CN103146812A - Polymerase chain reaction (PCR) detection method of specificity of botrytis cinerea - Google Patents
Polymerase chain reaction (PCR) detection method of specificity of botrytis cinerea Download PDFInfo
- Publication number
- CN103146812A CN103146812A CN2013100277221A CN201310027722A CN103146812A CN 103146812 A CN103146812 A CN 103146812A CN 2013100277221 A CN2013100277221 A CN 2013100277221A CN 201310027722 A CN201310027722 A CN 201310027722A CN 103146812 A CN103146812 A CN 103146812A
- Authority
- CN
- China
- Prior art keywords
- botrytis cinerea
- pcr
- dna
- specificity
- amplification
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a polymerase chain reaction (PCR) detection method of specificity of botrytis cinerea. The PCR detection method of the specificity of the botrytis cinerea includes the following steps of obtaining specificity fragment of the botrytis cinerea according to randomly amplified polymorphic DNA (RAPD) marks, designing amplification primer pair sequences, B1SE11f and B1SE11r, extracting sample deoxyribonucleic acid (DNA), conducting amplification through the PCR method, detecting an amplification product through gel electrophoresis, and judging whether the sample contains botrytis cinerea, wherein the judging is conducted according to the fact that the sample contains the botrytis cinerea when the electrophoresis result appears an amplification band on 327bp. The PCR detection method of the specificity of the botrytis cinerea can detect DNA of 0.4-nanogram botrytis cinerea, distinguish the botrytis cinerea from other fungus and relative genus fungus of the botrytis cinerea, and be directly applied to field detection. The PCR detection method of the specificity of the botrytis cinerea is short in detection time, low in cost, distinctive in detection result and simple in result judgment.
Description
Technical field
The present invention relates to the microorganism detection field.Be specifically related to a kind of Botrytis cinerea PCR method for detecting specificity, the method is short detection time, and cost is low, and result is special, and result is judged simple, and susceptibility is high.
Background technology
According to up-to-date categorizing system, it belongs to imperfect fungi without condition to Botrytis cinerea (Botrytis cinerea), hyphomycetes, hyphomycetales, dark Moniliaceae, Staphlosporonites.There is condition to belong to Ascomycota, discomycete, Helotiales, Sclerotiniaceae, Botryotinia.
Botrytis cinerea is a kind of facultative parasite, all can infect the position, ground of plant in any stage of plant-growth, produce a large amount of conidiums, thus can be with the wind, the propagation such as water and farming operation infects again, its saprophytic property is strong, and the disease gray mold that causes is a class intractable disease.In the Staphlosporonites fungi of having reported, the Botrytis cinerea host range is the widest, can infect vegetables (as tomato, cucumber, eggplant, capsicum, beans etc.), field crop (as rape, wheat etc.), fruit (peach, pears, grape, strawberry, apple etc.) and flowers (as Chinese rose, carnation, flower of Greenish Lily, turmeric etc.).This pathogenic bacteria is liked low temperature and high relative humidity, and its morbidity thermophilic is generally 20 ~ 25 ℃, because its morbidity optimal temperature protects the optimal temperatures of ground vegetables and fruits growth close with the overwhelming majority; crop is in case infected; the gray mold that can break out also spreads, and due to the control of cause of disease amount disaster, thereby causes serious financial loss.
fungi mainly comprises Staphlosporonites: Botrytis cinerea(Botrytis cinerea), B.fabiopsis(intends Botrytis fabae), the B.fabae(Botrytis fabae), the living grape spore of B.sinoviticola(Chinese Grape), the B.elliptica(Botrytis elliptica), B.squamosa(green onion squama grape spore), blind kind of grape spore of B.porri(garlic), B.sinoallii(Chinese Onion grape spore), the B.aclada(botrytis allii Munn), B.byssoidea(green onion filament grape spore), its relative genus fungi mainly comprises: Amphobotrys ricini, Verrucobotrys gernii, Streptobotrys caulophylli, the symptom that they cause on the host is similar, can't distinguish the cause of disease kind in the field.And by separation and Culture, and carry out germ from view of morphology and identify that required time is longer, thereby incur loss through delay disease control.Therefore in the urgent need to a kind of simple, fast, high specificity, the Methods of Detection of Pathogens that susceptibility is high.
The present invention is according to the diversity of fungal genomic DNA, with reference to perfect RAPD(randomly amplified polymorphic DNA fragment) method, amplification Botrytis cinerea, other kind of Staphlosporonites fungi and relative genus fungi thereof, obtain Botrytis cinerea DNA fragment specific and order-checking, according to gained sequences Design Botrytis cinerea Auele Specific Primer, and propose a kind of more convenient, Botrytis cinerea specific PCR detection technique saves time.The most of bacterial strain reference of the present invention (quiet. Hubei Province's gray mold germ fauna and Botrytis cinerea Study on Diversity. Hua Zhong Agriculture University, doctorate paper, 2010) in the fungi of having identified.All test strains derive from plant pathogenic fungi Lee seminar on National Day of agricultural microorganism National Key Laboratory of Hua Zhong Agriculture University.Simultaneously, the present invention according to universal primer to ITS1, ITS4 amplification eukaryote ITS1-5.8S-ITS2(eukaryote rrna the Internal Transcribed Spacer) subregion verifies in the present invention, whether all samples contains eukaryotic dna, the reliability of experiment in the proved invention.
Although there has been the scholar to detect Botrytis cinerea by the method that designs the specific PCR primer, but required PCR long reaction time, and only provide the detected result of specific PCR primer amplification bacterium of downy mildew of cucumber, powdery mildew of cucumber bacterium, Phytophthora capsici germ three kinds of fungies, wherein, bacterium of downy mildew of cucumber, Phytophthora capsici germ belong to mastigomycetes door fungi, and the powdery mildew of cucumber Pseudomonas is in Ascomycota gang pyrenomycetes fungi, and these three kinds of fungies and Staphlosporonites are separated by and are very far easily distinguished.Other kind of Staphlosporonites and other fungi of relative genus are not carried out specific detection, and its specific PCR primer susceptibility also only limits to the microgram rank.
The present invention overcomes the deficiencies in the prior art, and a kind of Botrytis cinerea specific PCR primer and PCR detection technique are provided.Adopt detection method of the present invention to detect Botrytis cinerea, the time is short, and cost is low, and result is special, and result is judged simple, and susceptibility is high, more has practicality.
Summary of the invention
The object of the present invention is to provide the new PCR method for detecting specificity of a kind of Botrytis cinerea.Adopt detection method of the present invention to detect Botrytis cinerea, the time is short, and cost is low, and result is special, and result is judged simple, and susceptibility is high.
The present invention is achieved by the following technical solutions:
The invention provides the new PCR method for detecting specificity of a kind of Botrytis cinerea, comprise the steps:
Compared with prior art, the present invention has following beneficial effect:
The present invention chooses a large amount of a large amount of bacterial strains of primer amplification reliably by the RAPD method, has obtained reliable Botrytis cinerea specific fragment.Simultaneously, reaction system provided by the invention has reduced reaction volume with respect in the past PCR system, but has obtained good amplification, thereby reduced testing cost.Usually the PCR response procedures needs even more than 40 circulation more than 35, and program of the present invention only needs 27 circulations just can obtain expected result, reduce the reaction times, also extended the work-ing life of PCR instrument, more proved the highly sensitive of Auele Specific Primer in the present invention.Therefore, adopt the present invention to detect Botrytis cinerea, detection time is short, and testing cost is low, has avoided adopting traditional authentication method complex operation, the shortcomings such as length consuming time.Simultaneously, the present invention detects has single specificity, and susceptibility is high, and result is judged simple.
Specificity is good: detect with primer of the present invention and method the Botrytis cinerea that 23 strains come from different hosts and different areas, result is all positive.And it is all negative to detect 15 strain sibling species fungi results.Illustrate that primer of the present invention and method have good specificity.
Highly sensitive: primer of the present invention and method can detect 0.4 nanogram Botrytis cinerea genomic dna, simultaneously, when mixing amplification with healthy host plant genomic dna when the Botrytis cinerea genomic dna, healthy host plant genomic dna concentration is that 1000 times of Botrytis cinerea genomic dnas do not affect detected result yet.Illustrate that primer of the present invention and method have good susceptibility.
Description of drawings
Fig. 1 is the Botrytis cinerea gel electrophoresis figure as a result that a kind of detection 23 strains come from different hosts and different areas.
Swimming lane M:DNA marker DL2000; Swimming lane 1 ~ 23:23 strain comes from the Botrytis cinerea amplification (code name is with table 2) of different hosts and different areas; Swimming lane CK: with ddH
2O is the template blank.
Fig. 2 is a kind of specificity gel electrophoresis by detecting 15 strain sibling species fungi evaluation methods figure as a result.
This figure is divided into two portions, and first part is that Auele Specific Primer is to B1SE11f, B1SE11r amplification control sample and testing sample result; Second section is ITS1, ITS4 primer pair amplification, verifies first part's test reliability.
Swimming lane M:DNA marker DL2000; Swimming lane 1: Botrytis cinerea amplification; Swimming lane 2 ~ 16:15 strain sibling species fungi amplification (code name is with table 3); Swimming lane CK: with ddH
2O is the template blank.
Fig. 3 is a kind of susceptibility gel electrophoresis by detecting different concns Botrytis cinerea DNA evaluation method figure as a result.
Swimming lane M:DNA marker DL2000; The 2nd ~ 6 swimming lane: Botrytis cinerea genomic dna amount is followed successively by 20ng, 4ng, 0.8ng, 0.4ng, 0.04ng amplification; Swimming lane C
+: 40ng Botrytis cinerea genomic dna amplification; Swimming lane C
﹣: with ddH
2O is the template blank.
Fig. 4 is that a kind of middle detection 40ng Botrytis cinerea DNA mixes amplification gel electrophoresis figure as a result with the healthy host plant DNA of different concns.
Swimming lane M:DNA marker DL2000; The 2nd ~ 4 swimming lane: 40ng Botrytis cinerea DNA successively with 40ng, 400ng, 4 μ g, the healthy host plant DNA of 40 μ g mixing amplifications; Swimming lane C:40ng Botrytis cinerea genomic dna amount amplification; Swimming lane CK: with ddH
2O is the template blank.
Fig. 5 is a kind of Fields detection gel electrophoresis practicality of figure evaluation method as a result.
This figure is divided into two portions, and first part is that Auele Specific Primer is to B1SE11f, B1SE11r amplification control sample and field sample result; Second section is ITS1, ITS4 primer pair result, verifies first part's test reliability.
Swimming lane M:DNA marker DL2000; Swimming lane C:40ng Botrytis cinerea DNA cloning result; Swimming lane 1～10: field 10 duplicate samples DNA cloning results; Swimming lane CK: with ddH
2O is the template blank.
Embodiment
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used for explanation the present invention and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example usually according to normal condition, for example extracts the CTAB method of hypha,hyphae genomic dna according to document
EM, Bahnweg G, Sandermann H, Geige HH.1992.A simple and efficient protocol for isolation of high molecular weight DNA from filamentous fungi, fruit bodie, and infected plant tissues.Nucleic Acids Res.20:6115-6116.) described operation, the condition of perhaps advising according to manufacturer.
Embodiment 1:
The present invention designs a kind of Botrytis cinerea PCR method for detecting specificity, comprises the steps:
By the RAPD(randomly amplified polymorphic DNA fragment of searching document and providing with reference to Shanghai living work biotechnology limited-liability company) primer, select 23 random primers (to see Table 1, sequence is synthetic by the prosperous bio tech ltd of Beijing AudioCodes), take Botrytis cinerea and sibling species (seeing Table 3) genomic dna thereof as template amplification.
50 μ LRAPD reaction systems: sample gene group DNA1 μ L(is 40ng); 10 * PCRbuffer5 μ L; 25mM MgCl
22 μ L; 2.5mM dNTP Mixture (TAKARA Biotechnology Co., Dalian) 1.6 μ L; 5U/ μ L rTaq enzyme (TAKARA Biotechnology Co., Dalian) 0.5 μ L; 20 μ M RAPD random primer 3 μ L; ddH
2O36.9 μ L.RAPD response procedures: 94 ℃ of denaturation 4min; 94 ℃ of sex change 30s, 36 ℃ of annealing 30s, 72 ℃ are extended 45s, 35 circulations; 72 ℃ are extended 10min; Be cooled to 16 ℃ and keep 5min.
All bacterial strain gained 50 μ L products of each primer amplification, 1.5% agarose gel electrophoresis detects, EB dyeing, ultra violet lamp is observed, all bacterial strain polymorphic bandses relatively, clear, the most stable primer of amplification Botrytis cinerea gained specific band is required RAPD primer, at last selected RAPD primer OPE-11.according to AxyPrepTM DNA Gel Extraction Kit(Axygen Scientific, Inc.Union City, USA) illustration method reclaims the Botrytis cinerea specific fragment, then the PCR product is connected to pMD18-T carrier (TAKARA Biotechnology Co., Dalian) on, change intestinal bacteria (Escherichia coli DH5 α) cell over to, picking resistant panel (LA+Amp) goes up positive colony and detects the size of Insert Fragment, select at last three positive and send the prosperous bio tech ltd order-checking of Beijing AudioCodes (as shown in SEQ ID NO:1), simultaneously, Botrytis cinerea whole genome sequence in sequence and GenBank is compared, confirm that this sequence is the Botrytis cinerea partial dna sequence.Institute calling sequence input PrimerPremier5.0 software design amplimer pair, described primer pair sequence following (primer is synthetic by the prosperous bio tech ltd of Beijing AudioCodes):
B1SE11f：5’-CAGGAAACACTTTTGGGGATA–3’（SEQ ID NO:2）
B1SE11r：5’-GAGGGACAAGAAAATCGACTAA–3’（SEQ ID NO:3）
Table 1RAPD primer numbering and sequence
Separate from 23 kinds of morbidity hosts and obtain Botrytis cinerea (seeing Table 2).Plant site of pathological change (the visible conidiophore of naked eyes and conidium) is cut, put into the 1.5mL centrifuge tube of sterilization, add sterilized water concussion 30s, namely obtain conidial suspension.Get the suspension 100 μ L that carry disease germs, use aseptic spreading rod to be coated on the PDA flat board, cultivated 2 days under 20 ℃, 10 single bacterium colonies of picking are transferred to respectively and continue on fresh PDA flat board to cultivate, flat board of a bacterium colony.Again these cultures are placed on 20 ℃ of lower constant temperature culture 15 days, according to colony characteristics and its attribute of conidium identification of morphology (authentication method is with reference to quiet. Hubei Province's gray mold germ fauna and Botrytis cinerea Study on Diversity. Hua Zhong Agriculture University, the doctorate paper, 2010), determine that it is all Botrytis cinerea.The representative strain of the different plant origins in different areas is transferred to the PDA test tube slant (on 18 * 2cm), and to be placed under 20 ℃ and to cultivate after 12 days, be kept in 4 ℃ of refrigerators.Take out a small amount of mycelia piece from the inclined-plane, after 2 days, shift the bacterium cake in activation on the PDA flat board to the PDA flat board that is covered with the sterilization glassine paper, collect mycelia after 3 days, utilize the CTAB method to extract each bacterial strain mycelia DNA, ddH
2O dissolving, dilution, UV spectrophotometer measuring concentration be to 40ng/ μ L, place-20 ℃ standby.
Upper Botrytis cinerea electrophoresis sample number into spectrum, strain number, host's title, collecting location and the time that obtains of the different hosts of table 2
PCR detects 25 μ L reaction systems and is specially: sample gene group DNA1 μ L(is 40ng); 10 * PCR buffer2.5 μ L; 2.5mM dNTP Mixture(TAKARA Biotechnology Co., Dalian) 0.5 μ L; 5U/ μ L rTaq enzyme (TAKARA Biotechnology Co., Dalian) 0.25 μ L; A pair of 20 μ M primers are 0.5 μ L respectively; ddH
2O19.75 μ L.The PCR response procedures is specially: 94 ℃ of denaturation 5min; 94 ℃ of sex change 30s, 56 ℃ of annealing 30s, 72 ℃ are extended 1min, 27 circulations; 72 ℃ are extended 10min; Be cooled to 16 ℃ and keep 5min.
Described judgement is specially: get pcr amplification product 10 μ L, 1.5% agarose gel electrophoresis detects, EB dyeing, and ultra violet lamp is observed, if having single amplified band at the 327bp place, contains Botrytis cinerea in interpret sample.
Result, get respectively 23 sample P CR amplified production 10 μ L, 1.5% agarose gel electrophoresis detects, EB dyeing, ultra violet lamp is observed, and as shown in Figure 1, all has single amplified band at the 327bp place, contrast does not detect any obvious band, illustrates that the PCR method of setting up can successfully detect 23 Botrytis cinerea bacterial strains on different hosts.
Embodiment 2:
The experiment of Botrytis cinerea PCR detection method Evaluation on specificity
According to embodiment 1 step 2, extract respectively other fungi of Staphlosporonites and relative genus fungi thereof totally 16 strains (seeing Table 3) genomic dna.
Bacterial strain uses therefor of the present invention and authentication method reference (quiet. Hubei Province's gray mold germ fauna and Botrytis cinerea Study on Diversity. Hua Zhong Agriculture University, doctorate paper, 2010) in the fungi of having identified.All experimental strains derive from plant pathogenic fungi Lee seminar on National Day of agricultural microorganism National Key Laboratory of Hua Zhong Agriculture University.Simultaneously, the present invention according to universal primer to ITS1, ITS4 amplification eukaryote ITS1-5.8S-ITS2(eukaryote rrna the Internal Transcribed Spacer) subregion verifies in the present invention, whether all samples contains eukaryotic dna, the reliability of experiment in the proved invention.
Table 3 Staphlosporonites fungi and relative genus fungi electrophoresis sample number into spectrum, strain number, collecting location and time
According to PCR reaction system in embodiment 1 step 3, getting each the bacterial strain DNA1 μ L(for preparing in step 1 is 40ng) as amplification template, blank is with 1 μ L ddH
2O is as template.Again according to PCR response procedures amplification in embodiment 1 step 3.Simultaneously, according to universal primer to ITS1, ITS4 amplification eukaryote ITS1-5.8S-ITS2(eukaryote rrna the Internal Transcribed Spacer) subregion verifies in the present invention, whether all samples contains eukaryotic dna, thereby verifies the reliability of this experiment.Its 25 μ LPCR reaction system is specially: testing sample genomic dna 1 μ L(is 40ng); 10 * PCR buffer2.5 μ L; 2.5mM dNTP Mixture0.5 μ L; 5U/ μ L rTaq enzyme (TAKARA Biotechnology Co., Dalian) 0.25 μ L; A pair of 20 μ M primers are 0.5 μ L respectively; ddH
2O19.75 μ L.The PCR response procedures is specially: 94 ℃ of denaturation 5min; 94 ℃ of sex change 30s, 56 ℃ of annealing 30s, 72 ℃ are extended 2min, 34 circulations; 72 ℃ are extended 10min; Be cooled to 16 ℃ and keep 5min.
Get pcr amplification product 10 μ L, 1.5% agarose gel electrophoresis detects, EB dyeing, and ultra violet lamp is observed, if there is single amplified band to B1SE11f, B1SE11r amplified production in Auele Specific Primer at the 327bp place, contains Botrytis cinerea in interpret sample.Simultaneously, if there are single amplified band in primer pair ITS1, ITS4 amplification at place, 539bp left and right, contain Staphlosporonites fungi and relative genus fungal DNA template thereof in interpret sample.
Result: as shown in Figure 2, only there is swimming lane 1 sample Botrytis cinerea (Botrytis cinerea) to have single amplified band at the 327bp place, swimming lane 2 ~ 16 sample 15 strain Staphlosporonites fungies and relative genus fungi thereof and contrast all do not detect any obvious band in addition, and ITS1, ITS4 primer pair amplification confirm that all samples to be measured all contains the fungal DNA template.These results suggest that primer pair has good specificity, the PCR detection method of foundation can the specific detection Botrytis cinerea.
Embodiment 3:
Amplification different concns Botrytis cinerea DNA estimates Botrytis cinerea PCR detection method sensitivity experiment
According to embodiment 1 step 2, extract Botrytis cinerea DNA, ddH
2O dissolving, dilution, UV spectrophotometer measuring concentration is successively to 40ng/ μ L, 20ng/ μ L, 4ng/ μ L, 0.8ng/ μ L, 0.4ng/ μ L, 0.04ng/ μ L.
Each concentration sample is got respectively 1 μ L and is added the PCR reaction system, according to method in embodiment 1 step 3, DNA profiling to be measured is carried out pcr amplification and detects.
Get pcr amplification product 10 μ L, 1.5% agarose gel electrophoresis detects, EB dyeing, and ultra violet lamp is observed, if having single amplified band at the 327bp place, contains Botrytis cinerea in interpret sample.
Result: as shown in Figure 3, the single amplified band that the 2nd ~ 5 swimming lane all weakens successively in 327bp place's existence, sample DNA content is followed successively by 20ng, 4ng, 0.8ng, 0.4ng.The 6th swimming lane has no obvious band, and sample DNA content is 0.04ng.The 7th swimming lane is the 40ngDNA amplification, as positive control.The 8th swimming lane is ddH
2The O amplification is as negative control.Therefore judge that PCR sensitivity is 0.4ng, has higher susceptibility.
Embodiment 4:
Different concns host DNA mixes amplification and estimates Botrytis cinerea PCR detection method sensitivity experiment with Botrytis cinerea DNA
According to embodiment 1 step 2, extract Botrytis cinerea DNA, ddH
2O dissolving, dilution, UV spectrophotometer measuring concentration is to 40ng/ μ L.Extract healthy Broad Bean Leaves genomic dna, ddH according to the described method of plant genome DNA test kit (TIANGEN BIOTECH, Beijing)
2O dissolving, dilution, UV spectrophotometer measuring concentration is successively to 40ng/ μ L, 400ng/ μ L, 4 μ g/ μ L, 40 μ g/ μ L.
Each concentration plant tissue DNA gets respectively 1 μ L and mixes with 1 μ L Botrytis cinerea DNA, adds the PCR reaction system, according to method in embodiment 1 step 3, DNA profiling to be measured is carried out pcr amplification and detects.
Get pcr amplification product 10 μ L, 1.5% agarose gel electrophoresis detects, EB dyeing, and ultra violet lamp is observed, if having single amplified band at the 327bp place, contains Botrytis cinerea in interpret sample.
Result: as shown in Figure 4, all there is single amplified band clearly in the 2nd ~ 4 swimming lane at the 327bp place.The 5th swimming lane is 40ng Botrytis cinerea DNA cloning result, as positive control.The 6th swimming lane is ddH
2The O amplification is as negative control.Therefore, judge that the host plant tissue DNA detects without impact PCR, PCR detects has higher susceptibility.
According to embodiment 1 step 2, choose arbitrarily the field and manifest scab Broad Bean Leaves 0.2g, extract DNA, 100 μ L ddH
2The O dissolving.
Get respectively every duplicate samples DNA1 μ L and add the PCR reaction system, according to method in embodiment 1 step 3, DNA profiling to be measured is carried out pcr amplification and detect.Simultaneously, with primer pair ITS1, ITS4 all testing samples that increase, whether contain eukaryotic dna for detection of sample according to method in embodiment 2 step 2.
Get pcr amplification product 10 μ L, 1.5% agarose gel electrophoresis detects, EB dyeing, and ultra violet lamp is observed, if there is single amplified band to B1SE11f, B1SE11r amplified production in Auele Specific Primer at the 327bp place, contains Botrytis cinerea in interpret sample.Simultaneously, if there are amplified band in primer pair ITS1, ITS4 amplification between 500 ~ 750bp, contain the eukaryotic dna template in interpret sample.
Result: Fig. 5 is field 10 duplicate samples genomic dna amplifications, 1,4,5,6, No. 9 samples single amplified band of all existing light and shade to differ at the 327bp place, reclaim these bands according to method in embodiment 1 step 1, and order-checking, sequence and gained Botrytis cinerea specific sequence are compared 100% homology.Simultaneously, with ITS1, ITS4 primer pair amplified band reclaim respectively, check order (sequence is recorded by the prosperous bio tech ltd of Beijing AudioCodes), sequence alignment in institute's calling sequence and GenBank, confirm in all testing samples that amplification obtains strong brightness band and is host plant DNA, and relatively weak band is the DNA of Botrytis cinerea or other fungi.The present embodiment proves, the Botrytis cinerea PCR method for detecting specificity has extreme high reliability.
Should be understood that, for those of ordinary skills, can be improved according to the above description or conversion, and all these improve and conversion all should belong to the protection domain of claims of the present invention.
SEQUENCE LISTING
＜110〉Hua Zhong Agriculture University
＜120〉a kind of Botrytis cinerea PCR method for detecting specificity
＜130〉a kind of Botrytis cinerea PCR method for detecting specificity
<160> 3
<170> PatentIn version 3.3
<210> 1
<211> 327
<212> DNA
＜213〉the pathogen of Botrytis cinerea (Botrytis cinerea)
<400> 1
caggaaacac ttttggggat attatcacca gataattaat ttggagaaat ttttgaggaa 60
ttaatgatcg cctacacagc tctgaaccga aagattgaaa aggaataaaa atttggaaca 120
caaatatttg gtttgtgcct atcacattta ttaaggggaa ataataagtt cttcaatcta 180
ttaagtgaca cttgatgaac ggatatagag actaccaatg cctgtcatat tcgtgattat 240
aaaacgatag tatttgttct cggtggtagc tttacttctg acatatttga aactcttctt 300
tacttttagt cgattttctt gtccctc 327
<210> 2
<211> 21
<212> DNA
＜213〉artificial sequence
<400> 2
caggaaacac ttttggggat a 21
<210> 3
<211> 22
<212> DNA
＜213〉artificial sequence
<400> 3
gagggacaag aaaatcgact aa 22
Claims (1)
1. a Botrytis cinerea PCR method for detecting specificity, the steps include:
1) the CTAB method is extracted sample hypha,hyphae genomic dna;
2) PCR method amplification, the PCR reaction system is specially: sample gene group DNA 1 μ L; 10 * PCR buffer, 2.5 μ L; 2.5mM dNTP Mixture 0.5 μ L; 5U/ μ L rTaq enzyme 0.25 μ L; A pair of 20 μ M primers are 0.5 μ L respectively; ddH
2O 19.75 μ L; Total system 25 μ L; The PCR response procedures is specially: 94 ℃ of denaturation 5min; 94 ℃ of sex change 30s, 56 ℃ of annealing 30s, 72 ℃ are extended 1min, 27 circulations; 72 ℃ are extended 10min; Be cooled to 16 ℃ and keep 5min;
Described primer pair is:
B1SE11f：5’–CAGGAAACACTTTTGGGGATA–3’；
B1SE11r：5’–GAGGGACAAGAAAATCGACTAA–3’ ；
3) observation of dyeing of detected through gel electrophoresis amplified production, EB exists single amplified band to contain Botrytis cinerea in showing sample at the 327bp place.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310027722.1A CN103146812B (en) | 2013-01-24 | 2013-01-24 | Polymerase chain reaction (PCR) detection method of specificity of botrytis cinerea |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310027722.1A CN103146812B (en) | 2013-01-24 | 2013-01-24 | Polymerase chain reaction (PCR) detection method of specificity of botrytis cinerea |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103146812A true CN103146812A (en) | 2013-06-12 |
| CN103146812B CN103146812B (en) | 2014-08-06 |
Family
ID=48545129
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310027722.1A Expired - Fee Related CN103146812B (en) | 2013-01-24 | 2013-01-24 | Polymerase chain reaction (PCR) detection method of specificity of botrytis cinerea |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103146812B (en) |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104293957A (en) * | 2014-10-14 | 2015-01-21 | 华中农业大学 | Early fast molecule detection method of botrytis cinerea |
| CN105368954A (en) * | 2015-12-10 | 2016-03-02 | 中国农业科学院植物保护研究所 | Fluorescent quantitative PCR (polymerase chain reaction) detection method for quickly detecting Botrytis cinerea and kit |
| CN107119139A (en) * | 2017-06-14 | 2017-09-01 | 中国农业科学院蔬菜花卉研究所 | The method of quick detection lily gray mold infective pathogen bacterium Botrytis cinerea |
| CN108913806A (en) * | 2018-08-13 | 2018-11-30 | 天津市植物保护研究所 | A kind of plant botrytis molecular detecting method based on grey mold toxin sesquiterpene synthase BcBOT2 gene |
| CN113355348A (en) * | 2021-07-15 | 2021-09-07 | 山东省葡萄研究院 | Construction method of agrobacterium-mediated grape botrytis cinerea genetic transformation system |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1752215A (en) * | 2005-08-26 | 2006-03-29 | 中国人民解放军第二军医大学 | Molecular diagnosis method for gray mold |
-
2013
- 2013-01-24 CN CN201310027722.1A patent/CN103146812B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1752215A (en) * | 2005-08-26 | 2006-03-29 | 中国人民解放军第二军医大学 | Molecular diagnosis method for gray mold |
Non-Patent Citations (1)
| Title |
|---|
| 王娜 等: "番茄灰霉病分子诊断方法研究", 《上海交通大学学报（农业科学版），》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104293957A (en) * | 2014-10-14 | 2015-01-21 | 华中农业大学 | Early fast molecule detection method of botrytis cinerea |
| CN105368954A (en) * | 2015-12-10 | 2016-03-02 | 中国农业科学院植物保护研究所 | Fluorescent quantitative PCR (polymerase chain reaction) detection method for quickly detecting Botrytis cinerea and kit |
| CN105368954B (en) * | 2015-12-10 | 2018-09-18 | 中国农业科学院植物保护研究所 | A kind of fluorescent quantitative PCR detection method and kit of quick detection tomato gray mould bacterium |
| CN107119139A (en) * | 2017-06-14 | 2017-09-01 | 中国农业科学院蔬菜花卉研究所 | The method of quick detection lily gray mold infective pathogen bacterium Botrytis cinerea |
| CN108913806A (en) * | 2018-08-13 | 2018-11-30 | 天津市植物保护研究所 | A kind of plant botrytis molecular detecting method based on grey mold toxin sesquiterpene synthase BcBOT2 gene |
| CN113355348A (en) * | 2021-07-15 | 2021-09-07 | 山东省葡萄研究院 | Construction method of agrobacterium-mediated grape botrytis cinerea genetic transformation system |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103146812B (en) | 2014-08-06 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Maciá‐Vicente et al. | Real‐time PCR quantification and live‐cell imaging of endophytic colonization of barley (Hordeum vulgare) roots by Fusarium equiseti and Pochonia chlamydosporia | |
| Lievens et al. | A robust identification and detection assay to discriminate the cucumber pathogens Fusarium oxysporum f. sp. cucumerinum and f. sp. radicis‐cucumerinum | |
| Ioos et al. | Sensitive detection of Fusarium circinatum in pine seed by combining an enrichment procedure with a real-time polymerase chain reaction using dual-labeled probe chemistry | |
| Zhou et al. | Genetic diversity of rice false smut fungus, Ustilaginoidea virens and its pronounced differentiation of populations in North China | |
| Qi et al. | Morphological and molecular analysis of genetic variability within isolates of Corynespora cassiicola from different hosts | |
| Silva et al. | Molecular, physiological and pathological characterization of Corynespora leaf spot fungi from rubber plantations in Sri Lanka | |
| CN103146812B (en) | Polymerase chain reaction (PCR) detection method of specificity of botrytis cinerea | |
| Fan et al. | Development of PCR-based assays for detecting and differentiating three species of Botrytis infecting broad bean | |
| Visentin et al. | The ITS region as a taxonomic discriminator between Fusarium verticillioides and Fusarium proliferatum | |
| Gang et al. | Analysis of fungicide sensitivity and genetic diversity among Colletotrichum species in sweet persimmon | |
| Loganathan et al. | Morphological, pathogenic and molecular characterizations of Alternaria species causing early blight of tomato in Northern India | |
| CN101974650A (en) | Polymerase chain reaction (PCR) method for detecting fusarium oxysporum and kit | |
| Lu et al. | Rapid diagnosis of Fusarium root rot in soybean caused by Fusarium equiseti or Fusarium graminearum using loop-mediated isothermal amplification (LAMP) assays | |
| Baskarathevan et al. | Development of isolate‐specific markers for Neofusicoccum parvum and N. luteum and their use to study rainwater splash dispersal in the vineyard | |
| Guinet et al. | One-step detection of Monilinia fructicola, M. fructigena, and M. laxa on Prunus and Malus by a multiplex real-time PCR assay | |
| Pérez‐Sierra et al. | High vegetative compatibility diversity of Cryphonectria parasitica infecting sweet chestnut (Castanea sativa) in Britain indicates multiple pathogen introductions | |
| Shen et al. | Development of a loop‐mediated isothermal amplification assay for rapid and sensitive detection of Sporisorium scitamineum in sugarcane | |
| Zhou et al. | Development of a loop‐mediated isothermal amplification method for the rapid detection of Venturia carpophila on peach | |
| CN104593502A (en) | Loop-mediated isothermal amplification primer composition capable of detecting colletotrichum truncatum and application thereof | |
| Jun-hai et al. | Development and evaluation of a loop-mediated isothermal amplification assay for rapid detection of bacterial blight pathogen (Xanthomonas axonopodis pv. dieffenbachiae) in anthurium | |
| KR20130093387A (en) | Dna markers for ganoderma lucidum, primers for the markers, and method for discriminating ganoderma lucidum | |
| CN112266879B (en) | Trichoderma harzianum SQ-18 strain and application thereof in preventing and treating turfgrass diseases | |
| Atkins et al. | Use of real‐time quantitative PCR to investigate root and gall colonisation by co‐inoculated isolates of the nematophagous fungus Pochonia chlamydosporia | |
| Chen et al. | Development of pathogenicity and AFLP to characterize Fusarium oxysporum f. sp. momordicae isolates from bitter gourd in China | |
| CN104232748A (en) | Rapid molecular detection method for detecting whether waxberry nursery-grown plant carries wilting germs or not |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140806 Termination date: 20160124 |
|
| EXPY | Termination of patent right or utility model |