CN103156827A - Application of stilbene compounds in treating and preventing AIDS - Google Patents
Application of stilbene compounds in treating and preventing AIDS Download PDFInfo
- Publication number
- CN103156827A CN103156827A CN2011104113734A CN201110411373A CN103156827A CN 103156827 A CN103156827 A CN 103156827A CN 2011104113734 A CN2011104113734 A CN 2011104113734A CN 201110411373 A CN201110411373 A CN 201110411373A CN 103156827 A CN103156827 A CN 103156827A
- Authority
- CN
- China
- Prior art keywords
- hiv
- application
- protease
- hydroxyl
- aids
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Abstract
The invention provides an application of stilbene compounds in treating and preventing AIDS. The stilbene compounds have a structural formula represented by the general formula (I), wherein R1, R2, R3, R4, R5 or R6 independently represents hydrogen, hydroxyl, C1-C4 alkyl, C1-C4 alkoxy, C1-C4 acyloxy, halogen, nitro, trifluoromethyl, or cyano, provided that at least one of R1, R2 and R3 is hydroxyl and at least one of R4, R5 and R6 is hydroxyl. In the compounds represented by the general formula (I), the inhibition activity IC50 of a stilbene compound piceatannol against HIV-1 protease reaches 59mum.
Description
Technical field
The present invention relates to the pharmaceutical chemistry field, in particular to the purposes of diphenylethylene compounds.
Background technology
Acquired immune deficiency syndrome (AIDS) (Acquired Immune Deficiency Syndrome is abbreviated as AIDS) also referred to as acquired immune deficiency syndrome (AIDS), is the infectious disease that is caused by human immunodeficiency virus (HIV).HIV virus is a kind of virus that can attack the human immune system, it most important T4 lymphocyte in the human immune system as target of attack, engulf in a large number, destroy the T4 lymphocyte, thereby destroy people's immune system, finally make the immune system collapse, human body is fallen ill to the resistivity of various diseases because losing, thereby multi-infection or tumor occur, cause at last death.
The harm of acquired immune deficiency syndrome (AIDS) is have swept the globe, and the gesture that spreads is very swift and violent.1984, HIV sufferers less than 3000 people of whole world report." the 2008 Summary of HIV/AIDS Epidemic report " of UNAIDS's issue pointed out: by the end of the year 2007, acquired immune deficiency syndrome (AIDS) has caused 2,500 ten thousand people dead, separately has 3,300 ten thousand people infected, and wherein there are 700,000 people in China.China found HIV viral infection person first from 1985, infection has occured existing 60～800,000 people so far, and the expert estimates, if do not take rapidly effective preventive measure, presses the growth rate of present annual 30%, and HIV the infected of China is with 10 million.In some country in Africa, the infection rate of HIV reaches total population more than 30%.Therefore, prevention and treatment acquired immune deficiency syndrome (AIDS), oneself is not only the problem of saving individual life, but is related to the major issue of national living or death.
HIV belongs to Retroviridae (Retroviridae) lentivirus (lentivirus) on viral taxonomy, at present oneself finds two kinds of HIV virus strains, is respectively HIV-I and HIV-2.Both have similar virus structure and route of transmission.HIV-I is distributed widely in all over the world, is the cause of disease that causes that whole world AIDS is popular, and the research of HIV is at present also carried out as main take HIV-I.HIV-I protease is the useful effect target spot of anti-AIDS drug, can effectively stop copying of HIV-I virus to its inhibition, thereby play the effect of anti-AIDS.Synthesized multiple HIV-I protease inhibitor according to this thinking people, existing 10 HIV-I protease inhibitor are successfully applied to clinical, as Saquinavir, ritonavir, indinavir, viracept see nelfinaivr, amprenavir, atazanavir, DRV etc.Characteristics due to the easy variation of HIV-I virus, the problem of drug resistance also occurs thereupon, and the efficient antiretroviral therapy (HAART that uses in the world, or title " HAART ") can not eradicate the virus in body, and long-term Drug therapy also can be with and serve side effect, and price higher (for each person every year up to 15000 U.S. dollars).Therefore, seek novel HIV-I protease inhibitor and find the inverase that can effectively suppress virus, reparation body immunity, low toxicity, cheapness to remain present stage research worker urgent problem.
Utilize the natural Chinese medicinal herb resource of China's abundant, separation and Extraction active component wherein, and as lead compound, be the effective way of development HIV-1 protease inhibitor.
Natural product claims again secondary metabolite (Secondary Metabolites), has the multifarious characteristics of structure diversity and biological activity.Natural product and derivant thereof have been brought into play promising effect in disease treatment in the past, also one of resource (Newman DJ, Gragg GM, the Snader KM.Nat Prod Rep of tool potentiality in current medicament research and development process, 2000,17 (3): 215-234; Lee K-H. J Nat Prod, 2004,67 (2): 273-283).Now in the ascendant to the Natural products research in the conventional medicaments such as Chinese medicine, marine organisms and microbial metabolism, annual all can have the compound of a large amount of novel structures to be found to provide, these compounds are the medicine that can't realize of synthetic method and the important source of lead compound, play an important role in the discovery of new drug and lead compound.Because Chinese medicine is the treasure-house of the Medicine small molecule compound of a greatness in the history that China used in existing thousands of years, therefore, the new Anti-AIDS Drugs of development becomes a focus of research from natural resources.
The open Chinese medicine of existing many patents can be used as potential Anti-AIDS Drugs, and open walnut shell extract, the Zhou Ying in CN101982187A such as Liu Guangming disclose Folium Camelliae sinensis extract in CN101507778A, wear Semen Arecae extract, the Chen Guangying etc. of disclosing in CN101411796A such as rich discloses plum extract, Wu Nanping etc. and disclose Flos Lonicerae extract, Zhang Lanzhen disclose Cacumen Securinegae Suffruticosae extract all have the AIDS virus resisting effect in CN1255355 in CN1850144 in CN101254224.In addition, there is no the application of relevant sausage bean (Cassia fistula L.) in anti-AIDS drug, and above extract there is no finally to determine the active component of its AIDS virus resisting yet.
Piceatannol is the chemical composition in the sausage bean, claim again 3 '-hydroxyl resveratrol or than China fir Extra Old, be diphenylethylene compounds, have anti-leukocythemia liveness; Has the activity that suppresses non-receptor activation enzyme, spleen butyric acid kinases and lymphocyte specific protein tyrosine kinase.Li Junlin etc. disclose the application of diphenylethylene compounds in treatment and prevent diabetes in CN1398838; Lv Qiujun etc. disclose the purposes of trans stilbene derivant in prevention or treatment hepatic fibrosis in CN1401316A; Chen Genghui etc. disclose one group of new diphenyl ethylene derivatives as the application in treatment immune disease, inflammation and autoimmune disease in CN1688535A.Yet diphenylethylene compounds there is no relevant report to the inhibition of hiv protease.
Summary of the invention
Because diphenylethylene compounds there is no relevant report to HIV-1 albumen enzymeinhibition activity, therefore the purpose of this invention is to provide diphenylethylene compounds as the new purposes of HIV-1 protease inhibitor.
According to an aspect of the present invention, provide the application of diphenylethylene compounds in the medicine for preparing treatment and prevent AIDS, the structural formula of wherein said diphenylethylene compounds is:
Wherein, R
1, R
2, R
3, R
4, R
5Or R
6Represent independently hydrogen, hydroxyl, C
1-C
4Alkyl, C
1-C
4Alkoxyl, C
1-C
4Acyloxy, halogen, nitro, trifluoromethyl or cyano group, precondition is R
1, R
2And R
3In be one of at least hydroxyl and R
4, R
5And R
6In be one of at least hydroxyl.
According to a preferred embodiment of the present invention, wherein said R
1, R
2, R
3, R
4, R
5Or R
6Represent independently hydrogen or hydroxyl.
Diphenylethylene compounds of the present invention can make (Zhang Yue, Zhao Shuchun, CN101830764A according to the method for chemical field routine by chemosynthesis from corresponding substituted benzaldehyde, replacement benzyl chlorine; CN101838173A), corresponding alkoxyl and acyloxylation compound can make (Peter G.M.Wuts and Theodora W.Greene according to the method alkylation of chemical field routine or acylation reaction by hydroxy derivatives, Greene ' s protective group in organic synthesis.The fourth edition.2007, John Wiley ﹠amp; Sons, Inc.).
According to another preferred implementation of the present invention, wherein said diphenylethylene compounds is piceatannol.
Above-mentioned application is the application of diphenylethylene compounds aspect preparation HIV-1 protease inhibitor.
The present invention is take HIV-1 protease as target spot, and separating-purifying goes out the HIV-1 protease inhibitor from sausage bean extract.HIV-1 protease inhibitor provided by the invention is piceatannol, and wherein piceatannol is from the acetic acid ethyl ester extract of 95% ethanol extraction of sausage bean.
Alkyl mentioned above refers to have the alkyl of the straight or branched of 1～4 carbon atom, for example: methyl, ethyl, 1-propyl group, 2-propyl group, 1-butyl, 2-butyl, the tert-butyl group, preferable methyl.
Alkoxyl mentioned above refers to have the alkoxyl of the straight or branched of 1～4 carbon atom, for example: methoxyl group, ethyoxyl, propoxyl group, isopropoxy, butoxy, isobutoxy, tert-butoxy.Preferred methoxyl group.
Acyloxy mentioned above is formyloxy, acetoxyl group, propionyloxy or butyryl acyloxy.Preferred acetoxyl group.
Halogen mentioned above refers to fluorine, chlorine, bromine or iodine atom.Preferred fluorine atom.
The present invention also provides a kind of pharmaceutical composition, and described pharmaceutical composition and contains one or more pharmaceutically acceptable carriers take the diphenylethylene compounds for the treatment of effective dose as active component
Above-mentioned pharmaceutically acceptable carrier refers to the pharmaceutical carrier of pharmaceutical field routine, such as: diluent, excipient such as water etc., filler such as starch, sucrose etc.; Binding agent such as cellulose derivative, alginate, gelatin and polyvinylpyrrolidone; Wetting agent such as glycerol; Disintegrating agent such as agar, calcium carbonate and sodium bicarbonate; Absorption enhancer such as quaternary ammonium compound; Surfactant such as hexadecanol; Absorption carrier such as Kaolin and soap clay; Lubricant such as Pulvis Talci, calcium stearate and magnesium and Polyethylene Glycol etc.Can also add other adjuvant such as flavouring agent, sweeting agent etc. in the recombinant thing in addition.
The various dosage forms of pharmaceutical composition of the present invention can be according to the conventional production method preparation of pharmaceutical field.Active component is mixed with one or more carriers, then be made into required dosage form.
According to a further aspect in the invention, a kind of method of the HIV-1 of screening protease inhibitor is provided, comprise the steps: to utilize FRET (fluorescence resonance energy transfer) (fluorescence resonance energy transfer, FRET) technology observation measurements micromolecule to the inhibition of HIV-1 protease; Adopt the interaction between biological mass spectrometry measurement HIV-1 protease and micromolecule; Measure micromolecular inhibitor to the active IC of HIV-1 albumen enzymeinhibition
50Data.
The selected primary raw materials of the present invention is the sausage bean.The present invention's sample extraction purification process used is as follows:
(a) get a certain amount of sausage bean, 95% alcohol reflux of doubly measuring with 1-3 3 times, merge extractive liquid,, the concentrated extractum that to get.
(b) take extractum in a certain amount of step (a), disperse with distilled water, obtain petroleum ether layer, dichloromethane layer, ethyl acetate layer, n-butanol layer and water layer 5 parts through petroleum ether, dichloromethane, ethyl acetate and n-butanol extraction respectively, the concentrated thick component accordingly that gets later on.
(c) get the thick component of step (b) gained, carry out the suppression ratio of HIV-1 protease and measure.
(d) utilize silica gel column chromatography, sephadex LH-20 gel column chromatography spectrum method to have a highly active thick component to what step (c) recorded, be further separated.Follow active principle of following the tracks of in separation process and only activated part is carried out separation and purification.
(e) one-component with purification carries out nuclear magnetic resonance spectroscopy confirmation structure.
(f) one-component of step (e) being confirmed carries out the HIV-1 protease inhibiting activity to be measured, and determines IC
50Value.
Screening scheme by HIV-1 protease inhibitor of the present invention extracts from the sausage bean has isolated the HIV-1 protease inhibitor, and wherein the diphenylethylene compounds piceatannol is to the active IC of HIV-1 albumen enzymeinhibition
50Reach 59 μ M.
Description of drawings
Fig. 1 illustrates the separation and purification flow chart of acetic acid ethyl ester extract of 95% ethanol extraction of sausage bean.
Fig. 2 illustrates the acetic acid ethyl ester extract of 95% ethanol extraction of sausage bean through the screening active ingredients result of eight parts obtaining after separation and purification.
Fig. 3 illustrates the IC of piceatannol Inhibit HIV-1 Protease
50Curve chart.
The specific embodiment
The following examples can make the present invention of those skilled in the art's comprehend, but do not limit the present invention in any way.
The expression of embodiment 1 HIV-1 protease, purification, protein active detect and IC
50The mensuration of value
(1) structure of the amplification of HIV-1 protease fragment and expression vector
The design primer PCR reclaims PCR product and pET-11a carrier with Nde I and BamH I enzyme action with HIV-1 protease-encoding fragment amplification, reclaims the purpose fragment, the fragment after enzyme action is connected rear Transformed E .coli.DH5 α competent cell with linearized vector.The clone that picking transforms carries out PCR and identifies, positive colony carries out DNA sequencing.
The gene order of HIV-1 protease:
cctcagatcactctttggcaacgacccctcgtcacaataaagataggggg
gcaactaaaggaagctctattagatacaggagcagatgatacagtattag
aagaaatgagtttgccaggaagatggaaaccaaaaatgatagggggaat
tggaggttttatcaaagtaagacagtatgatcagatactcatagaaatctg
cggacataaagctataggtacagtattagtaggacctacacctgtcaacat
aattggaagaaatctgttgactcagattggatgcactttaaatttt
(2) expression of HIV-1 protease and purification
Cultivation is extracted plasmid through the correct clone strain that checks order, and transforms e. coli bl21 (DE3), and the picking monoclonal is cultured to OD600nm ≈ 0.4-0.6 at 37 ℃, adds 1mmol/L IPTG, induces 5h.Centrifugal collection thalline is with the resuspended thalline of solution A (20mM Tris-HCl, pH8.0,500mM NaCl, 2mMEDTA), carrying out ultrasonic bacteria breaking.Centrifugal collection inclusion body.With the resuspended inclusion body of solution B (20mMTris-HCl, pH8.0,500mM NaCl, 2mM EDTA, 2%TritonX-100,2%Tween20), repeat 3 times.With solution C (20mM Tris, pH8.0,10mM NaCl, 8M Urea) dissolving inclusion body.The centrifugal 20min of 16000rpm/min gets supernatant.Supernatant is concentrated with the 30KD concentration tube, and under collection membrane, solution dilution is to 0.1mg/ml, and adding molecular cut off is in the bag filter of 3kD, put into the dialysis buffer liquid A (20mMNaH2PO4-Na2HPO4 of 4 ℃ of pre-coolings, pH7.2,25mMNaCl, 10% glycerol, 0.2% beta-mercaptoethanol) in, dialysed overnight is transferred to bag filter dialysis buffer liquid B (20mM NaAc-HAc, the pH5.2 of 4 ℃ of pre-coolings, 0.2% beta-mercaptoethanol) in, dialysed 4-5 hour.Take out solution in bag filter, the centrifugal 20min of 12000rpm/min collects supernatant, measures the activity of refolded protein, and the activated albumen that obtains is concentrated into 5mg/ml.
(3) protein active detects
utilize FRET (fluorescence resonance energy transfer) (fluorescence resonance energy transfer, FRET) technical measurement is for the activity of the inhibitor of HIV-1 protease, according to HIV-1 protease recognition site design substrate: MCA-gama-abu-Ser-Gln-Asn-Tyr-Pro-Ile-Val-Gln-Glu-Lys-Dnp, when inhibitor is not done the used time to HIV-1 protease, HIV-1 protease can cut substrate, quenching group (Dnp) is away from fluorophor (MCA), fluorophor absorbs the 320nm wavelength, inspire the wavelength of 405nm, by the detector fluorescence intensity, if inhibitor has effect to HIV-1 protease, quenching group can not cut, the ripple rear portion energy that fluorophor absorbs 320nm can be transferred to quenching group, the excitation wave intensity of 405nm will weaken, detect inhibitor to the inhibition of HIV-1 protease with this.
Protein concentration is diluted to 500nM, substrate 20 μ M, fluorescence intensity.Each reaction system 100 μ L first adds albumen 97 μ L and the 1 alternative sample blending of μ L, then adds substrate to start reaction, and measures immediately, surveys once every 3 seconds, surveys 3 minutes, will design simultaneously the experiment of feminine gender and positive control.For every kind of alternative sample parallel assay three times.Calculate alternative sample to the enzymeinhibition effect according to the initial velocity of course of reaction curve.Negative control, reaction rate is decided to be V0, and the initial velocity of experimental group reaction is decided to be Vi.Vi/V0 reflects the residual activity of albumen, and 1-Vi/V0 is that medicine is to the suppression ratio of albumen.
Filter out for the first time residual activity lower than 50% the positive result of alternative sample, also need to get rid of false positive by the method for fluorescent quenching.The method that adopts is first with albumen and substrate mixing, reacts completely, and when fluorescent value reaches maximum, adds alternative sample in system, again measures fluorescent value.Add the alternative sample of change calculations of fluorescent value before and after reaction system to the cancellation rate of product fluorescence by alternative sample.Reaction is reached peaked fluorescent value be decided to be Q, after adding alternative sample, fluorescent value is decided to be Qi, and alternative sample is (Q-Qi)/Q to the cancellation rate of product fluorescence.Lower than 50%, the cancellation rate is further measured lower than 30% alternative sample for residual activity.Alternative sample is diluted with 2 times of Concentraton gradient with 95%DMSO, measure the IC that alternative sample suppresses albumen
50Value.
After with 1.4 times of amount distilled waters, it being disperseed 30 gram 95% ethanol extractions of sausage bean, pour in separatory funnel, extract with petroleum ether, dichloromethane, ethyl acetate and n-butyl alcohol successively, shake well, standing 6 hours, every kind of solvent extraction 3 times, separate organic facies and water, extract is concentrated with EYELA N1001 type Rotary Evaporators, the dried paste sausage bean petroleum ether, dichloromethane, ethyl acetate and the n-butanol extraction sample that obtain are as screening and the sample separation of hiv protease vitro inhibition agent.
The inhibition of the extract of the above four kinds of solvents of test to hiv protease under the drug level of 0.5mg/ml finds that acetic acid ethyl ester extract has inhibition preferably active, is next step separation and purification sample therefore select acetic acid ethyl ester extract.
Above-mentioned acetic acid ethyl ester extract is used etc. the silica gel mixed sample of weight, grind and evenly after, select 10 times of normal-phase chromatography silica gel to example weight to separate with the normal pressure post, obtain respectively eight parts of F1-F8.F1-F8 is carried out determination of activity, and the suppression ratio to hiv protease under 0.5mg/ml is 32.91%, 46.45%, 49.91%, 82.91%, 72.55%, 94.98%, 105.18%, 106.89% successively.Choose F6 and do further separation and purification with sephadex LH-20 gel column chromatography spectrum method, obtain a monomeric compound, this compound is white powder (methanol), and fusing point is 227 ℃, and its nuclear magnetic resonance data is
1H-NMR ((CD
3)
2CO, 400MHz, δ, ppm): 7.09 (1H, d, J=1.6Hz, H-2), 6.99 (1H, d, J=16Hz ,-CH=CH-), 6.93 (1H, dd, J
1=8Hz J
2=2Hz, H-6), 6.86 (1H, d, J=16Hz ,-CH=CH-), 6.83 (1H, d, J=8Hz, H-5), 6.55 (2H, d, J=2Hz, H-2 ', 6 '), 6.29 (1H, t, J=2Hz, H-4 '); ESI-MS (m/z, %): M
+244 (100%).Above nuclear-magnetism and mass spectrometric data and document (N.R.Ferrigni and J.L.McLaughlin, Use Of Potato Disc And Brine Shrimp Bioassays To Detect Activity And Isolate Piceatannol As The Antileukemic Principle From The Seeds Of Euphorbza Lagascae, Journal of Natural Products, 1984,47 (2): the data of the piceatannol 347-352.) are basically identical, therefore infer that this compound is piceatannol.The structural formula of piceatannol is as follows:
Utilize the described method of embodiment 1 to measure piceatannol to the active IC of HIV-1 albumen enzymeinhibition
50Value is 59 μ M.
Although illustrated and described embodiments of the invention, for the ordinary skill in the art, be appreciated that without departing from the principles and spirit of the present invention and can carry out multiple variation, modification, replacement and modification to these embodiment, scope of the present invention is limited by claims and equivalent thereof.
Claims (4)
1. the application of diphenylethylene compounds in the medicine for preparing treatment and prevent AIDS, the structural formula of wherein said diphenylethylene compounds is:
Wherein, R
1, R
2, R
3, R
4, R
5Or R
6Represent independently hydrogen, hydroxyl, C
1-C
4Alkyl, C
1-C
4Alkoxyl, C
1-C
4Acyloxy, halogen, nitro, trifluoromethyl or cyano group, precondition is R
1, R
2And R
3In be one of at least hydroxyl and R
4, R
5And R
6In be one of at least hydroxyl.
2. application according to claim 1, wherein said R
1, R
2, R
3, R
4, R
5Or R
6Represent independently hydrogen or hydroxyl.
3. application according to claim 1, wherein said diphenylethylene compounds are piceatannol.
4. the described application of any one according to claim 1～3, wherein said application are the application of diphenylethylene compounds aspect preparation HIV-1 protease inhibitor.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011104113734A CN103156827A (en) | 2011-12-09 | 2011-12-09 | Application of stilbene compounds in treating and preventing AIDS |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011104113734A CN103156827A (en) | 2011-12-09 | 2011-12-09 | Application of stilbene compounds in treating and preventing AIDS |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103156827A true CN103156827A (en) | 2013-06-19 |
Family
ID=48580694
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011104113734A Pending CN103156827A (en) | 2011-12-09 | 2011-12-09 | Application of stilbene compounds in treating and preventing AIDS |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103156827A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1398838A (en) * | 2001-07-26 | 2003-02-26 | 中国人民解放军军事医学科学院放射医学研究所 | Diphenylethylene compound and its prepn and application in preventing and treating diabetes |
| CN1977852A (en) * | 2005-12-07 | 2007-06-13 | 周亚伟 | Medicinal composition containing stilbene total glycoside and its use for pharmaceutical treating hepatitis B |
| WO2010033986A2 (en) * | 2008-09-22 | 2010-03-25 | Regents Of The University Of Minnesota | Dna cytosine deaminase inhibitors |
-
2011
- 2011-12-09 CN CN2011104113734A patent/CN103156827A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1398838A (en) * | 2001-07-26 | 2003-02-26 | 中国人民解放军军事医学科学院放射医学研究所 | Diphenylethylene compound and its prepn and application in preventing and treating diabetes |
| CN1977852A (en) * | 2005-12-07 | 2007-06-13 | 周亚伟 | Medicinal composition containing stilbene total glycoside and its use for pharmaceutical treating hepatitis B |
| WO2010033986A2 (en) * | 2008-09-22 | 2010-03-25 | Regents Of The University Of Minnesota | Dna cytosine deaminase inhibitors |
Non-Patent Citations (1)
| Title |
|---|
| HONG-WEI LIN等: "Anti-HIV Activities of the Compounds Isolated from Polygonum cuspidatum and Polygonum multiflorum", 《PLANTA MED》 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Ovenden et al. | Globoidnan A: a lignan from Eucalyptus globoidea inhibits HIV integrase | |
| Rittà et al. | Antiviral activity of a Arisaema tortuosum leaf extract and some of its constituents against herpes simplex virus type 2 | |
| CN1950376A (en) | Curcumol derivatives, compositions comprising the same and use in manufacture of medicament | |
| CN112409310B (en) | Compound with LSD1 inhibitory activity, preparation method and application | |
| Cho et al. | Prenylated phenolic compounds from the leaves of Sabia limoniacea and their antiviral activities against porcine epidemic diarrhea virus | |
| CN112457281B (en) | Small molecule inhibitor for blocking combination of COVID-19 spinous protein and human angiotensin converting enzyme 2 and application thereof | |
| CN101921823B (en) | Method for screening SARS corona virus major protease inhibitor from traditional Chinese medicine and screened SARS corona virus major protease inhibitor | |
| WO2022262820A1 (en) | Group of imb-c5 series compounds having anti-coronavirus activity and application thereof | |
| Yu et al. | In vitro immunocompetence of two compounds isolated from Polygala tenuifolia and development of resistance against grass carp reovirus (GCRV) and Dactylogyrus intermedius in respective host | |
| CN113332363A (en) | Application of tea extract and composition thereof in resisting coronavirus | |
| CN106214677B (en) | A kind of single carbonyl curcumin class compound application in preparation of anti-tumor drugs replaced containing allyl | |
| CN113735814B (en) | Myrtle ketone compound and application thereof in preparation of anti-influenza virus drugs | |
| CN102304158A (en) | Acylated flavonoid glycoside compounds and application thereof in preparation of complement inhibitor medicines | |
| Morales-Salazar et al. | Synthesis of bis-furyl-pyrrolo [3, 4-b] pyridin-5-ones via Ugi–Zhu reaction and in vitro activity assays against human SARS-CoV-2 and in silico studies on its main proteins | |
| Nematollahi et al. | Antiviral and antimicrobial applications of chalcones and their derivatives: From nature to greener synthesis | |
| CN103156827A (en) | Application of stilbene compounds in treating and preventing AIDS | |
| CN103127040B (en) | Magnolia cortex P.E is applied in the medicine of preparing treatment and prevent AIDS | |
| CN107438433A (en) | Containing 2 methoxyl groups 4 (3 (4 methoxyphenyls) the third 1 base of alkene 1) phenol as the anti-curing arthritis of active component or the pharmaceutical composition of inflammatory disease | |
| CN103908447B (en) | The application of shrubby sophora extract and Vexibinol in anti-EV71 virus infection | |
| CN103156868A (en) | Application of stilbene glucosides in treating and preventing AIDS | |
| Brand et al. | Combretastatin A-4: The Antitubulin Agent that Inspired the Design and Synthesis of Styrene and Spiroisatin Hybrids as Promising Cytotoxic, Antifungal and Antiviral Compounds | |
| CN103156907B (en) | The pharmaceutical applications of Chinese medicine sausage beans and its extract | |
| US9629822B2 (en) | Flavonoid based antiviral targets | |
| WO2004033443A1 (en) | Halogen substituted hexahydroxy biphenyl derivatives, their preparation and their uses as medicament | |
| CN104814973B (en) | Application in the drug of diseases associated with inflammation of the Cappariloside A in preparation for treating influenza and influenza virus mediation |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| RJ01 | Rejection of invention patent application after publication |
Application publication date: 20130619 |
|
| RJ01 | Rejection of invention patent application after publication |