CN103146833A - Fluorogenic quantitative PCR (polymerase chain reaction) kit for detecting mice SEPS1 (selenoprotein) gene - Google Patents
Fluorogenic quantitative PCR (polymerase chain reaction) kit for detecting mice SEPS1 (selenoprotein) gene Download PDFInfo
- Publication number
- CN103146833A CN103146833A CN2013100935940A CN201310093594A CN103146833A CN 103146833 A CN103146833 A CN 103146833A CN 2013100935940 A CN2013100935940 A CN 2013100935940A CN 201310093594 A CN201310093594 A CN 201310093594A CN 103146833 A CN103146833 A CN 103146833A
- Authority
- CN
- China
- Prior art keywords
- seps1
- gene
- mouse
- kit
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a fluorogenic quantitative PCR (polymerase chain reaction) kit for detecting mice SEPS1 (selenoprotein) gene. The kit comprises the following constituents: specific primers, a specific probe, a standard DNA template, a fluorogenic quantitative PCR reaction liquid and a negative quality control standard substance. The invention further discloses an application method of the fluorogenic quantitative PCR kit for detecting mice SEPS1 gene expression level. The kit is utilized to rapidly detect the expression quantity of the SEPS1 gene in a ration manner, so that the pyemic generating condition is detected.
Description
Technical field
The present invention relates to the method for preparation and use of gene detecting kit.Particularly, the present invention relates to classify the basis as with the nucleotides sequence of mouse SEPS1 gene, design specific oligonucleotide primer and fluorescence labeling probe, adopt the pyemic detection kit of Real-Time Fluorescent Quantitative PCR Technique assembling, the present invention also relates to its detection method.
Background technology
Selenoprotein S1 (SEPS1) is that a kind of newfound stress reaction and inflammation to endoplasmic reticulum controlled the gene that works.Recent result of study shows that SEPS1 and the generation existence of inflammatory cytokine directly contact, and may play a major role in other dysimmunity of inflammation mediated insulin-dependent diabetes mellitus and some.
The mechanism of many common diseases has all comprised immune activation, for example diabetes, tumour and cardiovascular disorder.The nearest result that studies show that the inflammatory reaction continuous action is the generation that causes these diseases.Cell is exposed to meeting activate immunity under stressed condition, causes thus short inflammatory factor level rising in circulation, and this lowers relevant to the SEPS1 gene.
SEPS1 also plays an important role in resisting potential metabolic stress at protection endoplasmic reticulum functional completeness.SEPS1 is classified as a new reticulon, participates in misfolded protein matter is transported to lysosome by endoplasmic reticulum, carries out ubiquitin and degraded by proteasome in lysosome.SEPS1 also participates in regulating cellular oxidation reduction balance and protecting endoplasmic reticulum to avoid the deleterious effect of oxidative stress simultaneously.When the endoplasmic reticulum function was impaired, the untoward reaction that damage causes was to lure some genetic expressions into, will cause the activation of transcription factor NF-KB.The NF-KB of activation enters nucleus, activates the genetic transcription that comprises the pro-inflammatory cytokine of encoding.[Kryukov?GV，?et?al.Characterization?of?mammalian?selenoproteomes.Science，2003，(300)：1439-1443]
Mankind SEPS1 gene is positioned at karyomit(e) 15q26.3, comprises 6 exons, and encoding one has 189 amino acid whose protein.No. 15 chromosomal these zones were considered to comprise the quantitative trait locus (quantitative trait loci QTLs) that affects inflammatory diseases in the past, these inflammatory diseasess comprise insulin-dependent diabetes mellitus, Alzheimer ' s disease and coeliac disease.SEPS1 might be the multifarious functional factor of inflammation related disease and positional factor like this.[Zamani，M.，Pociot，F.，Raeymaekers，P.，Nerup，J.&?Cassiman，J.J.Linkage?of?type?I?diabetes?to?15q26(IDDM3)in?the?Danish?population.Hum.Genet.1996?98，491-496；Field，L.L.，Tobias，R.&?Magnus，T.A?locus?on?chromosome?15q26(IDDM3)produces?susceptibility?to?insulin-dependent?diabetes?mellitus.Nat.Genet.19948，189-194.]。
Sepsis is one of the most ancient disease, and over nearly 50 years, sickness rate and case fatality rate raise gradually, has report to ask that morbidity had increased by 300% in 1979-1999, and the whole world approximately has 1400 people to die from this disease every day at present.Gram-negative bacteria (G
-) to infect be to cause one of pyemic major reason, G
-The activeconstituents intracellular toxin (endotoxin) of bacterium adventitia is lipopolysaccharides (lipop0lysaccharide, LPS) with the various kinds of cell films such as scavenger cell, endotheliocyte on after corresponding receptor acting, start the intracellular signal conducting system, final nuclear transcription factor-kappa B (the nuclear factor κ B that activates, NF-κ B), cause expression and the release of cytokine profiles and inflammatory mediator (TNF, IL-I β, IL-6 etc.), cause vascular permeability to increase, body fluid oozes out with lymphocytic migration to inflammation part.This defensive raction of body is conducive to remove pathogenic bacteria, but as overreact, can cause " cascade of response of inflammation " or with the severe inhibition of immunologic function, be systemic inflammatory response syndrome or compensatory anti-inflammatory response syndromes (compensatory anti-inflammatory reaction syndrome, CARS), show as Sepsis, septic shock is multiple organ dysfunction syndrome (multiple organ dysfunction syndrome, MODS) even.
Summary of the invention
The purpose of this invention is to provide a kind of detect mouse SEPS1 gene expression dose PCR kit for fluorescence quantitative and using method, this PCR test kit is suitable for existing at present all types fluorescence quantitative gene extender on market, highly sensitive, quantitatively quick and precisely, good stability, have a good application prospect.
Another object of the present invention is to be to provide a kind of PCR kit for fluorescence quantitative that the mouse Sepsis is detected fast.
To achieve these goals, the mouse SEPS1 gene conserved sequence that the present invention provides according to GenBank adopts ABI primer Express 2.0 software design probe and primers.Special primer and probe title and sequence are: the upstream primer sequence is SEQ ID NO.1 TGGAGACCGAGAGCCTGCGA, the downstream primer sequence is SEQ ID NO.2 CGGCTTGGTCCAGCTGTCTCT, and probe is: FAM-GCGGGAAGCT CTTGCAGATT-TAMRA.Wherein FAM is Fluoresceincarboxylic acid, is to be marked at 5 ' end fluorogene; TAMRA is fluorescence dye, is the fluorescent quenching group that is marked at 3 ' end.
The present invention has also prepared the positive control recombinant plasmid of mouse SEPS1 gene.The preparation process method is as follows: the total RNA that uses TRNzol reagent extracting Sepsis murine liver tissue, then carry out reverse transcription reaction, the reverse transcription system is: upstream primer SEQ ID NO.1 (2 μ mol/L) 1 μ l, 5 * the first chain damping fluid 4 μ l, dNTP mixture (every kind of 2.5mmol/L) 4 μ l, 0.1mol/L DTT2 μ l, SuperScript RNase H reversed transcriptive enzyme (200U/ μ l) 2 μ l.Reaction conditions is: 37 ℃ of water-baths 60 minutes, 95 ℃ of water-baths 3 minutes.The cDNA that reverse transcription reaction is obtained carries out conventional pcr amplification, cuts glue after the PCR product detects and reclaims and purifying, and purified product is connected on the PGM-T cloning vector, is transformed into subsequently in DH5 α competent cell.It is the Auele Specific Primer screening positive clone of SEQ ID NO.1 and SEQ ID NO.2 by sequence.Extract plasmid DNA after the positive colony amplification, plasmid DNA adopts quantitatively (NanoDrop Technologies of NanoDrop ND-1000 nucleic acid quantification instrument, Wilmington, Delaware) and do 10 times of serial dilutions as the preparation of standard substance for typical curve.
The present invention has also prepared a kind of PCR kit for fluorescence quantitative that detects mouse SEPS1 gene expression dose, and component is as follows: Auele Specific Primer, specific probe, standard DNA template, fluorescence quantitative PCR reaction solution, negative quality control standard product.Wherein said Auele Specific Primer comprises upstream primer and downstream primer, and the upstream primer sequence is SEQ ID NO.1 TGGAGACCGAGAGCCTGCGA, and the downstream primer sequence is SEQ ID NO.2 CGGCTTGGTCCAGCTGTCTCT, and the amplicon size is 153bp.Specific probe is SEQ ID NO.3:5 ' FAM-TGCTGGCCAGCTATGGCTGG-TAMRA3 '.Fluorescence quantitative PCR reaction solution is Hot-start Taq archaeal dna polymerase (2.5U/ μ l), 10 * buffer of Hot-start Taq archaeal dna polymerase and dNTP mixture (every kind of 10mmol/L).
the invention also discloses a kind of detect mouse SEPS1 gene expression dose the using method of PCR kit for fluorescence quantitative as follows: quantitative fluorescent PCR system: Hot-start Taq archaeal dna polymerase (2.5U/ μ l) 1 μ l, 10 * buffer, the 5 μ l of Hot-start Taq archaeal dna polymerase, dNTP mixture (every kind of 10mmol/L) 1 μ l, upstream primer (10 μ mol/L), downstream primer (10 μ mol/L), each 1 μ l of specific probe (5 μ mol/L), sample cDNA 5 μ l or standard plasmid DNA 2 μ l or negative quality control standard product 5 μ l add ionized water to 50 μ l.The quantitative fluorescent PCR program: 5 ℃ of 10min denaturations connect 45 circulations: 95 ℃ of 40s, 60 ℃ of 1min.
The present invention has also detected this test kit susceptibility, and result shows that this test kit sensing range is 10
7-10
2Copies/ μ l, minimum concentrations are 10
2Copies/ μ l.
Find the negative Detection accuracy 95% of this test kit by sample detection of the present invention, positive accuracy rate is 100%.Continuous 3 repeated experiments, experimental result is stable, and the variation coefficient is less than 1.5%.
Description of drawings
Fig. 1 is the variation of Sepsis murine liver tissue SEPS1 albumen.
Fig. 2 is that Sepsis murine liver tissue SEPS1 histological chemistry is detected.
Fig. 3 is that the Sepsis mouse lung organizes SEPS1 histological chemistry to detect.
Fig. 4 utilizes the fluorescent quantitation typical curve for preparing after positive DNA fragmentation gradient dilution: Y=-3.39X+42.7, R=0.993.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.The experimental technique of unreceipted actual conditions in the following example is usually according to normal condition or the condition of advising according to manufacturer.
Embodiment 1 SEPS1 albumen is crossed in the Sepsis mouse and is expressed
1, the foundation of Sepsis mouse model
Experiment mice than C mouse (available from the medical university's Experimental Animal Center of coordinating), cleans level, body weight 17～20g for bar.Raised 3 days at our unit's Animal Lab. after mouse is bought, room temperature is kept 22～25 ℃.
The foundation of Sepsis mouse model: 12h mouse fasting before experiment, freely drink water, intraperitoneal injection intracellular toxin 10mg/kg, single cage is raised.60 mouse are chosen at random to 10 endotoxin injections not, and as a control group, all the other make Sepsis models.
Live after Normal group anesthesia and kill, after Sepsis group mouse peritoneal endotoxin injection 10mg/kg, respectively at 6h, 12h, 24h, 48h specimen taken, each time point is no less than 10 animals.
2, Western Blot immunoblotting detects murine liver tissue SEPS1 protein expression
1) tissue cracking and protein quantification: hepatic tissue shreds in the glass homogenizer that is placed on precooling, grinds after adding the cell pyrolysis liquid of precooling.100mg tissue/ml lysate, fully cracking, ice bath 30min, 12000g, 4 ℃ of centrifugal 5min draw supernatant (including plasmosin), packing, the every pipe of 200-300 μ l is placed in-20 ℃ of preservations (short-term preservation can 4 ℃) immediately.Stay a little sample to carry out determination of protein concentration.Adopt Bradford Xylene Brilliant Cyanine G method, by measuring the absorbance at 595nm place, carry out quantification of protein.
2) gel preparation: formula is seen the molecular cloning handbook, the rapid implantation glass of separation gel sheet separation, and cover one deck tri-distilled water, be placed in room temperature.After 30min, pour out tectum water, filter paper blots.Record spacer gel.Insert immediately comb.
3) electrophoresis: with protein sample (20 μ g) and equal-volume 2 * sds gel sample-loading buffer mixing, boil 3min so that protein denaturation 100 ℃ of water-baths.After spacer gel polymerization fully, pull out the comb loading.Electrophoresis carries out in the Tris-glycine buffer, and applied voltage is: spacer gel 120V, separation gel 140V.Treat that the bromjophenol blue electrophoresis to gel bottom termination electrophoresis, takes off gel.
4) transferring film: standby 6 Whatman 3M filter paper and a nitrocellulose filter, size is consistent with gel.Nitrocellulose filter is floated on transfering buffering liquid, after borrowing wicking action to make it to soak from bottom to top, 6 filter paper are immersed in equilibrium at room temperature 30min in damping fluid together with gel.Transfer device is installed, is kept flat lower electrode (anode), graphite faces up, and stacks one by one 3 filter paper that soaked damping fluid of Accurate align, makes cylinder to extrude all bubbles with glass stick.Then nitrocellulose filter accurately is placed on filter paper, guaranteeing does not have bubble between filter paper and film.Again gel accurately is placed on film.The gel lower left corner is placed on the mark angle of film, wears gloves and discharges all bubbles.Another 3 filter paper that soaked damping fluid are placed on gel, guarantee equally each layer alignment and do not stay bubble.Place upper electrode (negative electrode), graphite faces down.Connect power supply, anode (redness) wire connects the bottom Graphite Electrodes.According to the gel area according to the 0.65mA/cm2 making current, electrotransfer 2h, complete confirm protein delivery to nitrocellulose filter with the Ponceau S dye liquor afterwards.
5) sealing of cellulose membrane and hybridization: the immunoglobulin (Ig) binding site of sealing nitrocellulose membrane.Confining liquid is 10% skim-milk solution of 1 * TBST preparation, nitrocellulose filter is put into the plastics bag that can add heat sealing, added confining liquid according to the filter membrane area by 0.1ml/cm2, discharge as far as possible the bubble of the inside, then seal sack, lie in 37 ℃ of shaking table 1h.After taking-up, added primary antibodie 1: 300,4 ℃ are spent the night.Cut off plastics bag, the primary antibodie of inclining, PBS rinsing filter membrane 3 times, each 10min.Add two to resist, working fluid concentration 1: 1000, then the bubble inside discharging as far as possible seals sack, lies in 37 ℃ of shaking table 1h.Cut off plastics bag, the deblocking liquid and two that inclines resists, PBS rinsing filter membrane 3 times, each 10min.Luminescence reagent colour developing, the X-ray 1min that exposes thereon rinses scanning imagery.
3, immunohistochemical method detects SEPS1 protein expression in liver and lungs
The immunohistochemical staining step:
1) paraffin section de-waxing is to water.
2) 3%H
2O
2Incubated at room 5～10 minutes is to eliminate the activity of endogenous peroxydase.
3) distilled water flushing, PBS soaked 5 minutes
4) 5～10% normal goats serum (PBS dilution) sealing, incubated at room 10 minutes.
5) serum deprivation that inclines is not washed, and drips primary antibodie (Anti-SEPS1, Sigma company), and 4 ℃ are spent the night.
6) PBS rinses, 5 minutes * 3 times.
7) biotin labeling two anti-(1%BSA-PBS dilution), hatched 10～30 minutes for 37 ℃;
8) PBS rinses, 5 minutes * 3 times.
9) drip s-generation horseradish enzyme labelling strepto-avidin working fluid, 37 ℃ or incubated at room 10～30 minutes.
10) PBS rinses, 5 minutes * 3 times.
11) chromogenic reagent (DAB or AEC).
12) tap water fully rinses, and redyes mounting.
4, Western Blot detects Sepsis murine liver tissue SEPS1 protein expression rule
Actin is internal reference.A small amount of SEPS1 protein expression is arranged in the normal control animal liver tissue.Intracellular toxin is attacked the Sepsis mouse liver SEPS1 protein expression that causes and is significantly raise, and in the rear 24h peaking of wound.(Fig. 1).
5, SEPS1 protein expression situation in liver
Paraffin section immunohistochemical study result shows that brown color is the positive position of SEPS1 protein expression.A small amount of SEPS1 protein expression (0h) is arranged in the normal control animal liver tissue.Intracellular toxin is attacked and to be caused Sepsis mouse liver SEPS1 protein expression and increases gradually, and after wound the 24h～48h peaking (24h), show as brown color positive position and increase (Fig. 2).
6, SEPS1 protein expression situation in lungs
Paraffin section immunohistochemical study result shows that brown color is the positive position of SEPS1 protein expression.Minute quantity SEPS1 protein expression (0h) is only arranged in normal control animal lung tissue.Intracellular toxin is attacked and to be caused Sepsis mouse lungs SEPS1 protein expression and increases gradually, and after wound the 24h～48h peaking, show as brown color positive position and increase (Fig. 3).
Show by above-mentioned result of study, when mouse suffered from Sepsis, the SEPS1 expressing quantity compared with normal murine liver tissue of murine liver tissue and lung tissue and the SEPS1 expressing quantity of lung tissue significantly raise.Because SEPS1 protein expression amount is to be controlled by the expression level of SEPS1 gene, so we can pass through to detect the expression amount of SEPS1 gene as an index of diagnosis of sepsis disease.
2 one kinds of preparations that detect the PCR kit for fluorescence quantitative of mouse SEPS1 gene of embodiment
1, the PCR kit for fluorescence quantitative of mouse SEPS1 gene forms
Wherein, Hot-start Taq archaeal dna polymerase and 10 * buffer are available from sky Time Inc., and the dNTP mixture is available from Promega company.
2, design of primers and probe are synthetic
According to the mouse SEPS1 gene conserved sequence that GenBank provides, adopt ABI primer Express 2.0 software design probe and primers.Special primer and probe title and sequence are: the upstream primer sequence is SEQ ID NO.1TGGAGACCGAGAGCCTGCGA, and the downstream primer sequence is SEQ ID NO.2
CTGGATGC ATGTATGATGTG, probe is: 5 ' FAM-
TGCTGGCCAGCTATGGCTGG-TAMRA3’。Wherein FAM is Fluoresceincarboxylic acid, is to be marked at 5 ' end fluorogene; TAMRA is fluorescence dye, is marked at 3 ' end, and in the time of the fluorescent quenching reporter group, TAMRA self can be at higher wavelength place emitting fluorescence.Above-mentioned sequence and probe are synthetic by Invitrogen company.
3, the preparation of the positive control recombinant plasmid of mouse SEPS1 gene
To specifications, use total RNA of TRNzol reagent (available from Invitrogen company) extracting Sepsis murine liver tissue, then carry out reverse transcription reaction, the reverse transcription system is: upstream primer SEQ ID NO.1 (2 μ mol/L) 1 μ l, 5 * the first chain damping fluid 4 μ l, dNTP mixture (every kind of 2.5mmol/L) 4 μ l, 0.1mol/L DTT2 μ l, SuperScript RNase H reversed transcriptive enzyme (200U/ μ l) 2 μ l (available from Invitrogen company) reaction conditions is: 37 ℃ of water-baths 60 minutes, 95 ℃ 3 minutes.
The cDNA that reverse transcription reaction is obtained carries out conventional PCR reaction, reaction system and condition are as follows: 10 * Ex Taq buffer 10ul, dNTP Mixture (each 2.4mM) 4ul, Sequence NO.1 (10pmol) 4ul, Sequence NO.2 (10pmol) 4ul, cDNA (0.1-2ug) 5ul, Ex Taq archaeal dna polymerase 0.5ul, the distilled water polishing is to 100ul.Reaction conditions is 94 ℃ of denaturation 5min; 94 ℃ of sex change 50s, 50 ℃ of annealing 50s, 72 ℃ are extended 50s, 35cycles; Last 72 ℃ are extended 10min.
5 μ l take a sample, product to pcr amplification carries out the agarose gel electrophoresis detection, cut glue and reclaim also purifying (recovery use test kit: EZ-10Spin Column DNA Gel Extraction Kit), purified product is connected to the PGM-T cloning vector, is transformed into subsequently in DH5 α competent cell.It is the Auele Specific Primer screening positive clone of SEQ ID NO.1 and SEQ ID NO.2 by sequence.Extract plasmid DNA after the positive colony amplification, plasmid DNA adopts quantitatively (NanoDrop Technologies of NanoDrop ND-1000 nucleic acid quantification instrument, Wilmington, Delaware) and do 10 times of serial dilutions and be used for the preparation of typical curve as standard substance (the standard plasmid concentration range is 10
9-10
1Copies/ μ l).
4, the foundation of quantitative criterion curve
After the recombinant plasmid that builds is measured dilution, calculate copy number/ml, 10 times of doubling dilutions become 10
9-10
1Copy/ml concentration gradient, each concentration is parallel adds 3 reaction tubess to carry out simultaneously the fluorescent quantitation amplification, reaction is carried out on BIO-RAD CFX (Bio-Rad Laboratories USA) real-time fluorescence quantitative PCR instrument, 50 μ l reaction systems comprise: Hot-start Taq archaeal dna polymerase (2.5U/ μ l) 1 μ l, 10 * buffer7 μ l of Hot-start Taq archaeal dna polymerase, dNTP mixture 1 μ l, Auele Specific Primer SEQ ID NO.1, Auele Specific Primer SEQ ID NO.2, each 1 μ l of specific probe, deionized water polishing to 50 μ l.Response procedures is: 95 ℃ of 10min denaturations connect 45 circulations: 95 ℃ of 40s, 60 ℃ of 1min.Sterilized water is used for negative control, repeats 3 times, computer automatic drafting typical curve after reaction finishes, detected result is carried out data analysis by Bio-Rad CFX Manager software and Excel, obtain typical curve: Y=-3.39X+42.7, R=0.993 (Fig. 4), initial masterplate is 10
7-10
3Better linear during copy/ml.
5, the preparation of negative control
Use the RNA in RNA extraction agent box (Beijing hundred Tyke Bioisystech Co., Ltd) extracting Normal group murine liver tissue, carry out reverse transcription reaction, obtain cDNA, as negative control.Detect the integrity of this cDNA by amplification house-keeping gene GAPDH (primer is available from TAKARA company), PCR product electrophoresis result is obvious, and this cDNA is complete, can be used as negative control.
6, sensitivity experiments
Getting that recombinant plasmid dilutes in proportion is 10
5, 10
4, 10
3, 10
2, 10,1 copy/ml, carry out quantitative fluorescent PCR, the detection sensitivity take the minimum concentration of test positive as the method.The method sensing range that this institute sets up is 10
7-10
2Copies/ μ l, minimum concentrations are 10
2Copies/ μ l.
The detection method of embodiment 3 mouse SEPS1 genes
A kind of detection method of mouse SEPS1 gene comprises the extraction of sample RNA, the preparation of sample cDNA, the amplification of SEPS1 gene, and its concrete steps are as follows:
The extraction of 1 sample RNA
Press the RNA that Trizol test kit specification sheets extracts mouse liver and lungs, prove the integrity of RNA by gel electrophoresis, measure concentration and the purity of RNA with the nucleic acid-protein instrument.Employing Shanghai China Shun biotechnology company limited total RNA extraction agent box extracts.Main operational steps is as follows:
(1) with cell pyrolysis liquid BL cracking histocyte, confluent monolayer cells on centrifuging and taking.The Trizol that adds 1ml in upper confluent monolayer cells is with lashing lysate 10 times with the disposable syringe of syringe needle, room temperature 5 minutes.
(2) after standing 5 minutes, add the chloroform of 200 μ l, after firmly putting upside down the centrifuge tube mixing, room temperature is standing makes it layering, and centrifugal 5 minutes of 12000g carefully pipettes water to the centrifuge tube of 1.5ml.
(3) add isopyknic Virahol, thoroughly after mixing, take out 750 μ l and move into adsorption column, centrifugal 30 seconds, outwell the liquid in collection tube, adsorption column is moved in same collection tube, all will enter in adsorption column centrifugal 30 seconds with remaining.Outwell the liquid in collection tube, adsorption column is moved in same collection tube.
(4) add 500 μ L RP liquid, centrifugal 30 seconds.Outwell the liquid in collection tube, adsorption column is moved in same collection tube.
(5) with the W3 liquid of 500 μ l, standing 1 minute, centrifugal 15 seconds.
(6) adsorption column is moved in a clean collection tube, add 500 μ l W3 liquid, centrifugal 15 seconds.
(7) outwell liquid in collection tube, then adsorption column is moved in same collection tube centrifugal 1 minute.
(8) adsorption column is put into the centrifuge tube of another clean 1.5ml, central authorities add 50 μ l pure water at adsorption film, and room temperature is after standing 1 minute, centrifugal 1 minute.RNA is stored in-70 ℃.
(9) total RNA integrity is identified: get 2 μ l RNA samples at 1.5% agarose gel electrophoresis (80v, 15min), after telling district's band, the Zone electophoresis band is observed in EB dyeing under ultraviolet lamp.
(10) measure concentration and the purity of RNA with the nucleic acid-protein instrument
The preparation of 2 sample cDNA
Test kit (MMLV First Strand cDNA Synthesis Kit) is used in the reverse transcription of RNA, wherein RNase Inhibitor and M-MuLV Reverse Transcriptase need be placed on ice, other reagent are (as 5 * Reaction Buffer, dNTP Mix, Oligo-p (dT) 18 Primer) the room temperature thawing.Must wear disposable PE gloves during test operation.The relevant equipment of RNA test must prevent the pollution of RNase.All reagent thawings are placed on ice, carry out short centrifugal before use.Concrete steps are as follows:
1. utilize the PCR pipe to be formulated as follows system on ice:
Template ribonucleic acid 1-5 μ g
Oligo(dT)18primer?1μl(0.5μg/μl)
Add DEPC water to 12 μ l
Mix gently, and short centrifugal 5s;
2.70 ℃ incubation 5min, cooled on ice 30s is short centrifugal afterwards;
3.PCR pipe is placed on ice, then adds wherein:
5×reaction?buffer?4μl
RNase?inhibitor?1μl(20U/μl)
dNTPMix2μl(10mmol/l)
M-MuLV?Reverse?Transcriptase?1μl(20U/μl)
Add DEPC water to 20 μ l, mix gently, short centrifugal afterwards;
4.37 ℃ incubation 60min;
5.70 ℃ incubation 10min, 4 ℃ to finish reaction.The cDNA that reverse transcription obtains is placed in-20 ℃ of preservations.
The amplification of 3SEPS1 gene
Quantitative fluorescent PCR 50 μ l reaction systems comprise: cDNA template 2 μ l, Hot-start Taq archaeal dna polymerase (2.5U/ μ l) 1 μ l, 10 * buffer7 μ l of Hot-start Taq archaeal dna polymerase, dNTP mixture 1 μ l, Auele Specific Primer SEQ ID NO.1, Auele Specific Primer SEQ ID NO.2, each 1 μ l of specific probe, deionized water polishing to 50 μ l.The quantitative fluorescent PCR program is: 95 ℃ of 10min denaturations connect 45 circulations: 95 ℃ of 40s, 60 ℃ of 1min adopt NanoDrop ND-1000 nucleic acid quantification instrument amplification SEPS1 gene (NanoDrop Technologies, Wilmington, Delaware).
Embodiment 4 pattern detection
abdominal injection intracellular toxin 10mg/kg sets up 20 of the mouse of Sepsis model, respectively at 6h, 12h, 24h, 48h leaves and takes the hepatic tissue of mouse, get simultaneously the hepatic tissue of 10 normal mouses, use RNA extraction agent box to extract mouse liver RNA, carry out reverse transcription reaction, system and the condition of reverse transcription reaction are the same, carry out quantitative fluorescent PCR reaction (reaction system and reaction conditions are the same), 6 times are set, 4 of each times are parallel, with the positive contrast of recombinant plasmid, the negative contrast of cDNA of normal mouse liver tissue, water is blank, result shows that Sepsis mouse liver SEPS1 gene is maximum at 24h and 48h expression amount.Wherein, the expression amount of 6h SEPS1 gene is 3 times of negative control, the expression amount of 12h SEPS1 gene is 14 times of negative control, and it is 86 times of negative control that the expression amount of 24h SEPS1 gene increases suddenly, and the expression amount of 48h SEPS1 gene is 102 times of negative control.
abdominal injection intracellular toxin 10mg/kg sets up 20 of the mouse of Sepsis model, respectively at 6h, 12h, 24h, 48h leaves and takes the lung tissue of mouse, get simultaneously the lung tissue of 10 normal mouses, use RNA extraction agent box to extract mouse lungs RNA, carry out reverse transcription reaction, system and the condition of reverse transcription reaction are the same, carry out quantitative fluorescent PCR reaction (reaction system and reaction conditions are the same), 6 times are set, 4 of each times are parallel, with the positive contrast of recombinant plasmid, the negative contrast of the cDNA of normal mouse lung tissue, water is blank, the expression amount of result demonstration Sepsis mouse lungs SEPS1 gene and the expression trend of liver are consistent, also maximum at 24h and 48h expression amount.Wherein, the expression amount of 6h SEPS1 gene is 4 times of negative control, the expression amount of 12h SEPS1 gene is 19 times of negative control, and it is 102 times of negative control that the expression amount of 24h SEPS1 gene increases suddenly, and the expression amount of 48h SEPS1 gene is 121 times of negative control.
By to the liver of above-mentioned 10 normal mouses and lung tissue totally 20 duplicate samples, with the livers of 20 Sepsis mouse and lung tissue in totally 40 sample detection, result shows has 1 to be false positive in 20 normal mouse tissue samples, 40 Sepsis mouse samples are entirely positive, so the negative Detection accuracy of this test kit reaches 95%, positive rate of accuracy reached to 100%.Continuous 3 repeated experiments, experimental result is stable, the variation coefficient is less than 1.5%, show this kit test method stablize feasible, good reproducibility.
Above-described embodiment is the better embodiment of the present invention, but embodiments of the present invention are not restricted to the described embodiments.
Claims (7)
1. the Auele Specific Primer of a SEPS1 gene to reaching specific probe, is characterized in that, described Auele Specific Primer is classified SEQ ID NO.1 and SEQ ID NO.2 as to its nucleotides sequence, and the nucleotides sequence of specific probe is classified SEQ ID NO.3 as.
2. a PCR kit for fluorescence quantitative that detects mouse SEPS1 gene, is characterized in that, described test kit contain Auele Specific Primer claimed in claim 1 to and specific probe, also comprise standard DNA template and other conventional quantitative fluorescent PCR reagent.
3. a kind of PCR kit for fluorescence quantitative that detects mouse SEPS1 gene according to claim 1, also comprise: standard DNA template, negative quality control standard product, Hot-start Taq archaeal dna polymerase, its concentration is 2.5U/ μ l, 10 * buffer of Hot-start Taq archaeal dna polymerase, the dNTP mixture, every kind of NTP concentration is 10mmol/L.
4. the detection method of a mouse SEPS1 gene, comprise the extraction of sample RNA, the preparation of sample cDNA, the amplification of SEPS1 gene.
5. the detection method described according to claim 4, the concrete steps of the preparation of the wherein extraction of sample RNA, sample cDNA, the amplification of SEPS1 gene comprise:
1) extraction of sample RNA: press the RNA that Trizol test kit specification sheets extracts mouse liver and lungs, prove the integrity of RNA by gel electrophoresis, measure concentration and the purity of RNA with the nucleic acid-protein instrument.
2) preparation of sample cDNA:
A) utilize the PCR pipe to be formulated as follows system on ice:
Template ribonucleic acid 1-5 μ g
Oligo(dT)18primer1μl(0.5μg/μl)
Add DEPC water to 12 μ l
Mix gently, and short centrifugal 5s;
B) 70 ℃ of incubation 5min, cooled on ice 30s is short centrifugal afterwards;
C) the PCR pipe is placed on ice, then adds wherein:
5×reaction?buffer4μl
RNase?inhibitor1μl(20U/μl)
dNTPMix2μl(10mmol/l)
M-MuLV?Reverse?Transcriptase1μl(20U/μl)
Add DEPC water to 20 μ l, mix gently, short centrifugal afterwards;
D) 37 ℃ of incubation 60min;
E) 70 ℃ of incubation 10min, 4 ℃ to finish reaction.The cDNA that reverse transcription obtains is placed in-20 ℃ of preservations.。
3) amplification of SEPS1 gene:
Carry out fluorescent quantitative PCR SEPS1 gene take the cDNA of reverse transcription as template.Template 2 μ l wherein, Hot-start Taq archaeal dna polymerase (2.5U/ μ l) 1 μ l, 10 * buffer5 μ l of Hot-start Taq archaeal dna polymerase, dNTP mixture 1 μ l, Auele Specific Primer SEQ ID NO.1, Auele Specific Primer SEQ ID NO.2, each 1 μ l of specific probe SEQ ID NO.3, deionized water polishing to 50 μ l.The quantitative fluorescent PCR program is: 95 ℃ of 10min denaturations connect 45 circulations: 95 ℃ of 40s, 60 ℃ of 1min.
6. the primer of claim 1 and the probe application in preparation detection mouse SEPS1 kit gene.
7. mouse SEPS1 gene or the SEPS1 albumen application in the pyemic test kit of preparation detection mouse.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013100935940A CN103146833A (en) | 2013-03-22 | 2013-03-22 | Fluorogenic quantitative PCR (polymerase chain reaction) kit for detecting mice SEPS1 (selenoprotein) gene |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2013100935940A CN103146833A (en) | 2013-03-22 | 2013-03-22 | Fluorogenic quantitative PCR (polymerase chain reaction) kit for detecting mice SEPS1 (selenoprotein) gene |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103146833A true CN103146833A (en) | 2013-06-12 |
Family
ID=48545148
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2013100935940A Pending CN103146833A (en) | 2013-03-22 | 2013-03-22 | Fluorogenic quantitative PCR (polymerase chain reaction) kit for detecting mice SEPS1 (selenoprotein) gene |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103146833A (en) |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005026358A1 (en) * | 2003-09-18 | 2005-03-24 | Agt Biosciences Limited | Polymorphisms in selenoprotein s |
| CN1665940A (en) * | 2002-07-05 | 2005-09-07 | 英属哥伦比亚大学 | Diagnosis of sepsis using mitochondrial nucleic acid assays |
| KR20100094705A (en) * | 2009-02-19 | 2010-08-27 | 한국과학기술연구원 | Biomarker for identification of exposure to toxaphene and the method of identification using thereof |
| CN102191327A (en) * | 2011-04-18 | 2011-09-21 | 中国人民解放军总医院 | Kit for forecasting death rate of patients with sepsis and application thereof |
-
2013
- 2013-03-22 CN CN2013100935940A patent/CN103146833A/en active Pending
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1665940A (en) * | 2002-07-05 | 2005-09-07 | 英属哥伦比亚大学 | Diagnosis of sepsis using mitochondrial nucleic acid assays |
| WO2005026358A1 (en) * | 2003-09-18 | 2005-03-24 | Agt Biosciences Limited | Polymorphisms in selenoprotein s |
| KR20100094705A (en) * | 2009-02-19 | 2010-08-27 | 한국과학기술연구원 | Biomarker for identification of exposure to toxaphene and the method of identification using thereof |
| CN102191327A (en) * | 2011-04-18 | 2011-09-21 | 中国人民解放军总医院 | Kit for forecasting death rate of patients with sepsis and application thereof |
Non-Patent Citations (2)
| Title |
|---|
| ANDREW J. GOLDSON ET.AL.,: "Effects of Selenium Supplementation on Selenoprotein Gene Expression and Response to Influenza Vaccine Challenge: A Randomised Controlled Trial", 《PLOS ONE》, vol. 6, no. 3, 21 March 2011 (2011-03-21) * |
| 苏茂生等: "SEPS1基因对内毒素所致脓毒症小鼠的肝脏保护作用", 《中华保健医学杂志》, vol. 12, no. 2, 30 April 2010 (2010-04-30) * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Wang et al. | Ablation of LGR4 promotes energy expenditure by driving white-to-brown fat switch | |
| Wu et al. | Obesity-related glomerulopathy: insights from gene expression profiles of the glomeruli derived from renal biopsy samples | |
| Zhang et al. | Presence of thyrotropin receptor in hepatocytes: not a case of illegitimate transcription | |
| Aaltonen et al. | Changes in the expression of nephrin gene and protein in experimental diabetic nephropathy | |
| Theiss et al. | Prohibitin inhibits tumor necrosis factor alpha–induced nuclear factor-kappa B nuclear translocation via the novel mechanism of decreasing importin α3 expression | |
| Taylor et al. | Basolateral NBCe1 plays a rate-limiting role in transepithelial intestinal HCO3–secretion, contributing to marine fish osmoregulation | |
| Bui-Nguyen et al. | NF-κB signaling mediates the induction of MTA1 by hepatitis B virus transactivator protein HBx | |
| Murphy et al. | A new molecular variant of desmoplastic small round cell tumor: significance of WT1 immunostaining in this entity | |
| Mei et al. | Long non-coding RNA expression profile in permanent atrial fibrillation patients with rheumatic heart disease. | |
| Bai et al. | Hydrogen sulfide attenuates paraquat‐induced epithelial‐mesenchymal transition of human alveolar epithelial cells through regulating transforming growth factor‐β1/Smad2/3 signaling pathway | |
| Islam et al. | Identification and proximal tubular localization of the Mg2+ transporter, Slc41a1, in a seawater fish | |
| Alachkar et al. | Urinary biomarkers in acute kidney transplant dysfunction | |
| López-Casado et al. | Potential role of the IL-33/ST2 axis in celiac disease | |
| CN105176976B (en) | A kind of primer pair of detection and the relevant genetic marker of Non-obstructive Azoospermia | |
| Kimura et al. | Close relations between podocyte injuries and membranous proliferative glomerulonephritis in autoimmune murine models | |
| Huang et al. | Mogroside V improves follicular development and ovulation in young-adult PCOS rats induced by letrozole and high-fat diet through promoting glycolysis | |
| Chatterjee et al. | Hepatic transcriptome signature correlated with HOMA-IR explains early nonalcoholic fatty liver disease pathogenesis | |
| Huang et al. | Expression of LncRNA KCNQ1Ot1 in diabetic nephropathy and its correlation with MEK/ERK signaling pathway | |
| Kumari et al. | Deletion of insulin receptor in the proximal tubule and fasting augment albumin excretion | |
| Hasegawa et al. | Sulfate transporters involved in sulfate secretion in the kidney are localized in the renal proximal tubule II of the elephant fish (Callorhinchus milii) | |
| CN103146833A (en) | Fluorogenic quantitative PCR (polymerase chain reaction) kit for detecting mice SEPS1 (selenoprotein) gene | |
| Le et al. | Serum leptin levels, hepatic leptin receptor transcription, and clinical predictors of non-alcoholic steatohepatitis in obese bariatric surgery patients | |
| Prosniak et al. | Differential expression of growth factors at the cellular level in virus-infected brain | |
| CN105925726A (en) | Primer pair for detecting enzootic nasal tumor virus gene and application of primer pair | |
| Tejero et al. | Adiponectin but not resistin is associated with insulin resistance‐related phenotypes in baboons |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20130612 |