinant plasmid pMD18- lip1.Thermal stimulus method transforms recombinant plasmid pMD18- lip1in competent cell bacillus coli DH 5 alpha, coat the dull and stereotyped 37 ℃ of incubated overnight of Amp-LB, after picking mono-clonal PCR checking conversion results, positive colony send order-checking company to check order.

Use restriction enzyme ndei and ecoRi enzyme is respectively to pET-28a carrier and the correct pMD18-of order-checking lip1carrier carries out double digestion, and enzyme is cut and be the results are shown in Figure 2, obtain respectively 5 ' and 3 ' end respectively with ndei and ecoRi restriction enzyme site lip1gene and pET-28a carrier large fragment, reclaim respectively after agarose gel electrophoresis.According to goal gene: carrier=5:1(mol ratio) application of sample, then adds T4 DNA ligase to connect 16h at 16 ℃; Adding 6 μ l to connect in product competent cell bacillus coli DH 5 alpha 50 μ l mixes; Mixed solution ice bath 30min, ice bath 2min after 42 ℃ of thermal stimulus 90s, adds the LB substratum of 400 μ l; 37 ℃ of shaking table 200rpm cultivate 60min makes thalline recovery; Cultivation finishes rear absorption 200 μ l nutrient solutions and is coated on the LB flat board that contains kantlex (Kan) resistance; 37 ℃ of incubated overnight, picking white colony, is inoculated into incubated overnight in kantlex Kan+LB liquid nutrient medium; PCR verifies conversion results; Positive colony is sent to Shanghai Sheng Gong Bioisystech Co., Ltd and is carried out the exactness that sequence verification is inserted gene, obtains recombinant expression vector pET28a- lip1, this expression vector contains lip1gene.

3, conversion, screening and sequence verification

With chemical transformation by recombinant expression vector pET28a- lip1be converted in e. coli bl21 (DE3), concrete grammar is: 50 μ l intestinal bacteria e.coliin BL21 competent cell, add 1 μ l recombinant expression vector pET28a- lip1mix; Mixed solution ice bath 30min, ice bath 2min after 42 ℃ of thermal stimulus 90s, adds the LB liquid nutrient medium of 400 μ l; 37 ℃ of shaking table 200rpm cultivate 60min makes thalline recovery; Cultivation finishes rear absorption 200 μ l nutrient solutions to be coated on the LB flat board that contains kantlex (Kan) resistance, in 37 ℃ of incubated overnight; With the LB substratum that contains kantlex (Kan) (50 μ g/ml), screen, picking mono-clonal, carries out enlarged culturing and extracts plasmid, sequence verification.Lip1 encoding gene nucleotide sequence is as shown in SEQ ID NO:1; Low-temperature lipase Lip1 Argine Monohydrochloride sequence, as shown in SEQ ID NO:2, proves that the plasmid and the recombinant bacterium that build are correct, and positive colony is denoted as to BL21-pET- lip1, positive plasmid is denoted as pET- lip1.

4, the expression of low-temperature lipase

Picking BL21-pET- lip1in the LB liquid nutrient medium that single bacterium colony access contains kantlex (Kan) (50 μ g/ml), in 37 ℃ of incubated overnight.Overnight culture is inoculated in to the LB substratum that 1L contains kalamycin (Kan) (50 μ g/ml) according to 1% inoculum size, and 37 ℃ of thermal agitations (200rpm) are cultivated, to the OD of fermented liquid ₆₀₀value reaches 0.6-0.8 left and right, in fermentation system, adds IPTG (final concentration 0.5mM), cultivates 6 hours for 30 ℃; The centrifugal 15min of 5000rpm, collects thalline; With the resuspended thalline of pH 7.5 Tris-Cl damping fluid, after ultrasonic disruption 12, the centrifugal 15min of 000rpm; SDS-PAGE detects albumen, LB-rhodamine B substratum (adding rhodamine B to final concentration in LB solid medium is 0.1%(V/V)) checking lipase activity, enzyme checking alive shows clone gene lip1the supernatant of recombination expression product has lipase activity, collects supernatant liquor, is the crude enzyme liquid that contains target protein, and experimental result is shown in Fig. 3, as can be seen from the figure, and swimming lane 2(clone gene lip1the supernatant of recombination expression product) and 4(clone gene lip1the precipitation of recombination expression product) all have new protein band to occur, and the fusion rotein value 35KDa that its molecular weight of albumen is inferred with theory conforms to substantially, but the albumen of swimming lane 4 may be form with inclusion body, have fat-free enzymic activity; Further, by LB-rhodamine B substratum checking lipase activity, the results are shown in Figure 4, sample 3(clone gene lip1the supernatant of recombination expression product) on LB-rhodamine B flat board, can form significantly hydrolysis circle, and sample 4(clone gene lip1the precipitation of recombination expression product) on flat board, do not form hydrolysis circle, further prove clone gene lip1the supernatant of recombination expression product has lipase activity and precipitates does not have lipase activity.

The expression product and the empty carrier pET28a(that by arranging, do not add inductor IPTG do not contain the clone gene of lipase lip1) abduction delivering product in contrast, verify the effect of inductor and the clone gene that contains lipase lip1expression vector can improve the expression amount of lipase, experimental result is shown in Fig. 5, swimming lane 1 and 2 is not for adding the upper cleer and peaceful precipitation of the expression product of inductor, by SDS-PAGE figure, can find out, the fusion rotein value (35KDa) of inferring in theory is located, and upper cleer and peaceful precipitation all has a small amount of albumen to occur, but compares with the expression product (swimming lane 3 and 4) that has added inductor, protein content seldom, illustrates that adding inductor can obviously improve expressing quantity; Also there is minute quantity albumen in the product of empty carrier pET28a abduction delivering (swimming lane 6 and 7), but with contain the clone gene that has lipase lip1abduction delivering product (swimming lane 3 and 4) is compared, and can eliminate interference by the method for contrast is set.Therefore, can illustrate that by experiment the expression vector that contains low-temperature lipase gene can be for the preparation of low-temperature lipase Lip1, and expression amount is higher.

5, the purifying of low-temperature lipase

Adopt nickel affinity chromatography post to carry out purifying, in the AKTA of Amersham company FPLC system, use the HiTrap chelating HP column(nickel post of 1ml loading amount) purifying supernatant, non-sex change nickel post binding buffer liquid I is for balance purifying cylinder and loading; Albumen applied sample amount is 10ml, and flow velocity is made as 1ml/min; With 20% non-sex change nickel post elution buffer, (be the mixing solutions of non-sex change nickel post binding buffer liquid I and non-sex change nickel post elution buffer II, the volume ratio of non-sex change nickel post binding buffer liquid I and non-sex change nickel post elution buffer II is 80:20) wash, remove the foreign protein of non-specific binding.With 80% non-sex change nickel post elution buffer, (be the mixing solutions of non-sex change nickel post binding buffer liquid I and non-sex change nickel post elution buffer II, the volume ratio of non-sex change nickel post binding buffer liquid I and non-sex change nickel post elution buffer II is 20:80) carry out wash-out, collect the elutriant containing elution peak, SDS-PAGE detects sample purity in elutriant, purification result is shown in Fig. 6, as can be seen from Figure, by the purifying of nickel affinity chromatography post, protein concentration has improved about 1 times above (swimming lane 2 is identical with 3 applied sample amount, but protein content has obviously improved approximately 1 times).

Wherein: non-sex change nickel post binding buffer liquid I: 0.05 M Tris-Cl damping fluid, 0.5 M sodium-chlor, pH 7.5;

Non-sex change nickel post elution buffer II: 0.05 M Tris-Cl damping fluid, 0.5 M sodium-chlor, 0.5 M imidazoles, pH 7.5.

embodiment 2: the enzyme biopsy of low-temperature lipase enzyme liquid is surveyed

1, determination of protein concentration after purifying, adopts BCA test kit to do standard curve determination protein concentration.

Protein concentration standard curve making method:

(1) adopt the method for gradient dilution, accurate dilution BSA standard model (original content 2000ug/ml), obtaining respectively concentration is 0ug/ml(blank), the standard model of 25ug/ml, 125ug/ml, 250ug/ml, 500ug/ml, 750ug/ml and 1000ug/ml; Dilute testing sample to different concns (determining according to the valid reading scope of microplate reader) simultaneously;

(2), according to the quantity of working sample, according to 50/1 ratio mixing A liquid and B liquid (test kit carries), be mixed with working fluid;

(3) in each hole of 96 orifice plates, add protein standard substance, testing sample and the blank of 20 ul different concns, every hole adds 200 ul working fluids, in 37 ℃, places 30 min;

(4) in microplate reader, measure the absorbancy under 540nm;

(5), according to protein standard substance concentration and light absorption value, make protein concentration typical curve, from the protein concentration of typical curve and diluted sample multiple calculation sample.

Typical curve is shown in Fig. 7, according to figure, can draw protein concentration and absorbancy OD _540nmbetween equation: y=0.3519x-0.0001, R2=0.9992, the protein concentration that simultaneously records testing sample low-temperature lipase is: 2.147mg/ml.

2, the mensuration of lipase activity

The mensuration of lipase activity adopts alkali formula volumetry, and concrete operations are as follows:

(1) enzyme is lived and is defined: under test conditions, every milliliter of enzyme liquid per minute catalytic substrate discharges the free fatty acids of 1 μ mol, is defined as a lipase activity unit of force (U);

(2) the sweet oil emulsion using in the present embodiment is 3%(W/V) polyvinyl alcohol with sweet oil in 3: ratio 1(V/V) is mixed, then in mulser, maximum speed of revolution carries out emulsification for 3 minutes/time, repeat 3 times, until the mixed solution of polyvinyl alcohol and sweet oil is not stratified after standing several minutes;

(3) control group: simultaneously empty carrier pET-28a (+) is converted into e. coli bl21 (DE3), screening verification, obtain the positive colony that contains empty carrier pET-28a (+), be denoted as BL21-pET-28a (+), bacterium in contrast, according to above-mentioned steps, contrast bacterium is carried out to expression and the purifying of enzyme, the liquid that purifying is obtained carries out enzyme biopsy survey;

(4) experimental technique: the clean beaker of getting 4 100ml, numbering 1-4(wherein 1 for contrast, 2-4 be three parallel), the Tris-Cl damping fluid of 50 mM pH7.5 and the sweet oil emulsion of 4ml that in each beaker, add respectively 5ml, in 25 ℃ of water bath with thermostatic control shaking tables, temperature is bathed after 10min, in No. 1 beaker, add 1ml control enzyme liquid (unloaded expression product), 2-4 beaker adds the enzyme liquid (2ug/ml) of 1ml, sustained oscillation reaction 10min in 25 ℃ of water bath with thermostatic control shaking tables, the dehydrated alcohol termination reaction that adds subsequently 15ml 95%, 1% phenolphthalein indicator that adds 25 μ l in each beaker, with 50 mM NaOH solution, carry out the titration of alkali formula, record respectively before titration and titration after the scale of drop-burette, calculate the NaOH liquor capacity consuming, according to enzyme calculation formula alive, calculating the enzyme of lipase lives,

(5) enzyme calculation formula alive: enzyme activity unit (U)= , V wherein _sample: the volume of the NaOH consuming in sample bottle while being titrated to terminal (ml); V _empty: the volume of the NaOH consuming in control bottle while being titrated to terminal (ml); : the volumetric molar concentration of NaOH; : the extension rate of enzyme liquid; : the reaction times (minute); V _enzyme: the volume (ml) that joins the enzyme liquid in reaction system.

By can be calculated the work of low-temperature lipase enzyme, be: 27.6U/ml, specific activity: 13800U/mg.

Embodiment 3: low-temperature lipase part zymologic property research

(1) low-temperature lipase optimum temperature

Relatively the enzyme of low-temperature lipase under differing temps lived, measure its optimum temperuture, the mensuration of optimum temperuture be in 50 mM Tris-Cl damping fluids (pH 7.5) under differing temps (10-90 ℃) carry out enzymatic reaction, adopt alkali formula titration measuring lipase activity.

In the present embodiment, specific experiment method is: the clean beaker of getting 11 100ml, the Tris-Cl damping fluid of 50 mM pH7.5 and the sweet oil emulsion of 4ml that in each beaker, add respectively 5ml, in differing temps gradient (10, 20, 25, 30, 35, 40, 50, 60, 70, 80, 90 ℃) water bath with thermostatic control shaking table in temperature bathe after 10min, the enzyme liquid (2ug/ml) that adds 1ml, sustained oscillation reaction 10min in the water bath with thermostatic control shaking table of differing temps gradient, the dehydrated alcohol termination reaction that adds subsequently 15ml 95%, 1% phenolphthalein indicator that adds 25 μ L in each beaker, with 50 mM NaOH solution, carry out the titration of alkali formula.Record respectively before titration and titration after the scale of drop-burette, calculate the volume of the NaOH solution that consumes, alive according to the enzyme enzyme of lipase of living under calculation formula calculating condition of different temperatures.

Contrast arranges with reference to control group setting in embodiment 2, adds control enzyme liquid after adding reagent to be sequentially adjusted into the dehydrated alcohol that first adds 15ml 95%.At the enzyme of take that the highest temperature alive, measured value is with reference to (100%), and enzyme measured at all the other temperature is lived in contrast, draws out the temperature catalysis curve of lipase with relative enzyme work.

Experimental result is shown in Fig. 8, and as can be seen from the figure the optimum temperature of low-temperature lipase of the present invention is 25 ℃, and this result shows that lipase Lip1 has the characteristic feature of cold-adapted enzyme, and the temperature of reaction of enzyme is low, has higher enzyme and live under cold condition.

(2) impact of temperature on low-temperature lipase stability

Under differing temps (40-70 ℃) condition, a minute different enzyme liquid treatment time section (0-30 min, sampling interval 5 min) samples, and measures the remnant enzyme activity of lipase under optimum temperuture.

In the present embodiment, under differing temps (40,50,60,70 ℃) condition, divide different enzyme liquid treatment time section (0-30 min, sampling interval 5 min) sampling, under optimum temperuture, measure the remnant enzyme activity of lipase, concrete grammar is: get respectively 1ml protein concentration and be the purifying enzyme liquid of 2ug/ml in the water-bath of condition of different temperatures (40,50,60,70 ℃), from 0min, every 5min sampling 1ml, till sampling altogether and processing 30min to enzyme liquid 7 times, sample is in the temporary enzyme activity determination of preparing of 4 ℃ of refrigerators.

Adopt alkali formula titration measuring enzyme to live: the clean beaker of getting 12 100ml, the Tris-Cl damping fluid of 50 mM pH7.5 and the sweet oil emulsion of 4ml that in each beaker, add respectively 5ml, in optimum temperuture (25 ℃) water bath with thermostatic control shaking table, temperature is bathed after 10min, add 1ml(2ug/ml) the enzyme liquid processed of differing temps different time, sustained oscillation reaction 10min in 25 ℃ of water bath with thermostatic control shaking tables, the dehydrated alcohol termination reaction that adds subsequently 15ml 95%, 1% phenolphthalein indicator that adds 25 μ l in each beaker, with 50 mM NaOH solution, carry out the titration of alkali formula, record respectively before titration and titration after the scale of drop-burette, calculate the volume of the NaOH solution that consumes, according to enzyme, living, to calculate the residual enzyme of different treatment condition difference lipase sample time alive for calculation formula.

Contrast arranges with reference to control group setting in embodiment 2, adds control enzyme liquid after adding reagent to be sequentially adjusted into the dehydrated alcohol that first adds 15ml 95%.The enzyme of the enzyme liquid processed without excess temperature of the take value of living is with reference to (100%), and at all the other temperature, measured residual enzyme work in contrast, is drawn out the thermostability curve of enzyme with relative enzyme work.

Experimental result is shown in Fig. 9, and the low-temperature lipase Lip1 described in this patent processes after 30min at 40 ℃ and 50 ℃ as seen from the figure, and enzyme still can keep more stable enzyme to live, and reaches approximately 80%.But when temperature surpasses 50 ℃, Lip1 thermostability declines very fast, at 60 ℃, to process 15min and also can cause enzyme to be lived declining nearly 70%, result shows that Lip1 is typical cold-adapted enzyme.

(3) low-temperature lipase Optimun pH

Relatively the enzyme of low-temperature lipase under different pH values lived, and measures its optimum pH.The mensuration of optimum pH is damping fluid (the citric acid-sodium citrate damping fluid (pH 3.0-6.0) in the different pH values of 50mM; Phosphate buffered saline buffer (pH 6.0-7.0); Tris-Cl damping fluid (pH 7.0-10.0); Glycine-NaOH damping fluid (pH 10.0-12.0)) in, under 25 ℃ of conditions, carry out enzymatic reaction, adopt alkali formula titration measuring lipase activity.Concrete grammar is with optimum temperuture determination experiment.

Experimental result is shown in Figure 10, and the Optimun pH of low-temperature lipase of the present invention is 7.5 as seen from the figure.

(4) impact of pH value on low-temperature lipase stability

Under different pH buffer (pH 3.0-11.0) condition, 4 ℃ of treat enzyme liquid 12 h, measure the remnant enzyme activity of lipase, concrete grammar is: the clean beaker of getting 8 100ml, the Tris-Cl damping fluid of 50 mM pH7.5 and the sweet oil emulsion of 4ml that in each beaker, add respectively 5ml, in optimum temperuture (25 ℃) water bath with thermostatic control shaking table, temperature is bathed after 10min, add 1ml(2ug/ml) the enzyme liquid processed of different pH buffer, sustained oscillation reaction 10min in 25 ℃ of water bath with thermostatic control shaking tables, the dehydrated alcohol termination reaction that adds subsequently 15ml 95%, 1% phenolphthalein indicator that adds 25 μ l in each beaker, with 50 mM NaOH solution, carry out the titration of alkali formula.Record respectively before titration and titration after the scale of drop-burette, calculate the volume of the NaOH solution that consumes, according to enzyme, living, to calculate the residual enzyme of different treatment condition difference lipase sample time alive for calculation formula.

Contrast arranges with reference to control group setting in embodiment 2, adds control enzyme liquid after adding reagent to be sequentially adjusted into the dehydrated alcohol that first adds 15ml 95%.The enzyme of undressed enzyme liquid of the take value of living is with reference to (100%), and the lower measured residual enzyme of all the other pH values is lived in contrast, draws out the pH value stabilization linearity curve of enzyme with relative enzyme work.

Experimental result is shown in Figure 11, and the low-temperature lipase described in this patent is stable in maintain property within the scope of pH 6.0-8.0 as seen from the figure, can reach higher enzyme and live.

(5) impact of different metal ion pair low-temperature lipase activity

Under 25 ℃, pH 7.5 conditions, different metal ion (Na ⁺, K ⁺, Ca ²⁺, Mg ²⁺, Ba ²⁺, Zn ²⁺, Mn ²⁺, Cu ²⁺, Ni ²⁺, EDTA) at different ions concentration (10 mM, 20 mM), measuring the enzyme of low-temperature lipase lives, determine the impact that different metal ion different concns is lived on enzyme, specific experiment method is: the clean beaker of getting 11 100ml, the Tris-Cl damping fluid that adds respectively the 50 mM pH 7.5 of 5ml in each beaker, the salts solution of the sweet oil emulsion of 4ml and different metal ion different concns (final concentration that makes respectively metal ion is 1mM and 10mM), in optimum temperuture (25 ℃) water bath with thermostatic control shaking table, temperature is bathed after 10min, add 1ml(2ug/ml) enzyme liquid, sustained oscillation reaction 10min in 25 ℃ of water bath with thermostatic control shaking tables, the dehydrated alcohol termination reaction that adds subsequently 15ml 95%, in each beaker, add 1% phenolphthalein indicator of 25 μ L to carry out the titration of alkali formula with 50 mM NaOH solution, record respectively before titration and titration after the scale of drop-burette, calculate the volume of the NaOH solution that consumes, according to enzyme calculation formula alive, calculating the residual enzyme of different treatment condition different sample time of lipase lives.

Contrast arranges with reference to control group setting in embodiment 2, adds control enzyme liquid after adding reagent to be sequentially adjusted into the dehydrated alcohol that first adds 15ml 95%.The enzyme that do not add any metal ion of the take value of living is that the measured enzyme work of effect of all the other different metal ions enzymes is compared with the enzyme work contrasting with reference to (100%), with relative enzyme work, represents the impact of metal ion on enzyme work.

Experimental result is shown in Figure 12, and the low-temperature lipase Lip1 described in this patent is at the metal ion K of 1 mM as seen from the figure ⁺, Mg ²⁺under the condition existing, enzyme is lived and is improved approximately 20%; Metal ion Na at 1 mM ^+,ca ²⁺and under the condition of EDTA existence, enzyme is lived substantially without impact; And at the metal ion Ba of 1 mM ²⁺, Zn ²⁺, Mn ²⁺, Cu ²⁺, Ni ²⁺under the condition existing, enzyme work has reduced 20-30%.At 10mM metal ion Na ⁺, K ⁺, Ca ²⁺under existence condition, to enzyme, work improves; 10mM metal ions M g ²⁺almost enzyme is lived without impact; Other metal ions and EDTA have reduced the vigor of low-temperature lipase.

Embodiment 4: low-temperature lipase Lip1 hydrolysis longer chain fatty acid (take sweet oil as substrate) experiment

By recombinant bacterial strain positive colony BL21-pET-Lip1 line activation, picking mono-clonal is in LB+ sweet oil solid plate (adding sweet oil emulsion to final concentration in LB solid medium is 8%(V/V)) upper point sample, four samples of each dull and stereotyped upper point, in 16 ℃ of constant incubators, cultivate 48h, observe colony edge hydrolysis circle formational situation.The results are shown in Figure 13, as seen from the figure BL21-pET- lip1on flat board, formation is significantly hydrolyzed circle, illustrates that the low-temperature lipase Lip1 of the recombinant bacterial strain generation that contains low-temperature lipase gene can be hydrolyzed longer chain fatty acid, can be used for the hydrolysis of long chain fatty acid ester in catalysis.

sequence table

<110> Kunming University of Science and Technology

<120> low-temperature lipase lip1and gene and application

<160> 4

<170> PatentIn version 3.3

<210> 1

<211> 885

<212> DNA

<213> Yersinia enterocoliticaKM1

<400> 1

atgtctacaa attcaacttt gaaatatcca gtcgtattag ttcatggctt acttggattc 60

gacaaaatcg caggggttta cccttatttt tatggtgtcg aagaaccgct aaaaaaagcg 120

ggcgcacaag tctttatcgc cacaatttcc gccaccaaca gtaatgaagt acgcggcgag 180

caattactta aatttgtcaa agaagtcatg gcaaaaacgg gggcgaaaaa agttaacctt 240

attggtcata gtcaggggcc tttggcatgt cgttatgttg ctgcaacgca tcctgaactt 300

atagcgtctg tgacctcggt taatggggtt aaccatgggt cggaaattgc cgatttagtt 360

cgctcagcgc tggtgcctgg tagtcttccg gaacatattg ttaatactat catgtcggca 420

ttcggtgtat ttgtttctct gctaagtggt aagccattcc tgccgcagga ttttatggag 480

tctattgatg cactgacgac cgagaatgtg gctaagttta ataccaaata tcctcagggg 540

ttacctgaaa cctggggagg tgaggggaaa gagtttgata atggagtcta ctattattca 600

tgggggggcg ttctgggtta taacccactg actgaaggat tgaacaacct cgatccgctg 660

caccattcat tggttgcctt atcactcttg ttcaccaaag aacgtaatca aaatgatggt 720

ctggtcggac gttacagtat gcacttaggg aaagttatcc gttcggatta tcagttagac 780

catgtggatg cgattaatca gaccgcgggt atggttagca aggacattga cccagttcaa 840

ttgtttgtaa atcagattga gttgttgaaa tcaaaaggcc tgtaa 885

<210> 2

<211> 294

<212> PRT

<213> Yersinia enterocoliticaKM1

<400> 2

MET Ser Thr Asn Ser Thr Leu Lys Tyr Pro Val Val Leu Val His Gly

1 5 10 15

Leu Leu Gly Phe Asp Lys Ile Ala Gly Val Tyr Pro Tyr Phe Tyr Gly

20 25 30

Val Glu Glu Pro Leu Lys Lys Ala Gly Ala Gln Val Phe Ile Ala Thr

35 40 45

Ile Ser Ala Thr Asn Ser Asn Glu Val Arg Gly Glu Gln Leu Leu Lys

50 55 60

Phe Val Lys Glu Val MET Ala Lys Thr Gly Ala Lys Lys Val Asn Leu

65 70 75 80

Ile Gly His Ser Gln Gly Pro Leu Ala Cys Arg Tyr Val Ala Ala Thr

85 90 95

His Pro Glu Leu Ile Ala Ser Val Thr Ser Val Asn Gly Val Asn His

100 105 110

Gly Ser Glu Ile Ala Asp Leu Val Arg Ser Ala Leu Val Pro Gly Ser

115 120 125

Leu Pro Glu His Ile Val Asn Thr Ile MET Ser Ala Phe Gly Val Phe

130 135 140

Val Ser Leu Leu Ser Gly Lys Pro Phe Leu Pro Gln Asp Phe MET Glu

145 150 155 160

Ser Ile Asp Ala Leu Thr Thr Glu Asn Val Ala Lys Phe Asn Thr Lys

165 170 175

Tyr Pro Gln Gly Leu Pro Glu Thr Trp Gly Gly Glu Gly Lys Glu Phe

180 185 190

Asp Asn Gly Val Tyr Tyr Tyr Ser Trp Gly Gly Val Leu Gly Tyr Asn

195 200 205

Pro Leu Thr Glu Gly Leu Asn Asn Leu Asp Pro Leu His His Ser Leu

210 215 220

Val Ala Leu Ser Leu Leu Phe Thr Lys Glu Arg Asn Gln Asn Asp Gly

225 230 235 240

Leu Val Gly Arg Tyr Ser MET His Leu Gly Lys Val Ile Arg Ser Asp

245 250 255

Tyr Gln Leu Asp His Val Asp Ala Ile Asn Gln Thr Ala Gly MET Val

260 265 270

Ser Lys Asp Ile Asp Pro Val Gln Leu Phe Val Asn Gln Ile Glu Leu

275 280 285

Leu Lys Ser Lys Gly Leu

290 294

<210> 3

<211> 54

<212> DNA

<213> artificial sequence

<400> 3

gggtttcata tgatgtctac aaattcaact ttgaaatatc cagtcgtatt agtt 54

<210> 4

<211> 27

<212> DNA

<213> artificial sequence

<400> 4

ccggaattct tacaggcctt ttgattt 27

Claims (6)

1. a low-temperature lipase Lip1, is characterized in that: the aminoacid sequence of described low-temperature lipase Lip1 is as shown in SEQ ID NO:2.

2. the gene of low-temperature lipase Lip1 described in the claim 1 of encoding.

3. low-temperature lipase Lip1 gene according to claim 2, is characterized in that: nucleotide sequence is as shown in SEQ ID NO:1.

4. the expression vector that contains low-temperature lipase Lip1 gene described in claim 2.

5. the application of the expression vector of low-temperature lipase Lip1 gene in preparing low-temperature lipase Lip1 described in claim 4.

6. the application of low-temperature lipase Lip1 claimed in claim 1 in middle long chain fatty acid ester catalysis.