CN103159857A - Compound based on recombinational triple helix support - Google Patents

Abstract

The invention discloses a protein compound which comprises a curly fused polypeptide chain and the curly fused polypeptide chain can from a triple helix. Each chain is provided with a support area and a heterologous area. The invention further discloses a relative separated fused polypeptide, nucleic acid, a carrier, host cells and a preparation method.

Description

The triple helix support of recombinating of take is basic mixture

The application is the Chinese invention patent application (applying date: on May 21st, 2007 that application number is 200710104159.8; Denomination of invention: take the restructuring the triple helix support be basic mixture) divide an application.

Technical field

The present invention relates to the to there is support protein complex (protein complex) of (scaffold), and be particularly related to the protein complex of (triple-helix) support that has triple helix, it can be used for the purposes of antitumor, infectious diseases and immunomodulatory (immunomodulatory).

Background technology

Binding reagents based on protein serves many purposes on treatment or diagnostic use.Antibody is exactly a splendid example; many monoclonal antibodies (mAbs) (hereinafter to be referred as mAbs) have been successfully used to treat cancer, infectious diseases and inflammatory diseases (inflammatory diseases) (Adams et al., Nat.Biotechnol.2005Sep; 23 (9): 1147-57.).

By recombinant DNA technology, comprise chimericization (chimerization) and humanization (humanization), strengthened effect and the security of murine mAbs.Yet use CDR (complementary determining region, hereinafter to be referred as CDR) to transplant while carrying out murine mAbs humanization, usually make its binding affinity lower than murine counterpart (counterpart).The avidity of antibody is the key factor of antibody as the therapeutical agent success or not.Antibody with high-affinity can make antibody and natural part effectively compete to reduce dosage, toxicity and cost to receptor targeted.Avidity also affects the pharmacokinetics of antibody, for example distribution and the secretion within target tissue and host's circulation.Effectively the prerequisite of monoclonal antibody is that targeting antigen is had strong avidity and irrelevant protein is not had to nonspecific combination in vivo.The multimerization of antigen binding site (multimerization) has been proved to be the effective means that increases the bulk strength that antibody is combined with antigen; the bulk strength that wherein antibody is combined with antigen is defined as affinity of antibody (antibody avidity) (functional affinity (functional affinity)) (Miller et al.; JImmunol170:4854-4861,2003; Rheinnecker etal., J Immunol157:2989-2997,1996; Shopes, J Immunol148:2918-2922,1992; Shuford et al., Science252:724-727,1991; Wolff et al., J Immunol148:2469-2474,1992).They have anti-tumor activity (Liu etal., Int Immunopharmacol6:791-799,2006 of enhancing in vivo; Wolff et al., Cancer Res53:2560-2565,1993).Due to the divalence character of immunoglobulin G (IgG) (hereinafter to be referred as IgG) molecular structure, IgG commonly used and the process transformation can not be used in conjunction with simultaneously in conjunction with plural not synantigen.Therefore need the protein bonding reagent of multivalence or polyspecific (multi-specific).

In some instances, in order to reduce mitogenesis side effect (mitogenicity side-effect), need to avoid effector function (effector function) by transformation Fc district, for example depend on cell-mediated cytotoxicity (the antibody-dependent cell-mediated cytotoxicity of antibody, ADCC) and the cytotoxicity (complement dependent cytotoxicity, CDC) that depends on complement.For example, murine Anti-Human class CD3 monoclonal antibody (positive pure line (Orthoclone) OKT3, Muromondb-CD3 (Muromonab-CD3)) is as the strong immunosuppression reagent that T-cell receptors/the CD3 mixture is target of take on human T cells.It is used for preventing or existing (Cosimi et al., N Engl J Med305:308-314,1981 of vicennial time for the treatment of allograft rejection (allograft rejection); Group, N Engl J Med313:337-342,1985; Kung et al., Science206:347-349,1979).Yet a main drawback that carries out this treatment is cytokine; for example the whole body of TNF-α, IL-2 and IFN-γ discharges; it causes a series of harmful mitogenesis effects (mitogenic effects); comprise cold like symptoms (flu-like symptoms), respiratory distress (respiratory distress), nervous symptoms (neurological symptoms) and acute tubular necrosis (acute tubular necrosis) (Abramowicz et al.; Transplantation47:606-608,1989; Chatenoud et al., N Engl J Med320:1420-1421,1989; Goldman etal., Transplantation50:158-159,1990; Toussaint et al., Transplantation48:524-526,1989).Because the mitogenesis effect of OKT3 and other anti-CD3mAbs depends on for example, with cell (FcR-positive cell) (monocyte) with the Fc acceptor thereby in conjunction with TCR/CD3 crosslinked (cross-linking) widely occurs, therefore there is recently much research all to wish the combination with FcR by change, develop the non-mitogenic action mode (nonmitogenic forms) of anti-CD 3 antibodies.From above explanation, need at present a kind of protein bonding reagent with high stability in high-affinity, low mitogenesis effect and body badly.

Summary of the invention

The invention provides there is high-affinity, high stability take protein complex as basic binding reagents (protein complex-based binding reagent) in low Mitosis and body.Reagent of the present invention also can be (multi-specific) of multivalence (multi-valenyt) or polyspecific.

On the one hand, the present invention relates to the recombinant protein mixture separated, it comprises the first fusion polypeptide chain, comprise the first heterology (heterologous) district, the second fusion polypeptide chain that in the first rack area and this first rack area one end frame, (in-frame) merges, comprise the second rack area, and the 3rd fusion polypeptide chain, comprise the 3rd rack area.It is curling to form triple helix that above-mentioned first, second and the 3rd rack area are compared mutually (align).And above-mentioned the first stent area is with the first heterology district frame endomixis and on identical polypeptide chain.

Above-mentioned heterology district can comprise the sequence of enzymatic structural domain or fluorescence protein.The example of fluorescence protein comprises GFP and dsRed and variant (variant) thereof.The example of enzymatic structural domain comprises glutathione S-transferase (glutathione S-transferase), luciferase (luciferase), beta-galactosidase enzymes (β-galactosidase) and β-lactamase (β-lactamase).

Above-mentioned heterology district can comprise the land (for example, part (ligand) land, part, acceptor, affinity tag or proteoglycan) with binding partners (binding partner) combination.The part (for example, protein) that " binding partners " means for interested target compound has any molecule specific, affinity covalently or non-covalently.The example of binding partners (for example comprises antigen/antibody counterpart, protein/inhibition counterpart, receptor/ligand counterpart, cell surface or nuclear receptor/part counterpart), enzyme/substrate counterpart (for example, kinases (kinase)/substrate counterpart), lectin (lectin)/carbohydrate (carbohydrate) counterpart, (oligomeric) or (heterooligomeric) protein counterpart of oligomeric of oligomerization, counterpart and the RNA/ protein counterpart of DBP/DNA binding site.The example of land also comprises the sequence of affinity tag, for example, and Histidine-marker (histidine-tag), myc marker (myc tag) or hemagglutinin marker (hemagglutin tag).

Above-mentioned the first heterology district can comprise one or more CDR of immunoglobulin (Ig).Therefore the heterology district can comprise the antigen-binding portion thereof of antibody, for example V _hdistrict and Fab.The sequence that the first heterology district comprises Fab or single-chain antibody in an embodiment, for example, to bunch name 3 (Cluster Designation 3, CD3) (hereinafter to be referred as CD3) or EGF-R ELISA (Epidermal Growth Factor Receptor, EGFR) (hereinafter to be referred as EGFR) special sequence.Above-mentioned the first polypeptide chain also can comprise the second heterology district with above-mentioned the first rack area the other end frame endomixis.As above-mentioned the first rack area, the second heterology district also can comprise the land with binding partner binds.The first and second heterology districts can be same to each other or different to each other.They can be different from identical binding partners or two binding partner binds.For example, the first heterology district and the second heterology district can comprise respectively the sequence of the first single-chain antibody and the second single-chain antibody, above-mentioned two antibody respectively with CD3 and EGFR specific binding.

In above-mentioned protein complex, the second fusion polypeptide chain can comprise with the 4th heterology district of the 3rd heterology district of above-mentioned the second rack area one end frame endomixis, frame endomixis to the second rack area the other end or frame endomixis to Liang Ge district, these two ends.Similarly, aforementioned the 3rd fusion polypeptide chain can comprise the 5th heterology district of frame endomixis to the three rack area one ends or frame endomixis to the three rack area the other ends the 6th heterology district or both.As above-mentioned the first and second heterology districts, each in other four heterology districts all can comprise the land with binding partner binds.Whole six heterology districts can be same to each other or different to each other.Therefore they can with 1,2,3,4,5 or 6 binding partner binds.In other words, this protein complex can be one, two, three, four, five or sexavalence.

Curling in order to allow first, second and the 3rd rack area form triple helix, each of three rack areas all comprises one or more triple helix tumor-necrosis factor glycoproteinss, the sequence that each tumor-necrosis factor glycoproteins comprises following formula: (X1-X2-X3) n, wherein X1 is glycine (Gly) residue, X2 or X3 are any amino-acid residues, are preferably imino-acid proline(Pro) or oxyproline (hydroxproline); And n is more than or equal to 5.For example, first, second or the 3rd rack area can comprise (GPP) ₁₀or one or more triple helix tumor-necrosis factor glycoproteinss of human complement C1q, collectin (collectin) or collagen polypeptide chain.

In an embodiment, aforementioned first, second is substantially the same with the 3rd fusion polypeptide, has each other the sequence identity of at least 75% (for example any quantity between 75% and 100%, comprise 75% and 100%).The mixture formed by three identical fusion polypeptide is homotrimer (homotrimer).Above-mentioned three fusion polypeptide can be " function equivalent (functional equivalent) "." function equivalent " means the polypeptide derivative of common polypeptide, for example, protein, its fusion rotein or above-mentioned combination with one or more point mutation, insertion (insertion), disappearance (deletion), brachymemma (truncation), and it keeps forming the ability of triple helix and the activity in heterology district basically, for example, with ligand binding.

Heterology polypeptide, nucleic acid or gene can be derived from different plant species, even or they from same species, they are also from the modification basic in initial formal process.Two corresponding circle of sensation or sequence are allos each other, even they do not interconnect yet in naturally occurring protein or nucleic acid.The peptide sequence that is not for example the mini collagen protein of the naturally occurring mankind (minicollagen) (XXI type), collectin family protein or complement 1q (C1q) part is allos for human protein's Qu Eryan.

Another characteristic of the present invention is the recombinant fusion polypeptide separated, it comprise (i) be used for forming rack area that triple helix is curling and (ii) the frame endomixis to the first heterology district of above-mentioned rack area one end or the frame endomixis to the second heterology district of the above-mentioned rack area the other end.Described rack area can comprise one or more aforementioned triple helix tumor-necrosis factor glycoproteinss, for example tumor-necrosis factor glycoproteins of mankind C1q or collagen polypeptide chain.The heterology district can comprise one of above-mentioned land and can by many methods known in the art for example phage display screening (phage display screening) obtain.

Isolated polypeptide or protein complex mean essentially no naturally relevant molecule, and polypeptide or the protein complex of the purity of at least 75% (any quantity between 75% and 100%, comprise 75% and 100%) arranged by the dry weight basis calculator.Purity can be with any suitable standard method, for example by the analyses of column chromatography (column chromatography), polyacrylamide gel electrophoresis (polyacrylamide gel electrophoresis) or high performance liquid chromatography (high performance liquid chromatography, HPLC), measure.Isolated polypeptide of the present invention or protein complex can be separated or be manufactured by recombinant DNA technology by natural source.

The present invention also relates to the nucleic acid separated, the complementary sequence of sequence or this sequence that the nucleic acid of this separation comprises the fusion polypeptide mentioned above of encoding.Nucleic acid refers to the analogue of DNA molecular (for example cDNA or genomic dna), RNA molecule (for example mRNA) or DNA or RNA.The analogue of DNA or RNA can be synthetic by nucleotide analog.This nucleic acid molecule can be strand or two strands, but preferred double-stranded DNA.

" nucleic acid of separation " is the nucleic acid that structure is not identical with any naturally occurring nucleic acid or any naturally occurring genomic nucleic acids fragment.Therefore this term comprises, (a) DNA for example, it has a part of sequence of naturally occurring genomic dna molecule, but not with the natural encoding sequence adjacency that is present in its both sides in the genome of organism; (b) nucleic acid, it is introduced in carrier (vector) or prokaryotic cell prokaryocyte or eukaryotic genome in some way, and formed molecule is not identical with any naturally occurring carrier or genomic dna thus; (c) molecule separated, for example cDNA, genomic fragment, the fragment or the restriction fragment (restriction fragment) that by polymerase chain reaction (polymerase chain reaction, PCR), produce; (d) recombinant nucleotide sequence, its part that is heterozygous genes (being the gene of encoding fusion protein matter).Above-mentioned nucleic acid can be used to express polypeptide of the present invention.For this purpose, above-mentioned nucleic acid can be connected to applicable regulating and controlling sequence to produce expression vector.

Carrier refers to nucleic acid molecule, and it has the ability of another nucleic acid being transferred to its junction.The autonomy that has carrier copies (autonomous replication) or is integrated into the ability of host DNA.The example of carrier comprises plasmid (plasimd), phagemid (cosmid) or virus vector.Carrier of the present invention comprises nucleic acid, and it is the form be suitable at this nucleic acid of host cell inner expression.Preferred described carrier comprises the one or more regulating and controlling sequences that are operatively connected with nucleotide sequence to be expressed, its." regulating and controlling sequence " comprises promotor (promoter), enhanser (enhancer) and other expression controlling elements (for example polyadenylation signal (polyadenylation signal)).Regulating and controlling sequence comprises constitutive expression and tissue specificity regulation and control and/or the derivable sequence that those instruct nucleotide sequence.Can be according to following factors to the design of expression vector, the degree of expressing as the selection to transfected host cell, desired protein and like that.Expression vector can be introduced to host cell to manufacture polypeptide of the present invention.The host cell that comprises above-mentioned nucleic acid also within the scope of the present invention.Example comprises intestinal bacteria (E.coli) cell, insect cell (for example using fruit bat (Drosophila) S2 cell or baculovirus (baculovirus) cell), yeast cell or mammalian cell (for example mouse myeloma (myeloma) NS0 cell).Refer to Goeddel for example, (1990) Gene Expression Technology:Methods in Enzymology185, Academic Press, San Diego, CA.

In order to manufacture fusion polypeptide of the present invention, cultivate host cell under certain condition to express the coded polypeptide of nucleic acid of the present invention in substratum, and from the substratum by cultured cells or this cell the purifying aforementioned polypeptides.Perhaps, can transcribe in vitro and translate nucleic acid of the present invention, for example using T7 promoter regulation sequence and T7 polysaccharase.

In order to manufacture protein complex of the present invention, but cultivate the host cell of first, second and the 3rd nucleic acid comprise encode respectively above-mentioned first, second and the 3rd fusion polypeptide under certain condition, curling to express the coded polypeptide of above-mentioned three nucleic acid and form triple helix between expressed polypeptide, and from the substratum of cultured cells or this cell the above-mentioned protein complex of purifying.Preferred above-mentioned host cell is eukaryotic cell (eukaryotic cell), and it comprises the enzymic activity that makes proline residue hydroxylation (hydroxylate).

For above-mentioned purpose, feature and the advantage with other of the present invention can be become apparent, preferred embodiment cited below particularly, and coordinate appended diagram, be described in detail below:

The accompanying drawing summary

Fig. 1 shows protein complex, and it has the mini collagen protein triple helix crimped stent from mankind XXI collagen type.Curling six ends of triple helix frame endomixis to six respectively have the V of single-chain antibody (scFv) _lwith V _hthe Fv fragment district in district.

Fig. 2 A shows the protein complex with triple helix crimped stent, its three N-terminal respectively with three single-chain antibody: OKT3 (anti-CD3), 528 (anti-EGFRs) and erb_scFv (anti-EGFR) frame endomixis, and 2B figure shows the photo of the Western trace of this protein complex.The substratum of the Drosophila S 2 cells of stable transfection is carried out under non-reduced state to the SDS-PAGE electrophoresis, make immunoblotting with the monoclonal antibody of anti-XXI collagen type (3E2) C-terminal afterwards.T: cystine linkage trisome between key; Mt: the monomer that comprises cystine linkage trisome between key.

Fig. 3 shows the protein complex with triple helix crimped stent.Three N-terminal and three OKT3 single-chain antibody frame endomixis of above-mentioned triple helix crimped stent; Three C-terminal and three 528 single-chain antibody frame endomixis.

Fig. 4 A and 4B show the schematic diagram of multi-form antibody: Fig. 4 A shows collagen scaffold antibody: scFv-Col (left figure), it comprises N-terminal scFv, IgG hinge (hinge) district, collagen protein district (GPP) ₁₀with XXI collagen type C-terminal NCl district; NSPD-scFv (right figure), it comprises Surfactant proteinD (surfactant protein D, SPD), at collectin and the scFv of C-terminal.Fig. 4 B shows respectively immunoglobulin G (IgG), chimeric (scFv-Fc) and single-chain antibody (scFv) by left-to-right, and their roughly molecular weight separately.Grey area shows V _hwith V _lfragment; Dotted line: interchain disulfide bond.

The primary clustering nomenclature

101～mini collagen protein

401～hinge area

403～(GPP) 10 collagen protein district

The land of 405～collagen protein XXI Xing NC1 district or other target

The N petiolarea of 407～collectin

The collagen-like of 409～collectin (collagen-like) district

The α spiral neck area of 411～collectin

Embodiment

The present invention finds because (at least a portion) is unexpected to have retained in conjunction with active with the heterologous protein calmodulin binding domain CaM of mankind's triple helix crimped stent regional frame endomixis, and gained fusion polypeptide to have formed triple helix curling.Fig. 1 has shown the example of protein complex of the present invention.As shown in the drawing, six ends of triple helix crimp protein mixture respectively with the land of six heterologous proteins, i.e. the Fv fragment frame endomixis of single-chain antibody (scFv).

Protein complex of the present invention antibody commonly used has many advantages.On the one hand, when above-mentioned Liu Ge district two or more mutually the same, protein complex for example can have 2-6, to the special land of binding partners (antigen), and antibody commonly used only has two this districts.In other words, unlike antibody commonly used, for antigen, only have divalence, this protein complex can be two, three, four, five or sexavalence.Thereby, it can be fabricated to and there is the various avidity higher than antibody commonly used.Because higher avidity, so compared with antibody commonly used, it needs the protein complex of small amount to reach the target that the shorter reaction times reaches expectation than antibody commonly used, curative effect (therapeutic effects) for example, reduce thus treatment cost and reduce side effect (for example, unexpected immune response).On the other hand, when above-mentioned Liu Ge district two or more mutual different, protein complex of the present invention can have 2-6 to 2-6 the special land of different binding partners.Not homospecific binding partners is combined into to a unit, therefore there is the ability that multiple binding partners is gathered together, be used in treatment, reconstructed tissue (tissue reconstruction) and for example, there is gratifying application at the fit on of the active protein structure (active protein machinery) (many subunits enzyme) of nanometer level.

In order to use in human body, protein complex of the present invention is preferably people source (human origin).For example, it can comprise the Humanized single chain antibody sequence, and the helix-coil support in this sequence and people source, as the helix-coil stand frame endomixis of mankind C1q, collectin family protein or collagen polypeptide chain.Because mankind C1q and collagen protein are all highly stable in blood, so this protein complex is more stable compared with general treatment type mouse source antibody.

Collagen protein is the protein of the maximum that exists in mammal, the extracellular matrix protein (extracellular matrix protein) of its sequence glycine (Gly) that is the triplet that comprises repetition-X1-X2, the appearance of this triplet allows three collagen polypeptide chains (α-chain) to be folded into the triple helix conformation.In the sequence glycine-X1-X2 of triplet, the amino acid of X2 position is often proline(Pro), in order to stablize the triple helix structure of collagen protein, often passes through the posttranslational modification of collagen polypeptide chain by proline-4-hydroxylation (hydroxylated).Lack the proline(Pro) hydroxylation; the essential triple helix conformation of collagen protein is heat-labile (thermally unstable) (Berg and Prockop lower than physiological temp (physiological temperature) time; Biochem Biophys Res Commun52:115-120,1973; Rosenbloom et al., Arch Biochem Biophys158:478-484,1973).The much collagen-like protein matter with collagen protein triple helix district (collagenous domain) comes across in serum human, plays the part of the role of innate immune system (innate immune system) on the protection infectious organisms.These comprise complement protein C1q, collectin family protein-mannose binding lectin (mannose binding lectin, MBL), surfactant protein (surfactant protein) A and D (SP-A and SP-D).And multimerization (multimeric) protein subunit (unit) that the common constitutional features of these collagen-like protein matter forms for the triple helix set by the collagen protein district, and the tripolymer molecule is heaped mutually or interchain forms disulfide bond crosslinking.Therefore, the functional affinity of the land of these " defence collagen protein " molecules increases considerably by multimerization (multimerization).

Protein complex of the present invention or polypeptide can obtain by recombinant technology.The nucleic acid of the polypeptide of this mixture of coding can be introduced in the appropriate host cell, and be expressed the polypeptide by the aforementioned nucleic acid coding under certain condition, curling to allow expressing this polypeptide and form triple helix between polypeptide.In order to promote the formation of triple helix crimped stent, can be in host cell coexpression (co-express) prolyl 4 hydroxylase (prolyl4-hydroxylase, P4HA), it is the key enzyme in the biosynthesizing of collagen protein.

The structural domain of heterologous protein can comprise antibody or its fragment (for example its Fab).Use herein " antibody " to mean immunoglobulin molecules or its immunocompetence part, i.e. antigen-binding portion thereof.It refers to comprise minimum preferred two weights (heavy, H) chain variable region (V _h), and at least one preferred two light (light, L) chain variable region (V _l) protein.Can be by V _hand V _ldistrict further is subdivided into hypervariable region and more conservative dispersion zone, and the former is called " complementary determining region (complementarity determining region) " " (CDR) " district, and the latter is called framework region (framework region).The scope that has clearly defined complementary determining region and framework region (is consulted Kabat et al. (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S.Department of Health and Human Services, NIH Publication No.91-3242, and Chothia et al. (1987) J.Mol.Biol.196:901-917).Each V _hand V _lformed putting in order as FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4 from the N-terminal to the C-terminal by three CDR and four FR.

Antibody also can comprise the constant region (constant region) of heavy chain and light chain, forms respectively thus the immunoglobulin chain of heavy chain and light chain.CH comprises three domain C H1, CH2 and CH3.Constant region of light chain comprises domain C L.The variable region of heavy chain and light chain comprises and antigen reactive land.The common mediate antibody of the constant region of antibody and host tissue or the factor, comprise the combination of the first component C1q of immune various kinds of cell (for example effector cell (effector cell)) and classical complement system.

" immunoglobulin (Ig) " used herein refers to the protein that is formed, basically encoded by immunoglobulin gene by one or more polypeptide.Known human immunoglobulin gene comprises κ, λ, α (IgA1 and IgA2), γ (IgG1, IgG2, IgG3 and IgG4), δ and the constant region gene of μ and countless immune globulin variable region genes." light chain " of total length immunoglobulin (Ig) (about 25KDa or 214 amino acid) is by NH ₂the variable region gene of end (approximately 110 amino acid) and encoding at κ or the λ constant region gene of COOH end.And " heavy chain " of total length immunoglobulin (Ig) (about 50KDa or 446 amino acid) reach other above-mentioned constant region gene similarly by variable region gene (approximately 116 amino acid), for example γ (approximately 330 amino acid of encoding) encodes.

" Fab " of antibody (or " antibody moiety " or " fragment ") refers to one or more fragments of full length antibody, and it retains for example, ability to antigen (EGFR or CD3 polypeptide or its fragment) of specific binding.The Fab of antibody includes, but are not limited to: (i) Fab fragment, and by V _l, V _h, C _land C _h1the unit price fragment that structural domain forms; (ii) F (ab ') ₂fragment, comprise and linked the divalence fragment of two Fab fragments by disulfide linkage at its hinge area (hinge region); (iii) by V _hand C _h1the Fd fragment that structural domain forms; (iv) by the V of antibody single armed (single arm) _land V _hthe Fv fragment that structural domain forms; (v) dAb fragment (Ward et al., (1989) Nature341:544-546), it comprises V _hstructural domain; (vi) complementary determining region (CDR) of separation and (vii) V _lor V _hstructural domain.Further, although two structural domain V of Fv fragment _land V _hbe by genes encoding separately, but use recombination method they can be connected, by manual splice, they can be prepared into to single chain protein matter, wherein V _lwith V _hdistrict's pairing forms monovalent molecule and (is called scFv (scFv), consults, for example Bird et al. (1988) Science242:423-426; And Huston et al. (1988) Proc.Natl.Acad.Sci.USA85:5879-5883).This kind of single-chain antibody is also included within " Fab " scope of antibody.These antibody fragments can use the common technology of the art to obtain, and screen application in the mode with identical to complete antibody.

Suitable antibody can be monoclonal antibody.In other embodiments, the antibody preparation of can recombinating, for example prepared by phage display or combined method (combinatorial method).Produce the phage display of antibody and combined method and be and known in the artly (consult Ladner et al.U.S.Patent No.5 for example, 223,409; Kang etal.International Publication No.WO92/18619; Dower et al.International Publication No.WO91/17271; Winter et al.International Publication WO92/20791; Markland et al.International Publication No.WO92/15679; Breitling et al.International Publication WO93/01288; McCafferty et al.International Publication No.WO92/01047; Garrard et al.International Publication No.WO92/09690; Ladner et al.International Publication No.WO90/02809; Fuchs et al. (1991) Bio/Technology9:1370-1372; Hay et al. (1992) Hum Antibod Hybridomas3:81-85; Huse et al. (1989) Science246:1275-1281; Griffths etal. (1993) EMBO J12:725-734; Hawkins et al. (1992) J Mol Biol226:889-896; Clackson et al. (1991) Nature352:624-628; Gram et al. (1992) PNAS89:3576-3580; Garrad et al. (1991) Bio/Technology9:1373-1377; Hoogenboom et al. (1991) Nuc Acid Res19:4133-4137; With Barbas et al. (1991) PNAS88:7978-7982).

In one embodiment, antibody be complete human antibodies (for example, the antibody of manufacturing in mouse, this mouse is through the genetic engineering modified antibody that is derived from human immunoglobulin sequence of manufacturing) or non-human antibody, for example antibody of rodent (mouse or rat), goat, primate (for example monkey), camel (cameloid).The non-human antibody is preferably the antibody of rodent (mouse or rat).The method of manufacturing rodent antibody has been that the art is known.

The transgenic mice that can carry human immunoglobulin gene by use is manufactured the human monoclonal antibody, rather than uses the system of mouse.Use the splenocyte (splenocytes) of these transgenic mices of interested antigen immune to be used to manufacture hybridoma (hybridoma); the mankind mAbs that its secretion has specificity avidity to human protein's epi-position (epitope) (consults; Wood et al.International Application WO91/00906 for example, Kucherlapati et al.PCT publication WO91/10741; Lonberg et al.International Application WO92/03918; Kay et al.International Application92/03917; Lonberg, N.et al.1994Nature368:856-859; Green, L.L.et al.1994Nature Genet.7:13-21; Morrison et al.1994Proc.Natl.Acad.Sci.USA81:6851-6855; Bruggeman et al.1993Year Immunol7:33-40; Tuaillon et al.1993PNAS90:3720-3724; Bruggeman et al.1991Eur J Immunol21:1323-1326).

The region of variability of antibody or its part, for example CDR can for example, produce in non-human organism (, rat or mouse).Can use chimeric, CDR is that transplant and humanized antibody.For example be included in the present invention, in non-human organism (, rat or mouse) and produce and pass through the antibody of modification (for example, in variable framework (variable framework) or constant region) with the antigenicity (antigenicity) that is reduced in the mankind.

The known recombinant DNA technology in useful the technology of the present invention field is manufactured chimeric antibody (chimeric antibody).For example with Restriction Enzyme, digest the Fc constant region gene of the monoclonal antibody molecule of coding mouse (or other species); the zone of coding mouse Fc is removed; then the part that is equal to that is substituted by the gene of coding human Fc constant region (is shown in; Robinson et al., International Patent Publication PCT/US86/02269; Akira, et al., European Patent Application184,187; Taniguchi, M., European Patent Application171,496; Morrison et al., European Patent Application173,494; Neuberger et al., International Application WO86/01533; Cabilly et al.U.S.Patent No.4,816,567; Cabilly etal., European Patent Application125,023; Better et al. (1988Science240:1041-1043); Liu et al. (1987) PNAS84:3439-3443; Liu et al., 1987, J.Immunol.139:3521-3526; Sun et al. (1987) PNAS84:214-218; Nishimura et al., 1987, Canc.Res.47:999-1005; Wood et al.et al (1985) Nature314:446-449; And Shaw et al., 1988, J.Natl Cancer Inst.80:1553-1559).

In the antibody that humanization or CDR transplant (weight of immunoglobulin (Ig) or light chain) at least one or two but be generally whole three recipients (recipient) CDR and replaced by donor CDR.Antibody can be replaced or only have some in CDR to be replaced by inhuman CDR by least a portion of non-human CDR.Only need to replace the CDR in conjunction with humanized antibody or humanized antibody fragment desired number.Preferred donor is rodent antibody, for example antibody of rat or mouse, and recipient behave class framework (framework) or the total framework (consensus framework) of the mankind.Generally speaking, provide the immunoglobulin (Ig) of CDR to be called " donor " and provide the immunoglobulin (Ig) of framework to be called " recipient (acceptor) ".In one embodiment, the donor immunoglobulin (Ig) is non-human (for example rat).Recipient's framework is natural existence the (for example mankind) or total framework, or has an appointment 85% or higher, preferably 90%, 95%, 99% or the sequence of higher identity." consensus sequence (consensus sequence) " as used herein refers to that in the family of correlated series the formed sequence of amino acid (or Nucleotide) the most often occurred (consults, Winnaker for example, From Genes to Clones (Verlagsgesellschaft, Weinheim, Germany1987).In protein families, the amino acid that each the position Bei Ci family in consensus sequence the most often occurs in that position is occupied.If the frequency of two amino acid appearance is identical, any in both all can be included in consensus sequence." total framework " refers to the framework region in total immunoglobulin sequences.

Can antibody be carried out to humanization by methods known in the art.Be the sequence that is equal to from mankind Fv variable region by replacing the Fv variable region sequences of not participating in the antigen combination directly, can produce humanized antibody.For generation of the common method of humanized antibody by Morrison, S.L., 1985, Science229:1202-1207, Oi etal., 1986, BioTechniques4:214, Queen et al.US5,585,089, US5,693,761 and US5,693,762 provide, and its content is incorporated herein by reference.Those methods comprise separation, manipulation and express nucleic acid sequence, and wherein said nucleic acid sequence encoding is from all or part of of the IgF v variable region of one of at least one heavy chain or light chain.The source of this kind of nucleic acid is being well-known in the art, and for example can from hybridoma, obtain, and wherein this hybridoma produces the antibody of anti-interested polypeptide or its fragment.Can clone (clone) recombinant DNA to suitable expression vector, wherein this recombinant DNA coding humanized antibody or its fragment.

Also humanized antibody can be merged to support, in humanized antibody, specific amino acid is substituted, lacks or increases.Preferred humanized antibody has aminoacid replacement in framework region, as in order to improve the combination with antigen.For example humanized antibody has the framework residue, and its framework residue or other amino acid except recipient's framework residue with donor is identical.In order to produce this kind of antibody, the Humanized immunoglobulin chain can be with corresponding donor aminoacid replacement through a small amount of receptor's framework residue of selecting.Preferred the position of substitution comprise be adjacent to CDR or can with the interactional amino-acid residue of CDR.From the amino acid whose standard to describe of donor selection in US5, in 585,089, its content is incorporated herein by reference.By other technical description of antibody humanization in Padlan et al.EP519596A1.

The present invention also comprises nucleic acid, and its coding forms the fusion polypeptide of protein complex of the present invention.Can filter out or separate (for example RT-PCR) nucleic acid from the cell strain of expressing above-mentioned applicable antibody or antibody derivatives from phage display library.Can be connected nucleic acid and expression vector are functional.Can use the cell through nucleic acid or carrier conversion (transformed) to prepare fusion polypeptide of the present invention or protein complex.Useful cell in order to Dispersal risk comprises insect cell and mammalian cell (for example, CHO or lymphocyte (lymphatic cell)).

Can be by protein complex of the present invention and medicable part (therapeutic moiety) combination, described medicable part is cytotoxin (cytotoxin), therapeutical agent (therapeutic agent) or isotopic ion (radioactive ion) for example.Cytotoxin or cytotoxic agent (cytotoxic agent) comprise any reagent harmful to cell, and example comprises taxol (taxol), cytochalasin B (cytochalasin B), Tyrothricin D (gramicidin D), ethidium bromide (ethidium bromide), Hemometine (emetine), mitomycin (mitomycin), Zuyeyidal (etoposide), teniposide (tenoposide), vincristine(VCR) (vincristine), vinealeucoblastine(VLB) (vinblastine), colchicine (colchicin), Zorubicin (doxorubicin), daunorubicin (daunorubicin), chinizarin (dihydroxy anthracin dione), mitoxantrone hydrochloride (mitoxantrone), mithramycin (mithramycin), dactinomycin (actinomycin D), 1-dehydrogenation testosterone (1-dehydrotestosterone), glucocorticoid (glucocorticoids), PROCAINE HCL, PHARMA GRADE (procaine), tetracaine (tetracaine), lignocaine (lidocaine), Proprasylyte (propranolol), tetracycline (puromycin), maytenin (maytansinoids), for example, maytansinol (maytansinol) (seeing US Patent No.5,208,020), CC-1065 (seeing US Patent Nos.5,475,092,5,585,499,5,846,545) and its analogue or homologue.Treatment reagent includes but not limited to, antimetabolite (antimetabolites) (for example, methotrexate (methotrexate), Ismipur (6-mercaptopurine), 6-Thioguanosine (6-thioguanine), cytosine arabinoside (cytarabine), 5 FU 5 fluorouracil decarbazine (5-fluorouracil decarbazine)), alkylating agent (alkylating agents) (for example, mustargen (mechlorethamine), Thiothal Chlorambucil (thioepa chlorambucil), CC-1065, melphalan (melphalan), carmustine (carmustine, BSNU) and lomustine (lomustine, CCNU), cyclothosphamide, busulfan (busulfan), mitobronitol (dibromomannitol), streptozotocin (streptozotocin), ametycin (mitomycin C) and Cis-DDP (cis-dichlorodiamine platinum (II) is cis-platinum (cisplatin) (DDP))), anthracycline (anthracyclines) (for example, daunorubicin (daunorubicin) (before being called daunomycin (daunomycin))), microbiotic (for example, gengshengmeisu (dactinomycin) (before being called actinomycin), bleomycin (bleomycin), mithramycin and anthramycin (anthramycin, AMC)) and antimitotic agent (anti-mitotic agents) (for example, vincristine(VCR)), vinealeucoblastine(VLB), taxol and maytenin.Isotopic ion includes but not limited to iodine (iodine), yttrium (yttrium) and praseodymium (praseodymium).

Can utilize conjugate (conjugate) to modify known biological respinse, drug moiety (drug moiety) should not be limited to chemotherapy agents commonly used.For example, drug moiety can be to have required bioactive protein or polypeptide.This protein can comprise, toxin for example, as abrin (abrin), ricin A (ricin A), Pseudomonas exotoxin (pseudomonas exotoxin) or diphtheria toxin (diphtheria toxin), protein, for example tumour necrosis factor (tumor necrosis factor), alpha-interferon ( -interferon), beta-interferon

-interferon), nerve growth factor (nerve growth factor), platelet-derived somatomedin (platelet derived growth factor), tissue plasminogen activator (tissue plasminogen activator), or biological response modifier (biological response modifier), for example, lymphokine (lymphokines), interleukin 1 (interleukin-1, " IL-1 "), interleukin II (interleukin-2, " IL-2 "), interleukin-6 (interleukin-6, " IL-6 "), granulocyte-macrophage colony stimutaing factor (granulocyte macrophage colony stimulating factor, " GM-CSF " '), granulocyte colony-stimulating factor (granulocyte colony stimulating factor, " G-CSF ") or other somatomedin.

Aforementioned protein and conjugate are according to the specificity of its heterology land, can be used to treat multiple disorder (disorder), comprise cancer, inflammatory diseases (inflammation disease), metabolic trouble (metabolism disease), fibrotic disease (brosis disease) and cardiovascular disorder (cardiovascular disease).Therefore the present invention be take and treated this kind of disorder as feature, for example, is administered to the experimenter who needs by the protein complex of the present invention significant quantity (effective amount).Can determine that the patient who is treated has take situation that disorder is feature or in this risk.This method can be carried out separately or be combined with other medicines or treatment.

Because protein complex of the present invention has the characteristics of polyspecific, can be connected to molecule or the cell generally do not interosculated with it.This feature is useful for the therapy based on cell (cell-based therapy) especially.In one embodiment, heterology district in protein complex by be positioned at effect antigen (effector antigen) specific binding on cytotoxic cell (cytotoxic cell) and can active cells toxic cell (for example cytotoxic T cell (cytotoxic T cell)), other heterology district specific binding to being positioned at the targeting antigen on destroyed pathogen cells (pathogen cell) or malignant cell (malignant cell).In this way, protein complex can be used to treat the disorder that substance due to illness or harmful cell cause.

Via protein complex of the present invention CD3 antigen of action effect antigen on the cytotoxin sexual cell, be combined, but the active cells toxic cell.The relevant effect antigen of other lymphoidocyte (lymphoid cell) comprises mankind CD16 antigen, NKG2D antigen, NKp46 antigen, CD2 antigen, CD28 antigen, CD25 antigen, CD64 antigen and CD89 antigen.Be combined meeting activating effect cell with these effect antigens, for example, monocyte (monocyte), neutrophilic granulocyte (neutrophilic granulocyte) and dendritic cell (dendritic cell).Can apply cytotoxicity or cells apoptosis (apoptotic effect) to targeted cells after these cells that are activated.

Targeting antigen is the antigen of expressing uniquely on the targeted cells relevant to the disease situation, but it is not in the situation that cell health is expressed or the expression degree is low or can not detect.The example of the targeting antigen that these are relevant to malignant cell comprises EpCAM, CCR5, CD19, HER-2neu, HER-3, HER-4, EGFR, PSMA, CEA, MUC-1 (mucoitin (mucin)), MUC2, MUC3, MUC4, MUC5.sub.AC, MUC5.sub.B, MUC7, .beta.hCG, Lewis-Y, CD20, CD33, CD30, ganglioside CD3 (ganglioside GD3), 9-O-acetyl-GD3, GM2, Globo H, fucosido GM1, Poly SA, GD2, carbonic anhydrase (Carboanhydrase IX (MN/CA IX)), CD44v6, Sonic Hedgehog (Shh), Wue-1, plasma cell antigen (Plasma Cell Antigen), film is in conjunction with (membrane-bound) IgE, melanoma sulfuric acid protein-polysaccharide (Melanoma Chondroitin Sulfate Proteoglycan (MCSP)), CCR8, TNF-α precursor, STEAP, mesothelin (mesothelin), A33 antigen, prostate gland sexual cell antigen (Prostate Stem Cell Antigen (PSCA)), Ly-6, desmoglein 4 (desmoglein4), the new epi-position of E-cadherin (E-cadherin neoepitope), fetus acetylcholine receptor (Fetal Acetylcholine Receptor), CD25, CA19-9 sign (marker), CA-125 sign and II type MIS acceptor (Muellerian Inhibitory Substance (MIS) Receptor type II), sTn (sialylated Tn antigen (sialylated Tn antigen, TAG-72)), FAP (fibroblast active antigen (fibroblast activation antigen)), endothelium saliva (liquid) acid albumin (endosialin), EGFRvIII, LG, SAS and CD63.

" treatment " is defined as composition is applied to the patient, and its purpose is the inducement (predisposition) of curing, alleviate, relax, treat, prevent or improving disorderly, disorderly symptom, be secondary to disorderly morbid state or susceptible disease." significant quantity " produces the amount of the composition of medical satisfactory result for the above-mentioned experimenter being treated for example.

Approach, for example, be applied to the experimenter by medicable composition (composition that, comprises protein complex of the present invention) in vivo.Generally speaking, mixture for example is suspended in, in pharmaceutically useful (pharmaceutically acceptable) carrier (carrier) (physiological saline), by it with oral, intravenously (intravenous) infusion, or subcutaneous (subcutaneous), intramuscular (intramuscular), subarachnoid space (intrathecal), intraperitoneal (intraperitoneal), internal rectum (intrarectal), intravaginal (intravaginal), in nose (intranasal), in stomach (intragastrical), the mode that in tracheae, in (intratracheal) or lung, (intrapulmonary) injects or implant is used.

Required dosage depends on selected route of administration; The character of preparaton; The character of experimenter's disease; Experimenter's build, body weight, surface-area, age and sex; The other medicines of using and attending doctor's decision.Suitable dosage range is at 0.01-100.0mg/kg.Variation based on existing composition (composition) and the viewpoint that multiple route of administration has different efficacies, the projected dose demand is multifarious.For example, expect Orally administered than intravenous injection use need to be higher dosage.As known as field of the present invention, the diversity that usable criterion experience program (standard empirical routines) is adjusted these dosage levels reaches best.For example, by composition is wrapped up to (encapsulate) in suitable carrier (vehicle) (poly particulate (polymeric microparticles) or implanted device (implantable devices)) commonly used, can improve the efficiency of transmission, particularly for oral transmission.

Scope of the present invention also comprises pharmaceutical compositions, the protein complex of the present invention that it comprises pharmaceutically useful carrier and significant quantity.Can treat above-mentioned disorder with this pharmaceutical compositions.Pharmaceutically useful carrier comprises that solvent, dispersion medium (dispersion medium), dressing (coating), antiseptic-germicide and anti-mycotic agent and isosmoticity agent absorb (absorption delaying) agent with delay.Can utilize common method that described composition is mixed with to the formulation (dosage form) for the different administration mode.

Can be in vivo and the effect of the in-vitro evaluation present composition.For research in vivo, Injectable composition arrives animal (for example, mouse model), and records afterwards its therapeutic efficiency.According to this result, can determine suitable dosage range and method of application.

The following examples are only for illustrative purposes, are never in order to disclose from of the present invention other of any angle limits.Without more details, can believe that those skilled in the art can, according to the disclosing of this paper, farthest implement the present invention.The publication of all references all is incorporated herein by reference in full.

Embodiment 1

M13 phage display library (phage display library) is screened to identify the mankind's single chain variable fragment (scFv) with the EGFR specific binding.Identify some clones (clone).After confirming by Western trace and enzyme immunoassay (Enzyme-linked immunoassay, ELISA) (hereinafter to be referred as ELISA), select a clone erb_scFv and do further experiment.Obtain the cDNA of coding erb_scFv, by standard method, be connected to expression vector.The peptide sequence of erb_scFv is recognition sequence number: 1 (SEQ ID NO:1), the nucleotides sequence of this sequence of encoding is classified recognition sequence number as: 2 (SEQ ID NO:2).

SEQ?ID?NO：1

MetAlaGluValGlnLeuLeuGluSerGlyGlyGlyLeuValGlnProGlyGlySerLeuArgLeuSerCysAlaAlaSerGlyPheThrPheSerSerTyrAlaMetSerTrpValArgGlnAlaProGlyLysGlyLeuGluTrpValSerAspIleGlyAlaSerGlySerAlaThrSerTyrAlaAspSerValLysGlyArgPheThrIleSerArgAspAsnSerLysAsnThrLeuTyrLeuGlnMetAsnSerLeuArgAlaGluAspThrAlaValTyrTyrCysAlaLysSerThrThrThrPheAspTyrTrpGlyGlnGlyThrLeuValThrValSerSerGlyGlyGlyGlySerGlyGlyGlyGlySerGlyGlyGlyGlySerThrAspIleGlnMetThrGlnSerProSerSerLeuSerAlaSerValGlyAspArgValThrIleThrCysArgAlaSerGlnSerIleSerSerTyrLeuAsnTrpTyrGlnGlnLysProGlyLysAlaProLysLeuLeuIleTyrAspAlaSerAlaLeuGlnSerGlyValProSerArgPheSerGlySerGlySerGlyThrAspPheThrLeuThrIleSerSerLeuGlnProGluAspPheAlaThrTyrTyrCysGlnGlnTyrAlaAspTyrProThrThrPheGlyGlnGlyThrLysValGluIleLysArg

SEQ?ID?NO：2

ATGGCCGAGGTGCAGCTGTTGGAGTCTGGGGGAGGCTTGGTACAGCCTGGGGGGTCCCTGAGACTCTCCTGTGCAGCCTCTGGATTCACCTTTAGCAGCTATGCCATGAGCTGGGTCCGCCAGGCTCCAGGGAAGGGGCTGGAGTGGGTCTCAGATATTGGTGCTTCTGGTTCTGCTACATCTTACGCAGACTCCGTGAAGGGCCGGTTCACCATCTCCAGAGACAATTCCAAGAACACGCTGTATCTGCAAATGAACAGCCTGAGAGCCGAGGACACGGCCGTATATTACTGTGCGAAATCTACTACTACTTTTGACTACTGGGGCCAGGGAACCCTGGTCACCGTCTCGAGCGGTGGAGGCGGTTCAGGCGGAGGTGGCAGCGGCGGTGGCGGGTCGACGGACATCCAGATGACCCAGTCTCCATCCTCCCTGTCTGCATCTGTAGGAGACAGAGTCACCATCACTTGCCGGGCAAGTCAGAGCATTAGCAGCTATTTAAATTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAGCTCCTGATCTATGATGCATCCGCTTTGCAAAGTGGGGTCCCATCAAGGTTCAGTGGCAGTGGATCTGGGACAGATTTCACTCTCACCATCAGCAGTCTGCAACCTGAAGATTTTGCAACTTACTACTGTCAACAGTATGCTGATTATCCTACTACGTTCGGCCAAGGGACCAAGGTGGAAATCAAACGG

Afterwards expression vector is expressed in insect cell line fruit bat S2 (Drosophila S2).The erb_scFv of purifying anti-EGFR also carries out Western engram analysis and ELISA, confirms the specificity of its anti-EGFR.

Carry out RT-PCR and obtain cDNA from hybridoma cell line, the encode variable region of heavy chain (V of anti-CD3 monoclonal antibody OKT3 of described cDNA _h) and variable region of light chain (V _l).Afterwards, two cDNA are connected produce the V of coding OKT3 _h-V _lthe fusion sequence of fused protein.The sequence of this fused protein is recognition sequence number: 3 (SEQ ID NO:3), the cDNA sequence of this sequence of encoding is recognition sequence number: 4 (SEQ ID NO:4).

SEQ?ID?NO：3

ValGlnLeuGlnGlnSerGlyAlaGluLeuAlaArgProGlyAlaSerValLysMetSerCysLysAlaSerGlyTyrThrPheThrArgTyrThrMetHisTrpValLysGlnArgProGlyGlnGlyLeuGluTrpIleGlyTyrIleAsnProSerArgGlyTyrThrAsnTyrAsnGlnLysPheLysAspLysAlaThrLeuThrThrAspLysSerSerSerThrAlaTyrMetGlnLeuSerSerLeuThrSerGluAspSerAlaValTyrTyrCysAlaArgTyrTyrAspAspHisTyrCysLeuAspTyrTrpGlyGlnGlyThrThrValThrValSerSerGlyGlyGlyGlySerGlyGlyGlyGlySerGlyGlyGlyGlySerAspIleValLeuThrGlnSerProAlaIleMetSerAlaSerProGlyGluLysValThrMetThrCysSerAlaSerSerSerValSerTyrMetAsnTrpTyrGlnGlnLysSerGlyThrSerProLysArgTrpIleTyrAspThrSerLysLeuAlaSerGlyValProAlaHisPheArgGlySerGlySerGlyThrSerTyrSerLeuThrIleSerGlyMetGluAlaGluAspAlaAlaThrTyrTyrCysGlnGlnTrpSerSerAsnProPheThrPheGlySerGlyThrLysLeuGluLeuLysArg

SEQ?ID?NO：4

GTCCAGCTGCAGCAGTCAGGGGCTGAACTGGCAAGACCTGGGGCCTCAGTGAAGATGTCCTGCAAGGCTTCTGGCTACACCTTTACTAGGTACACGATGCACTGGGTAAAACAGAGGCCTGGACAGGGTCTGGAATGGATTGGATACATTAATCCTAGCCGTGGTTATACTAATTACAATCAGAAGTTCAAGGACAAGGCCACATTGACTACAGACAAATCCTCCAGCACAGCCTACATGCAACTGAGCAGCCTGACATCTGAGGACTCTGCAGTCTATTACTGTGCAAGATATTATGATGATCATTACTGCCTTGACTACTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCGGACATTGTGCTAACCCAGTCTCCAGCAATCATGTCTGCATCTCCAGGGGAGAAGGTCACCATGACCTGCAGTGCCAGCTCAAGTGTAAGTTACATGAACTGGTACCAGCAGAAGTCAGGCACCTCCCCCAAAAGATGGATTTATGACACATCCAAACTGGCTTCTGGAGTCCCTGCTCACTTCAGGGGCAGTGGGTCTGGGACCTCTTACTCTCTCACAATCAGCGGCATGGAGGCTGAAGATGCTGCCACTTATTACTGCCAGCAGTGGAGTAGTAACCCATTCACGTTCGGCTCGGGGACCAAGCTGGAGCTGAAACGA

Carry out identical step obtain the coding anti-EGFR monoclonal antibodies 528 V _hand V _lcDNA, and the V of antibody 528 of coding anti-EGFR _h-V _lthe fusion sequence of fused protein.Monoclonal antibody 528 and EGFR on cytolemma, for example combination on people's epidermoid carcinoma (epidermoid carcinoma) A431 cell.The peptide sequence of 528 single-chain antibodies is recognition sequence number: 5 (SEQ ID NO:5), the cDNA sequence of this sequence of encoding is recognition sequence number: 6 (SEQ ID NO:6).

SEQ?ID?NO：5

ValLysLeuGlnGluSerGlySerGluMetAlaArgProGlyAlaSerValLysLeuProCysLysAlaSerGlyAspThrPheThrSerTyrTrpMetHisTrpValLysGlnArgHisGlyHisGlyProGluTrpIleGlyAsnIleTyrProGlySerGlyGlyThrAsnTyrAlaGluLysPheLysAsnLysValThrLeuThrValAspArgSerSerArgThrValTyrMetHisLeuSerArgLeuThrSerGluAspPheAlaValTyrTyrCysThrArgSerGlyGlyProTyrPhePheAspTyrTrpGlyGlnGlyThrThrValThrValSerSerGlyGlyGlyGlySerGlyGlyGlyGlySerGlyGlyGlyGlySerMetThrGlnThrProLeuSerLeuProValSerLeuGlyAspGlnAlaSerIleSerCysArgSerSerGlnAsnIleValHisAsnAsnGlyIleThrTyrLeuGluTrpTyrLeuGlnArgProGlyGlnSerProLysLeuLeuIleTyrLysValSerAspArgPheSerGlyValProAspArgPheSerGlySerGlySerGlyThrAspPheThrLeuLysIleSerArgValGluAlaGluAspLeuGlyIleTyrTyrCysPheGlnGlySerHisHisProProThrPheGlyGlyGlyThrLysLeuGlu

SEQ?ID?NO：6

GTCAAGCTGCAGGAGTCAGGGTCTGAGATGGCGAGGCCTGGAGCTTCAGTGAAGCTGCCCTGCAAGGCTTCTGGCGACACATTCACCAGTTACTGGATGCACTGGGTGAAGCAGAGGCATGGACATGGCCCTGAGTGGATCGGAAATATTTATCCAGGTAGTGGTGGTACTAACTACGCTGAGAAGTTCAAGAACAAGGTCACTCTGACTGTAGACAGGTCCTCCCGCACAGTCTACATGCACCTCAGCAGGCTGACATCTGAGGACTTTGCGGTCTATTATTGTACAAGATCGGGGGGTCCCTACTTCTTTGACTACTGGGGCCAAGGGACCACGGTCACCGTCTCCTCAGGTGGAGGCGGTTCAGGCGGAGGTGGCTCTGGCGGTGGCGGATCGATGACCCAAACTCCACTCTCCCTGCCTGTCAGTCTTGGAGATCAAGCCTCCATCTCTTGCAGATCTAGTCAGAACATTGTACATAATAATGGAATCACCTATTTAGAATGGTACCTGCAAAGGCCAGGCCAGTCTCCAAAGCTCCTGATCTACAAAGTTTCCGACCGATTTTCTGGGGTCCCAGACAGGTTCAGTGGCAGTGGATCAGGGACAGATTTCACACTCAAGATCAGCAGAGTAGAGGCTGAGGATCTGGGAATTTATTACTGCTTTCAAGGTTCACATCATCCTCCCACGTTCGGCGGGGGGACCAAGCTGGAA

Above-mentioned anti-EGFR scFv03, OKT3V encode _h-V _lwith anti-EGFR-antibodies 528V _h-V _lcDNA respectively with the mini collagen protein XXI of mankind cDNA frame endomixis, described cDNA comprises short hinge sequence and comprises histidine-tagged sequence at 3 ' end at 5 ' end.Polypeptide and the cDNA sequence thereof of the mini collagen protein XXI of the mankind are respectively recognition sequence number: 7 (SEQ ID NO:7) and recognition sequence number: 8 (SEQ ID NO:8).

SEQ?ID?NO：7

GlyGlyArgGluProLysSerCysAspLysThrHisThrCysProProCysProArgSerIleProGlyProProGlyProIleGlyProGluGlyProArgGlyLeuProGlyLeuProGlyArgAspGlyValProGlyLeuValGlyValProGlyArgProGlyValArgGlyLeuLysGlyLeuProGlyArgAsnGlyGluLysGlySerGlnGlyPheGlyTyrProGlyGluGlnGlyProProGlyProProGlyProGluGlyProProGlyIleSerLysGluGlyProProGlyAspProGlyLeuProGlyLysAspGlyAspHisGlyLysProGlyIleGlnGlyGlnProGlyProProGlyIleCysAspProSerLeuCysPheSerValIleAlaArgArgAspProPheArgLysGlyProAsnTyrSerLeuAspAspSerSerHisHisHisHisHisHisSerSerGly

(annotating: Pro=proline(Pro) or oxyproline residue)

SEQ?ID?NO：8

GGCGGCCGCGAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCAAGATCTATTCCTGGGCCACCTGGTCCGATAGGCCCAGAGGGTCCCAGAGGATTACCTGGTTTGCCAGGAAGAGATGGTGTTCCTGGATTAGTGGGTGTCCCTGGACGTCCAGGTGTCAGAGGATTAAAAGGCCTACCAGGAAGAAATGGGGAAAAAGGGAGCCAAGGGTTTGGGTATCCTGGAGAACAAGGTCCTCCTGGTCCCCCAGGTCCAGAGGGCCCTCCTGGAATAAGCAAAGAAGGTCCTCCAGGAGACCCAGGTCTCCCTGGCAAAGATGGAGACCATGGAAAACCTGGAATCCAAGGGCAACCAGGCCCCCCAGGCATCTGCGACCCATCACTATGTTTTAGTGTAATTGCCAGAAGAGATCCGTTCAGAAAAGGACCAAACTATAGTCTAGACGACAGCAGCCATCATCACCATCACCATAGCAGCGGC

Three the expression vector cotransfections (co-transfected) that produce are arrived in fruit bat S2 (Drosophila S2) cell.Cultivate these cells while existing at blasticidin (blasticidin), to filter out the cell of anti-blasticidin.The collecting cell culture supernatant also filters out the antibody of the activity of anti-EGFR and CD3 by Western trace and ELISA.Find some clones' cytotostatic ground expression triple helix mixture.These triple helix mixtures, collagen protein XXI as mini as the mankind is opposing heat and stomach en-(pepsin).The more important thing is, they are combined with EGFR and CD3 specifically.

Embodiment 2

In this embodiment, generate three fusion polypeptide: OKT3_scFv-Col, erb_scFv-Col and erb_NSPD-scFv.

The screening of phage library

(single fold) scFv phage display library (Tomlinson I+J by screening mankind single fold; By I.M.Tomlinson and G.Winter, MRC Laboratory of Molecular Biology, Cambridge, the UK friendship provides), separate erb phagemid (phagemid), this erb phagemid comprises in conjunction with the variable region fragment (variable fragment) of EGF-R ELISA extracellular region (epidermal growth factor receptor extracellular domain, EGFR-ECD) (scFv).Use immunity pipe (immunotube) (Maxisorp; Nunc, Roskilde, Denmark) screened the restructuring EGF acceptor (EGFR-ECD that the effective 10 μ g of wherein said immunity are purified; Research Diagnostics, Inc.) extracellular region coated (coated).Sealed increase again (reamplification) of (blocking), elutriation (panning), cleaning, wash-out (elution) and eluted phagemid according to manufacturers's service manual.

The structure of restructuring plastid

From will the encode cDNA of scFv of erb of erb phagemid, by PCR, increased.By the reverse transcription product from OKT3 hybridoma (ATCC, CRL-8001), obtain the encoding sequence of the anti-CD3mAb of IgG2a (Ortho Pharmaceutical Corporation) of mouse.Obtain the V of OKT3mAb by RT-PCR according to disclosed nucleotide sequence _land V _hcDNA.By using glycine joint (glycine-linker) (GGGS) ₃connect V _hand V _lchain, generate the scFv PCR fusions of erb and OKT3.

In order to generate scFv-Col, the coding region of scFv-Col comprises the scFv nucleotide sequence and comprises synthetic collagen protein framework gene, this collagen scaffold genes encoding EPKSCDKTHTCPPCPRSIP (GPP) at C-terminal (C-terminal) at N-terminal (N-terminal) ₁₀the peptide sequence of GICDPSLCFSVIARRDPFRKGPNY, the NC1 district of its hinge area that comprises IgG, collagen structure territory (collageneous domain) (using the underscore mark) and XXI collagen type.Synthetic collagen scaffold polypeptide and the sequence of cDNA thereof are respectively recognition sequence number: 9 (SEQ ID NO:9) and recognition sequence number: 10 (SEQ ID NO:10).

SEQ?ID?NO：9

GluProLysSerCysAspLysThrHisThrCysProProCysProArgSerIlePro Gl yProProGlyProProGlyProProGlyProProGlyProProGlyProProGlyProP roGlyProProGlyProProGlyProProGlyIleCysAspProSerLeuCysPheSerValIleAlaArgArgAspProPheArgLysGlyProAsnTyr

SEQ?ID?NO：10

GAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCAAGATCTATTCCTGGGCCACCTGGTCCCCCAGGTCCTCCAGGACCCCCAGGGCCCCCAGGCCCCCCCGGGCCGCCTGGACCCCCAGGGCCACCAGGCCCCCCAGGCATCTGCGACCCATCACTATGTTTTAGTGTAATTGCCAGAAGAGATCCGTTCAGAAAAGGACCAAACTAT

By overlapping PCR and the PCR product cloning that both sides had to NotI and an XhoI site prepared by the same position to expression vector pSecTag2/Hygro (Invitrogen) for this synthetic sequence (SEQ ID NO:10).The scFv of erb and OKT3 is cloned in AscI and NotI site frame in the construct (construct) that comprises above-mentioned C-terminal collagen scaffold, with the expression construct (expression construct) for preparing respectively erb_scFv-Col and OKT3_scFv-Col.

Generate afterwards erb_NSPD-scFv.254 amino acid of N-terminal that the coding region of NSPD-scFv comprises mankind's Surfactant Protein D (SPD) (member of collectin family) and at the scFv of C-terminal.254 amino acid of N-terminal and its cDNA sequence of mankind's Surfactant Protein D polypeptide are respectively recognition sequence number: 11 (SEQ ID NO:11) and recognition sequence number: 12 (SEQ ID NO:12)

SEQ?ID?NO：11

MetLeuLeuPheLeuLeuSerAlaLeuValLeuLeuThrGlnProLeuGlyTyrLeuGluAlaGluMetLysThrTyrSerHisArgThrMetProSerAlaCysThrLeuValMetCysSerSerValGluSerGlyLeuProGlyArgAspGlyArgAspGlyArgGluGlyProArgGlyGluLysGlyAspProGlyLeuProGlyAlaAlaGlyGlnAlaGlyMetProGlyGlnAlaGlyProValGlyProLysGlyAspAsnGlySerValGlyGluProGlyProLysGlyAspThrGlyProSerGlyProProGlyProProGlyValProGlyProAlaGlyArgGluGlyProLeuGlyLysGlnGlyAsnIleGlyProGlnGlyLysProGlyProLysGlyGluAlaGlyProLysGlyGluValGlyAlaProGlyMetGlnGlySerAlaGlyAlaArgGlyLeuAlaGlyProLysGlyGluArgGlyValProGlyGluArgGlyValProGlyAsnThrGlyAlaAlaGlySerAlaGlyAlaMetGlyProGlnGlySerProGlyAlaArgGlyProProGlyLeuLysGlyAspLysGlyIleProGlyAspLysGlyAlaLysGlyGluSerGlyLeuProAspValAlaSerLeuArgGlnGlnValGluAlaLeuGlnGlyGlnValGlnHisLeuGlnAlaAlaPheSerGlnTyrLysLysValGluLeuPhe

SEQ?ID?NO：12

ATGCTGCTCTTCCTCCTCTCTGCACTGGTCCTGCTCACACAGCCCCTGGGCTACCTGGAAGCAGAAATGAAGACCTACTCCCACAGAACAATGCCCAGTGCTTGCACCCTGGTCATGTGTAGCTCAGTGGAGAGTGGCCTGCCTGGTCGCGATGGACGGGATGGGAGAGAGGGCCCTCGGGGCGAGAAGGGGGACCCAGGTTTGCCAGGAGCTGCAGGGCAAGCAGGGATGCCTGGACAAGCTGGCCCAGTTGGGCCCAAAGGGGACAATGGCTCTGTTGGAGAACCTGGACCAAAGGGAGACACTGGGCCAAGTGGACCTCCAGGACCTCCCGGTGTGCCTGGTCCAGCTGGAAGAGAAGGTCCCCTGGGGAAGCAGGGGAACATAGGACCTCAGGGCAAGCCAGGCCCAAAAGGAGAAGCTGGGCCCAAAGGAGAAGTAGGTGCCCCAGGCATGCAGGGCTCGGCAGGGGCAAGAGGCCTCGCAGGCCCTAAGGGAGAGCGAGGTGTCCCTGGTGAGCGTGGAGTCCCTGGAAACACAGGGGCAGCAGGGTCTGCTGGAGCCATGGGTCCCCAGGGAAGTCCAGGTGCCAGGGGACCCCCGGGATTGAAGGGGGACAAAGGCATTCCTGGAGACAAAGGAGCAAAGGGAGAAAGTGGGCTTCCAGATGTTGCTTCTCTGAGGCAGCAGGTTGAGGCCTTACAGGGACAAGTACAGCACCTCCAGGCTGCTTTCTCTCAGTATAAGAAAGTTGAGCTCTTC

N-terminal SPD cDNA is cloned between the NheI and AscI site of expression vector pSecTag2/Hygro (Invitrogen).AscI and the XhoI site of the construct that comprises above-mentioned N-terminal SPD will be cloned into, with the expression construct of preparation erb_NSPD-scFv in the scFv frame of erb.

The opening code-reading frame of each erb_scFv-Col, erb_NSPD-scFv and OKT3_scFv-Col (open reading frame) comprises coding N-terminal leader sequence (leader sequence) and take the sequence of the C-terminal myc epi-position that secretion, detection and purifying be purpose/poly Histidine (polyhistidine) label.Table one is the protein/antibody of the multiple restructuring by above-mentioned expression construct coding.

The summary of the Multiple Antibodies molecule used in this research of table 1.

¹collagen scaffold antibody

The expression and purification of antibody

In order to generate the protein complex/antibody of restructuring, according to manufacturers's service manual, use Effectene (Qiagen) that aforementioned construct is transfected into to mouse myeloma (myeloma) NS0 cell.After with homomycin (hygromycin) (400 μ g/ml), selecting 4 weeks, stable being cloned in shaking flask (shaker flask) with 2 * 10 by each ⁵in the initial inoculum density of cell/ml substratum (chemically-defined medium) HyQCDM4NS0 (Hyclone) definite at the chemistry that comprises 2% foetal calf serum, cultivate.In 37 ℃ 150rpm maintain 5 days.Cell to those with the expression construct of coded protein, add sodium ascorbate (Sodium ascorbate) (80 μ g/ml) in substratum every day, wherein above-mentioned protein comprises aforementioned antibody regions and collagen scaffold district, i.e. collagen scaffold antibody (CSA).

For purifying erb_scFv, erb_scFv-Fc, erb_scFv-Col or OKT3_scFv-Col protein or protein complex, by every kind of about 2L filtration cell substratum with the flow velocity loading of 60ml/ hour to the T-gel column of Tris-HCl buffered soln (pH8) balance with 50mM (1.5 * 8cm, Pierce).After the buffered soln with identical cleans, protein or the protein complex of with sodium acetate buffer solution (pH4) wash-out of 50mM, recombinating.Monitoring its UV at 280nm absorbs, and the mountain portions of its wash-out is loaded to Sepharose HighTrap post (the 1-ml column volume of zinc sulfate-electrically charged (charged) chelating with the flow velocity of 60ml/ hour, GE Healthcare), Tris-HCl buffered soln (pH8) balance of the 50mM that comprises 0.5M NaCl for this post.First the imidazoles (imidazole) with 20mM cleans, and elutes afterwards protein or the protein complex of combination in identical buffered soln with the imidazoles of 0.25M.Last prepared product 50mM, the Hepes buffered soln of pH7.0 is dialysed.

Use afterwards 10%NuPAGE bis-Tris polyacrylamide gel or 7%SDS/Tris-acetic acid polyacrylamide gel with MOPS, the sodium-acetate of usining (Invitrogen) carries out SDS-PAGE as electrophoresis buffered soln (running buffer).Use afterwards Xylene Brilliant Cyanine G (Coomassie brilliant blue) the R-250 protein that dyes.By utilizing ChemiImager5500 (Alpha Innotech, SanLeandro, CA) and Alpha EaseFC (v.4.0; Alpha Innotech) photodensitometry of software (densitometry) carrys out the density of quantitative protein band (band).

In order to verify the character of triple helix, by purified erb_scFv-Col (1mg/ml) in the situation that DTT lacks without or exists in 37 ℃ cultivates 1 hour.Whole minute (aliquot) of the sample that the DTT that hangs oneself in the future processed, further with 50mM N-ethylomaleimide (N-ethyl-maleimide, NEM) in room temperature reaction 30 minutes, for good and all to prevent free sulfhydryl groups (sulfhydryl) and trimerically to form again.The protein of each sample of getting equivalent in 7%SDS/Tris-acetic acid polyacrylamide gel, the sodium-acetate of usining carries out electrophoresis as electrophoresis buffered soln.With Coomassie blue (Coomassie blue), do gel-colored.Find that purified CSA is homotrimer (homotrimer) or interchain disulfide bond six aggressiveness (heximer), in slight reducing environment, it can be separated into two tripolymers.

The thermostability of the tripolymer structure of test erb_scFv-Col.In the 50mM Tris-HCl (pH8) that contains 2M urea (urea), purified erb_scFv-Col is lacking without or is existing 10mM tri-(2-propyloic) phosphuret-(t)ed hydrogen (tris (2-carboxyethyl) phosphine, TCEP) time to be processed in room temperature.In room temperature, the sample of reduction is carried out to alkylation (alkylate) with the NEM of 50mM.To get every increment of equal protein matter before mixing with sds gel loading buffered soln (loading buffer) originally in 35,45,55,65,75 and 85 ℃ of heating 10 minutes.Sample is carried out to electrophoresis under non-reduced state at 10%NuPAGE bis-Tris polyacrylamide gel and in MOPS buffered soln.With Coomassie blue (Coomassie blue), carry out gel-colored.Result shows that the erb_scFv-Col tripolymer has high heat stability.Still retaining the tripolymer more than 50% after 65 ℃ are processed 10 minutes.And found that the tripolymer structure in erb_scFv-Col collagen structure territory is by prolyl hydroxylation (prolyl hydroxylate).

Binding

Use BIAcore X biosensor (BIACORE, Inc., Uppsala, Sweden) in running buffer (running buffer) HBS-EP (10mM HEPES, pH7.4,150mM NaCl, 3mMEDTA, 0.005% tensio-active agent P20) the middle binding kinetics of the variant of erb antibody to EGFR-ECD of measuring.In simple terms, EGFR-ECD is puted together to (amine coupling) via amine and be fixed in the degree that the C1 induction chip reaches 1700 units of replying (response units, RU), and inject the antibody purification of different concns with the flow velocity of 10 μ l/ minutes.By injecting (pH3.5) (regenerate) surface of regenerating of 5 μ l10mM glycine-hydrochloric acid (glycine-HCl).Obtain induction spectrum (sensorgram) and service routine BIA Evaluation3.2 carrys out wash-out induction spectrum in each concentration.Insert the 1:1Langmuir combination model in connection with data and calculate affinity constant K _d, it is defined as separation rate (dissociation rate) (k _diss)/combination rate (association rate) (k _ass) ratio.The results are shown in table 2.

The binding kinetics that the various ways of table 2.erb antibody is combined with immobilized EGFR-ECD

As shown in table 2, erb_scFv_Col almost is respectively divalence (erb_scFv-Fc) and monovalence (erb_scFv) mAb counterpart (counterpart) 20 and 1000 times to the binding affinity of EGFR-ECD.

Stability and pharmacokinetics (Pharmacokinetic) are analyzed

In order to carry out the analysis of serum stability, by 37 ℃, with the serum human incubation, measuring the stability of various ways of the erb antibody of erb_scFv_Col, erb_scFv-Fc or erb_scFv.Measure the amount of the activation anti-EGFR retained after the different times of incubative time by quantitative ELISA.Use the mAb (9E10 of restructuring EGFR-ECD (as catching reagent (capture reagent)) and anti-c-myc, Sigma Chemical Co.), use again afterwards polyclone goat anti-mouse IgG and the chemical luminous substrate (chemiluminescent substrate) (Pierce Biotechnology, Inc.) of the protein affinity purification of HRP coupling to carry out ELISA.In order to make pharmacokinetic analysis, with three BALB/c nude mices, analyze erb_scFv_Col clearance rate (clearance).Briefly, after blood sampling in advance, inject the erb_scFv_Col of 25 μ g (2mg/ body weight Kg) to every mouse subcutaneous (subcutaneously, s.c.).In ensuing 70 hours, collect periodic blood sample and assess their erb_scFv_Col content by ELISA.Found that this protein quite stable.

T cell proliferation (proliferation) is analyzed and mixed lymphocyte reacion (Mixed Lymphocyte Reaction)

Carry out the bromo-2-deoxyuridine of 5-(5-bromo-2'-deoxyuridine, BrdU) analysis of cell proliferation.Briefly, in the 96 flat tissue culture dishes in hole (flat bottom tissue culture plate), by human peripheral blood mononuclearcell (peripheral blood mononuclear cell) with 2 * 10 ⁵in the RPMI-1640 substratum that cells/well comprises 10%FBS at 100 μ l, when 37 ℃ of OKT3 (eBioscience, Inc.) in 10 times of serial dilutions of existence or OKT3_scFv-Col, cultivate 66 hours.Afterwards by the BrdU pulse of cell and 10 μ M 6 hours.After removing substratum, fixed cell, and with FixDenat mono-step denatured DNA.Afterwards the anti-BrdU antibody (anti-BrdU POD, Fab fragment) of cell and peroxidase (peroxidase) mark is cultivated 1.5 hours together in room temperature.(Hidex, CHAMELEON detection platform Finland) are carried out chemiluminescence detection and quantitative to use droplet plate luminometer (microplate-luminometer).

Assess as follows T cell proliferation and immunosuppression (immunosuppression) with unidirectional mixed lymphocyte reacion.Obtain the human peripheral blood mononuclearcell from the donor (exciter (stimulator) and reactor (responder)) of two health.Comprising 5%CO in 37 ℃ ₂damp atmosphere in, with 25 μ g/ml ametycins (Sigma-Aldrich) at perfect medium (RPMI1640, supplemented each 100 units/ml of 10% mankind AB serum (human AB serum), 2mM glutamine (glutamine), 50nM2-thioglycol (2-mercaptoethanol) and penicillin (penicillin) and Streptomycin sulphate (streptomycin)) process the cell 30 minutes of exciter or reactor, then in the RPMI1640 substratum, clean three times.By reactor cell single culture or with the cell of the exciter who processes through mitomycin C or the reactor processed through mitomycin C, with the ratio of 1:1, mix, in the perfect medium of 200 μ l with 2 * 10 ⁵cells/well is cultivated.After inserting the reactor cell, immediately the OKT3_scFv-Col of purifying or OKT3 are added in substratum with different concns.After 5 days by the BrdU pulse of cultured cells and 10 μ M, and after 24 hours harvested cell.Carry out analysis of cell proliferation with aforesaid method afterwards.

Found that, although show stimulating the insignificant mitogenic activity in T cell proliferation, OKT3_scFv-Col is more effective for the propagation of inhibitive ability of immunity T cell.

Cytokine measurements

In the RPMI-1640 substratum that the human peripheral blood mononuclearcell is comprised to 10%FBS at 0.1ml with 2 * 10 ⁵cells/well is cultivated under 37 ℃ of OKT3 10 times of dilutions (eBioscience, Inc.) or OKT3_scFv-Col existence.Collect supernatant in different time points, and end user's type cytokines immunoassay kits (eBioscience, Inc.) is measured cytokine profiles.Result shows, with the OKT3mAb of mouse, compares, and using of OKT3_scFv-Col causes insignificant release of cytokines.

Antibody surrogate is analyzed (replacement assay)

All following methods are all carried out at 4 ℃.By human T cells with 1 * 10 ⁶the density of cell/ml is suspended in FCM buffered soln (phosphate buffered saline (PBS) (phosphate-buffered saline) and 2%FBS and 0.1% sodiumazide (sodium azide)).Process cell 30 minutes with the full IgG of mouse (total IgG) (2 μ g/ml, JacksonImmunoResearch Laboratories), afterwards incubation 1 hour together with the OKT3_scFv-Col of serial dilution or OKT3 antibody.Directly add the fixedly OKT3 (0.25 μ g/ml, purchased from eBioscience, Inc.) of the FITC-coupling of saturation capacity (measuring by flow cytometry (cytometry))., after 1 hour cell is cleaned and carries out immunofluorescence analysis by flow cytometry on FACScan (Becton Dickinson, San Jose, CA) with FCM buffered soln at incubation.Result is shown as the inhibition per-cent of maximum fluorescence intensity, and it is defined as by the situation that lack the average fluorescent strength that blocking antibody (blocking antibodies) obtains with OKT3-FITC dyeing T cell.

Result shows OKT3_scFv-Col and mankind CD3 ⁺the combination of T cell is better than the OKT mAb of natural mouse.

Use IgG as standard substance, analyze (Coomassie plus reagent, from Pierce Biotechnology, Inc.) by Bradford and measure protein concn.For amino acid analysis, the erb_scFv-Col of purifying is dialysed with 50mM acetic acid, at 6N HCl after 110 ℃ are hydrolyzed 24 hours, at Waters carry out amino acid analysis in system.

These result proof collagen scaffold antibody are desirable structures in the application of antitumor and immunomodulatory (immunomodulatory) for the design of therapeutic antibodies.

Can combine by any way the disclosed all features of this specification sheets.Disclosed every the feature of this specification sheets can be identical with it, be equal to or the feature of similar purpose substitutes.Therefore, unless otherwise indicated, disclosed every feature be all a series of be equal to or similar characteristics in an example.

Although the present invention has disclosed preferred embodiment as above, yet they are not for limiting the present invention, and any those skilled in the art, can do some change that does not deviate from spirit and scope of the invention and modifications.Therefore the scope that protection scope of the present invention should limit with claim is as the criterion.

The application also provides following technical proposals:

1. recombinant protein mixture, it comprises:

The first fusion polypeptide chain, the first heterology district that comprises the first rack area and merge with this first rack area one end;

The second fusion polypeptide chain, comprise the second rack area; And

The 3rd fusion polypeptide chain, comprise the 3rd rack area;

Wherein this first, second and the 3rd rack area arrange mutually to form triple helix curling.

2. as 1 a described recombinant protein mixture, wherein this heterology district comprises land.

3. as 2 a described recombinant protein mixture, wherein this land comprises ligand binding domain, part, acceptor, affinity tag or proteoglycan.

4. as 2 a described recombinant protein mixture, one or more complementary determining regions that wherein this land comprises immunoglobulin (Ig).

5. as 4 a described recombinant protein mixture, the sequence that wherein this land comprises Fab.

6. as 5 described recombinant protein mixtures, wherein this Fab and CD3 or an EGFR specific binding.

7. as 5 a described recombinant protein mixture, the sequence that wherein this Fab comprises single-chain antibody.

8. as 1 a described recombinant protein mixture, wherein this first fusion polypeptide chain also comprises the second heterology district of merging with this first rack area the other end.

9. as 8 a described recombinant protein mixture, the sequence that wherein this first heterology district comprises the first single-chain antibody, this first single-chain antibody and CD3 specific binding.

10. as 8 a described recombinant protein mixture, the sequence that wherein this second heterology district comprises the second single-chain antibody, this second single-chain antibody and EGFR specific binding.

11., as 8 a described recombinant protein mixture, wherein this second fusion polypeptide chain comprises the 3rd heterology district of merging with this second rack area one end.

12., as 11 a described recombinant protein mixture, wherein this second fusion polypeptide chain also comprises the 4th heterology district of merging with this second rack area the other end.

13., as 12 a described recombinant protein mixture, wherein the 3rd fusion polypeptide chain comprises the 5th heterology district of merging with the 3rd rack area one end.

14., as 13 a described recombinant protein mixture, wherein the 3rd fusion polypeptide chain comprises the 6th heterology district of merging with the 3rd rack area the other end.

15. as 1 a described recombinant protein mixture, wherein this first, second or the 3rd rack area comprise one or more triple helix tumor-necrosis factor glycoproteinss, the sequence that each tumor-necrosis factor glycoproteins comprises following formula: (X1-X2-X3) n, wherein X1 is the Gly residue, X2 or X3 are any amino-acid residues, and n is more than or equal to 5.

16. as 15 described recombinant protein mixtures, wherein this first, second or the 3rd rack area one or more triple helix tumor-necrosis factor glycoproteinss of comprising C1q, collectin or collagen polypeptide chain.

17., as 15 a described recombinant protein mixture, wherein X3 is proline(Pro) or oxyproline residue.

18., as 15 a described recombinant protein mixture, wherein each tumor-necrosis factor glycoproteins comprises (GPP) ₁₀sequence.

19. as 1 a described recombinant protein mixture, the sequence that wherein this heterology district comprises enzyme zone or fluorescence protein.

20. as 1 a described recombinant protein mixture, wherein this first, second and the 3rd fusion polypeptide basic identical.

21. recombinant fusion polypeptide, it comprises:

Rack area, be used to form triple helix curling, and

The first heterology district with this stent area one end fusion.

22. as 21 a described recombinant fusion polypeptide, wherein this rack area comprises one or more triple helix tumor-necrosis factor glycoproteinss, and each tumor-necrosis factor glycoproteins comprises the sequence of following formula: (X1-X2-X3) n, and wherein X1 is the Gly residue, X2 or X3 are any amino-acid residues, and n is more than or equal to 5.

23., as 22 a described recombinant fusion polypeptide, wherein X3 is proline(Pro) or oxyproline residue.

24., as 21 a described recombinant fusion polypeptide, it also comprises the second heterology zone of merging with this rack area the other end.

25. as 21 a described recombinant fusion polypeptide, one or more triple helix tumor-necrosis factor glycoproteinss that wherein this rack area comprises C1q, collectin or collagen polypeptide chain.

26., as 21 a described recombinant fusion polypeptide, wherein this heterology district comprises ligand binding domain, part, acceptor or polysaccharide.

27., as 21 a described recombinant fusion polypeptide, acquisition is screened by phage display by wherein said heterology district.

28. the nucleic acid separated, sequence or its complementary sequence that it comprises coding 21 a described fusion polypeptide.

29. host cell, it comprises 28 a described nucleic acid.

30., as 29 a described host cell, wherein this cell is the cell of Mammals or insect.

31., as 30 a described host cell, wherein this mammiferous cell is mouse myeloma NS0 cell.

32. expression vector, it comprises 28 a described nucleic acid.

33. produce the method for fusion polypeptide, it comprises:

In the situation that allow expression of polypeptides to cultivate 29 a described host cell, wherein this polypeptide is by nucleic acid encoding, and

This polypeptide of purifying from the substratum of cultured cells or this cell.

34. produce the method for 1 a described protein complex, comprising:

Allow to express by the polypeptide of three kinds of nucleic acid encodings and in the situation that form the curling host cell of cultivating of triple helix between them in substratum, this host cell comprises:

Encode the first nucleic acid of the first fusion polypeptide chain, the first heterology zone that this first fusion polypeptide chain comprises the first rack area and merges with an end of the first rack area;

Encode the second nucleic acid of the second fusion polypeptide chain, this second fusion polypeptide chain comprises the second rack area; With

Encode the 3rd nucleic acid of the 3rd fusion polypeptide chain, the 3rd fusion polypeptide chain comprises the 3rd rack area; And

This protein complex of purifying from the substratum of cultured cells or this cell.

35., as the method for 34 a described generation protein complex, wherein this host cell is eukaryotic cell, it comprises makes the hydroxylated enzymic activity of proline residue.

Claims (7)

1. recombinant protein mixture, it comprises:

The first fusion polypeptide chain, the first heterology district that comprises the first rack area and hold the frame endomixis with this first rack area N;

The second fusion polypeptide chain, the 3rd heterology district that comprises the second rack area and hold the frame endomixis with this second rack area N; And

The 3rd fusion polypeptide chain, the 5th heterology district that comprises the 3rd rack area and hold the frame endomixis with the 3rd rack area N;

Wherein said rack area is SEQ ID NO:9, and wherein said first, second and the 3rd rack area are arranged mutually to form triple helix curling, described first, the 3rd, the aminoacid sequence in the 5th heterology district be SEQ ID NO:1 or described first, the 3rd, the aminoacid sequence in the 5th heterology district is SEQ ID NO:3.

2. the nucleic acid separated, the sequence that it comprises the first fusion polypeptide chain claimed in claim 1 of encoding.

3. host cell, it comprises nucleic acid claimed in claim 2, and this host cell is eukaryotic cell and comprises and make the hydroxylated enzymic activity of proline residue.

4. host cell as claimed in claim 3, wherein this cell is the cell of Mammals or insect.

5. host cell as claimed in claim 4, wherein this mammiferous cell is mouse myeloma NS0 cell.

6. produce the method for protein complex claimed in claim 1, comprising:

Allow to express by the polypeptide of three kinds of nucleic acid encodings and in the situation that form the curling host cell of cultivating of triple helix between them in substratum, this host cell is eukaryotic cell and comprises and make the hydroxylated enzymic activity of proline residue, and this host cell comprises:

Encode the first nucleic acid of the first fusion polypeptide chain, this first fusion polypeptide chain comprise the first rack area and with the first heterology zone of the N end frame endomixis of the first rack area;

Encode the second nucleic acid of the second fusion polypeptide chain, this second fusion polypeptide chain comprise the second rack area and with the 3rd heterology district of this second rack area N end frame endomixis; With

Encode the 3rd nucleic acid of the 3rd fusion polypeptide chain, the 3rd fusion polypeptide chain comprise the 3rd rack area and with the 5th heterology district of the 3rd rack area N end frame endomixis; And

This protein complex of purifying from the substratum of cultured cells or this cell, wherein said rack area is SEQ ID NO:9, described first, the 3rd, the aminoacid sequence in the 5th heterology district be SEQ ID NO:1 or described first, the 3rd, the aminoacid sequence in the 5th heterology district is SEQ ID NO:3.

7. the method for generation protein complex as claimed in claim 6,

Wherein this host cell is eukaryotic cell, and it comprises makes the hydroxylated enzymic activity of proline residue.

Images