CN103146745A - Plant RNA (Ribose Nucleic Acid) interference vector for inhibiting lignin from synthesizing, and construction method and application of plant RNA interference vector - Google Patents
Plant RNA (Ribose Nucleic Acid) interference vector for inhibiting lignin from synthesizing, and construction method and application of plant RNA interference vector Download PDFInfo
- Publication number
- CN103146745A CN103146745A CN2013100794143A CN201310079414A CN103146745A CN 103146745 A CN103146745 A CN 103146745A CN 2013100794143 A CN2013100794143 A CN 2013100794143A CN 201310079414 A CN201310079414 A CN 201310079414A CN 103146745 A CN103146745 A CN 103146745A
- Authority
- CN
- China
- Prior art keywords
- plant
- rna interference
- pfgc5941
- acid fragment
- plant rna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Abstract
The invention relates to a plant RNA (Ribose Nucleic Acid) interference vector for inhibiting lignin from synthesizing, and a construction method and application of the plant RNA interference vector. The plant RNA interference vector is that some nucleotide sequences (serving as forward nucleic acid fragments) of alfalfa CCoAOMT as shown in a sequence table SEQ ID No.1 and some nucleotide sequences (serving as reverse nucleic acid fragments) of the alfalfa CCoAOMT as shown in a sequence table SEQ ID No.2 are inserted into a plant expression vector pFGC5941, thus constructing the plant RNA interference vector pFGC5941-CCoAOMTi. The obtained interference vector is used for transforming agrobacterium tumefaciens EHA105 competent cells, so as to obtain agrobacterium engineering bacteria containing the interference vector. The agrobacterium engineering bacteria containing the interference vector is utilized for transforming the plant, and therefore, the plant with low lignin content can be cultivated. By adopting the method, a transgenic plant with normal growth and low lignin content can be gained, and germplasm resources are provided for cultivating low-lignin grass and papermaking plant and the like.
Description
Technical field
The invention belongs to biological technical field, be specifically related to a kind of structure and application in cultivating low content of lignin plant thereof that suppresses the synthetic plant interference carrier of xylogen.
Background technology
Xylogen is the important macromole phenol polymer of a class in plant materials, and its enormous amount is only second to Mierocrystalline cellulose at the content of occurring in nature, occupies the second of organic polymer, usually accounts for 10% left and right of plant materials dry weight, trees, even can reach 30%.Xylogen plays a part and is important in the growing of terrestrial plant.Yet in herbage, the excessive deposition of xylogen but affects the absorption of livestock to nutritive ingredient in herbage; Xylogen in industrial plant has also strengthened the cost that utilizes vegetable fibre.Therefore, wish to obtain the low new plant strain of content of lignin in herding production and vegetable fibre utilize industry always, thereby improve the nutritive property of herbage or reduce the industrial production cost.
Summary of the invention
The purpose of this invention is to provide a kind of synthetic plant RNA interference carrier of xylogen that suppresses, this interference carrier contains the part alfalfa
cCoAOMT(caffeoyl coenzyme A-O-methyltransgerase) gene order.CCoAOMT is one of synthetic key enzyme of xylogen, and the gene of coding CCoAOMT is
cCoAOMTgene.
Another object of the present invention is to provide a kind of preparation method who suppresses the synthetic plant RNA interference carrier of xylogen.
Another object of the present invention is to provide a kind of synthetic plant RNA interference carrier of xylogen that suppresses and applies in cultivating low content of lignin plant, for cultivating low content of lignin herbage etc., provides good material.
Another object of the present invention is to provide a kind of method that interference carrier by structure proceeds to vegetable cell, utilizes the method, and this interference carrier is proceeded to vegetable cell, through cultivating, obtains the normal low content of lignin plant of growth.
To achieve these goals, the present invention adopts following technical measures: a kind of synthetic plant RNA interference carrier of xylogen that suppresses, described plant RNA interference carrier is: using the nucleotide sequence shown in sequence table SEQ ID NO.1 as the forward kernel acid fragment and the nucleotide sequence shown in sequence table SEQ ID NO.2 as the inverse kernel acid fragment, insert in plant expression vector pFGC5941.Nucleotide sequence shown in sequence table is the alfalfa of having inserted restriction enzyme site
cCoAOMTfragment
.
The construction process of the plant RNA interference carrier that above-mentioned inhibition xylogen is synthetic comprises the following steps:
1) extraction of the total RNA of alfalfa
2) reverse transcription obtains alfalfa cDNA;
3) with corresponding restriction enzyme site, respectively as the alfalfa of forward kernel acid fragment and inverse kernel acid fragment
cCoAOMTthe pcr amplification of nucleotide sequence;
4) the forward kernel acid fragment of pcr amplification and inverse kernel acid fragment reclaim through cutting glue, are connected respectively on the T carrier;
5) double digestion is connected to forward kernel acid fragment and the plant expression vector pFGC5941 on the T carrier, and electrophoresis reclaims the purpose fragment, and the T4 ligase enzyme connects, and obtains intermediate carrier pFGC5941-CCoAOMT1;
6) double digestion is connected to inverse kernel acid fragment and the pFGC5941-CCoAOMT1 on the T carrier, and electrophoresis reclaims the purpose fragment, and the T4 ligase enzyme connects, and obtains plant RNA interference carrier pFGC5941-CCoAOMTi.
By the plant RNA interference carrier---the pFGC5941-CCoAOMTi plasmid proceeds in agrobacterium tumefaciens, obtains the restructuring agrobacterium tumefaciens.
The application of above-mentioned plant RNA interference carrier in cultivating low content of lignin plant, its method is as follows:
1) transduction process adopts Ye Panfa
Get the healthy and strong blade of plant (as tobacco or other plant), be cut into 0.5 ㎝
2the leaf dish of left and right after preculture 2d, is put into the above-mentioned restructuring agrobacterium tumefaciens that contains plant RNA interference carrier pFGC5941-CCoAOMTi and is soaked 10min in division culture medium, after taking-up, is inoculated in division culture medium, secretly cultivates 2d.Proceed to the screening division culture medium, carry out inducing of kalamycin resistance screening and indefinite bud.The indefinite bud of inducing is cut from base portion, go in root media and take root.Complete when root system development, during the long 1.5～2.0cm of root, transplant regrowth, obtain transfer-gen plant.
2) PCR of transfer-gen plant detects
Extract the transgenic line genomic dna, take genomic dna as template, 35S promoter adds the forward gene fragment shown in sequence table SEQ ID NO.1 for detecting target, carries out the PCR reaction; The order-checking of PCR product, comparison.Screen positive transfer-gen plant by the method.
Upstream primer: 5 '-GCACGACACTCTGGTCTACTC-3 '
Downstream primer: 5 '-TTATTTAATGGGCTAAAAATGGTT-3 '.
3) acquisition of the normal low content of lignin plant of growth
The mensuration of transfer-gen plant content of lignin: the content of measuring the sample xylogen by classical Klason method.The material that the screening content of lignin reduces more than 10% than wild-type continues to cultivate.
The mensuration of transfer-gen plant physiological and biochemical index: the transfer-gen plant that the screening content of lignin reduces more than 10% than wild-type continues to cultivate, take outward appearance, plant height, individual plant is heavily index, relatively transgenosis and the difference of wild-type material aspect growth potential, the content of lignin plant is hanged down in the growth that growth potential and wild-type be finally acquisition without the transfer-gen plant of significant difference of take normally.
The invention has the beneficial effects as follows: the present invention adopts and derives from alfalfa
cCoAOMTthe portion gene sequence of (caffeoyl coenzyme A-O-methyltransgerase), built a kind of synthetic plant RNA interference carrier of xylogen that suppresses, adopt agrobacterium-mediated transformation that this interference carrier is proceeded to vegetable cell, through cultivate obtaining the normal low content of lignin plant of growth, for the herbage of cultivating low content of lignin, papermaking material etc. provide germ plasm resource.
The accompanying drawing explanation
Fig. 1 is double digestion checking interference carrier forward kernel acid fragment;
M1:Marker (2000bp); M2:Marker (15000bp); 1～6; The recombinant vectors enzyme is cut product.
Fig. 2 is double digestion checking interference carrier inverse kernel acid fragment;
M1:Marker (15000bp); M2:Marker (2000bp); 1～3; The recombinant vectors enzyme is cut product.
Fig. 3 is that the PCR of transformed plant (tobacco) detects (2000bp Marker);
M:Marker (2000bp); 1～5; Target fragment is arranged, positive plant; 6: the driftlessness fragment is the wild-type plant; 7: recombinant plasmid: 8: water.
Embodiment
embodiment 1: alfalfa
cCoAOMTthe clone of gene fragment
1. the extraction of the total RNA of alfalfa
(1) get the tender alfalfa of children and organize 100mg, add liquid nitrogen grinding; Add 1mL RNAiso Plus in mortar, room temperature is standing melts fully to sample, continues to be ground to lysate and is transparence;
(2) homogenate is transferred in centrifuge tube; 12000 r/min, 4 ℃, centrifugal 5min; Getting supernatant moves in new centrifuge tube;
(3) add chloroform (1/5 volume of RNAiso Plus) in supernatant liquor, concussion 15s, after solution is fully emulsified, the more standing 5min of room temperature;
(4) 12000 r/min, 4 ℃, centrifugal 15min; Drawing supernatant liquor is transferred in another new centrifuge tube;
(5) add isopyknic Virahol in supernatant, after fully mixing, the standing 10min of room temperature;
(6) 12000 r/min, 4 ℃, centrifugal 10min; Abandon supernatant, slowly add 75% ethanol 1mL; 12000 r/min,, abandon ethanol after centrifugal 5min by 4 ℃;
(7) drying at room temperature precipitation 2～5min, add appropriate RNase-free water dissolution precipitation, after the RNA precipitation is dissolved fully, in-80 ℃ of preservations, obtains the RNA template.
2. obtain alfalfa cDNA through reverse transcription
(1) alfalfa cDNA the first chain is synthetic.By RNA template (3 μ l), the Primer Mix(2 μ l obtained), dNTP Mix(4 μ l) and RNase-Free Water(4 μ l) the configuration reaction system, hatch 10min for 70 ℃, rapid ice bath 2min.Of short duration centrifugal.Continuation adds 5 * RT Buff(4 μ l in above reaction solution), 0.1M DTT(2 μ l), hatch 2min for 42 ℃; Add 1 μ l HiFi-MMLV(200U/ μ l), hatch 50min for 42 ℃.Hatch 15min for 70 ℃.After reaction finishes, of short duration centrifugal, be placed in cooled on ice.
(2) alfalfa cDNA is synthetic.Above-mentioned reaction product, as template, is carried out the PCR reaction, obtains alfalfa cDNA sequence.
3. with the alfalfa of corresponding restriction enzyme site
cCoAOMTthe amplification of Gene Partial fragment
Take alfalfa cDNA as template, amplification
cCoAOMTgene fragment.
Amplification forward kernel acid fragment, upstream primer 5'-GGCGCGCCACGGAGAAGGAAAGCAAA-3,
Downstream primer 5'-ATTTAAATGCGGAGGGGCGCGTCGGG-3'.
Amplification inverse kernel acid fragment, upstream primer 5'-TCCCCCGGGACGGAGAAGGAAAGCAAA-3',
Downstream primer 5'-GCTCTAGAGCGGAGGGGCGCGTCGGG-3'.
Pcr amplification, obtain forward kernel acid fragment and the inverse kernel acid fragment as shown in sequence table SEQ ID NO.2 as shown in sequence table SEQ ID NO.1 through order-checking.
embodiment 2: suppress the preparation of the synthetic plant RNA interference carrier of xylogen
The acid fragment of the forward kernel with corresponding restriction enzyme site and inverse kernel acid fragment that embodiment 1 is obtained are connected respectively on the pMD19-T carrier; With
asci and
swathe I double digestion is connected to forward kernel acid fragment and the plant expression vector pFGC5941 on the pMD19-T carrier, reclaims the purpose fragment, and the T4 ligase enzyme connects, and obtains intermediate carrier pFGC5941-CCoAOMT1; With
xbai and
smathe pMD19-T carrier that the I double digestion contains the inverse kernel acid fragment and intermediate carrier pFGC5941-CCoAOMT1, reclaim the purpose fragment, and the T4 ligase enzyme connects, and is built into and suppresses the synthetic plant RNA interference carrier pFGC5941-CCoAOMTi of xylogen.
Double digestion carrier pFGC5941-CCoAOMTi identified, result as depicted in figs. 1 and 2, obtains 2 fragments, size with design consistent.
Take interference carrier pFGC5941-CCoAOMTi as template, and 35S promoter adds the forward gene fragment for detecting target, carries out the PCR reaction; The PCR product is served the Hai Shenggong order-checking, and order-checking is correct.
embodiment 3: the plant RNA interference carrier transforms agrobacterium tumefaciens.
1. the preparation of Agrobacterium competent cell
The single colony inoculation of picking agrobacterium tumefaciens is in 3ml LB liquid nutrient medium; 220 r/min, 28 ℃, shaking culture is to OD
600=0.5; Draw 1.5ml bacterium liquid in centrifuge tube, ice bath 10min; 5000 r/min, centrifugal 30s, abandoning supernatant, precipitation suspends with 1.5 ml 0.5M NaCl, ice bath 20min; 5000 r/min, centrifugal 30s, abandoning supernatant; Every effective 100 μ l 20mM CaCl
2suspend, for transforming.
2. plasmid directly transforms Agrobacterium
Add plasmid pFGC5941-CCoAOMTi 10ul, ice bath 30 min in 50 μ l Agrobacterium competent cells; Put into liquid nitrogen 1min, then put into immediately 37 ℃ of water-bath water-bath 5min; Take out centrifuge tube, add 0.5mlLB, 28 ℃, 220 r/min shaking culture 4h; Take out bacterium liquid in containing coated plate on the LB flat board of kantlex, in incubator, under 28 ℃ of conditions, be inverted cultivation.Within 2 days, the left and right bacterium colony is visible, obtains the agrobacterium tumefaciens of recombinating.
3. the restructuring agrobacterium tumefaciens is identified
Extract in a small amount plasmid DNA, PCR identifies, in the restructuring agrobacterium tumefaciens, contains plasmid pFGC5941-CCoAOMTi.
embodiment 4: plant RNA interference carrier transformation of tobacco plant
1. transduction (adopting Ye Panfa)
Get the healthy and strong blade of tobacco, be cut into 0.5 ㎝
2the leaf dish of left and right, the leaf outside of belly is placed in downwards on division culture medium, 26 ℃ ± 1 ℃ of temperature, illumination 16h/d, cultivate 2d.Blade is put into and is cultured to OD
600(0.5-0.6) soak 10min in restructuring agrobacterium tumefaciens bacterium liquid, with aseptic filter paper, suck unnecessary bacterium liquid, the leaf outside of belly is inoculated into downwards in division culture medium, and 26 ℃ ± 1 ℃ of temperature, secretly cultivate 2d.Proceed to the screening division culture medium containing kantlex, carry out inducing of resistance screening and indefinite bud, 26 ℃ ± 1 ℃ of culture temperature, illumination 16h/d.Cultivate the 7d left and right, callus occurs on blade; Continue to cultivate the 10d left and right, differentiate indefinite bud on callus.When indefinite bud grows to 1.5cm when high, it is cut from base portion, with the leaf dish, separate, go to root media, 26 ℃ ± 1 ℃ of culture temperature, illumination 16h/d.Cultivate the 10d left and right, adventive root occurs, complete when root system development, during the long 1.5～2.0cm of root, Transplantation of Regenerated Plantlets is cultivated to the basin that Nutrition Soil is housed to Routine Management.Obtain transgenic tobacco plant through aforesaid operations.
2. the PCR of transgenic tobacco plant detects
Press plant genome DNA and extract the test kit operation, extract the transgene tobacco genomic dna, take genomic dna as template, 35S promoter adds the forward gene fragment for clone's target, carries out the PCR reaction; The order-checking of PCR product, comparison.Screen positive transfer-gen plant by the method.
Upstream primer: 5 '-GCACGACACTCTGGTCTACTC-3 '
Downstream primer: 5 '-TTATTTAATGGGCTAAAAATGGTT-3 '
Screen positive transfer-gen plant by PCR.
As shown in Figure 3, after testing, contain target fragment in regeneration plant.Collect target fragment, deliver Shanghai and give birth to the work order-checking, sequencing result conforms to original design, is judged as positive plant.
embodiment 5: the acquisition of the normal low content of lignin plant of growth.
1. the mensuration of transgenic tobacco plant content of lignin
Be taken at transgenosis and the wild-type tobacco blade cultivated in Nutrition Soil and dry to constant weight, get 100mg as sample, measure the content of sample xylogen by classical Klason method.After testing, in transgenic tobacco plant, content of lignin on average reduces more than 10% than wild-type.
Klason method: after the sample liquid nitrogen grinding, accurately take sample 100 mg after drying to constant weight, add 12.5ml 72 % H
2sO
4, 30 ℃ digestion 1h, postdigestive mixed solution is diluted to 4 % with sterilized water, 120 ℃ the 2nd time digestion 1h, by hot solution by drying the sand core funnel (W to constant weight
1) filter, and with hot water injection 3 times, residue is put into baking oven together with funnel, 60 ℃ of (W that dry to constant weight
2), and be calculated as follows the content of lignin value.Each sample content of lignin replication 3 times, average.
Content of lignin (mg/100mg)=W
2– W
1.
2. the mensuration of transfer-gen plant physiological and biochemical index
Take outward appearance, plant height, individual plant is heavily index, relatively transgenosis and the difference of wild-type material aspect growth potential, and the content of lignin plant is hanged down in the growth that growth potential and wild-type be finally acquisition without the transgenic line of significant difference of take normally.
<110 > Liaoning University
<120 > a kind ofly suppress the synthetic plant RNA interference carrier of xylogen and construction process and application
<160> 2
<210> 1
<211> 684
<212> DNA
<213>alfalfa
cCoAOMTnucleic acid fragment (as the forward kernel acid fragment)
<400> 1
GCTATTAGTAGGGCATTCGCGCATCCTGCGAAGAATCTTGGGTATACTTCTCCATATTATTTCTTTATAAACAATGATTCCCCCCGGACTCTCTTTCTGTCCGGAGTCTTAAAGAATGAATTCTATTGAGTTGTGGTTGTTGACCAACAAATTATGCATGGGAGAAAGATTCACAAAGGAAAACTAACCTTGATCCAGAAAGAAAGGGGCCCCTTCATCGCATCGGGTTGGGTTGGCCCATCAGAATTTGTGCATTGCATCCTACCTAATTCGTTAGCGCTTTTTCTTTTAAGAATGCATCTGGTTCTATCTTTCTTTCGCCAGTTAGTCCACCTTTTAGTGATTCTAGTAATTCTGGTTTGATAGTGCTTAGAATGTCTCTTTCATATTGAGCAATTTTGTCTAATGGCATTCGATCACAGAATCCATTGACAGCTGCATAAATTACTAGAATTTGTTTTTCAATTGGAAGTGGTGCATATTGTGGTTGTTTTAGTACTTCTGTAAGCCTTGCACCTCTATTGAGTAATGCCTGAGTCGCAGCATCAAGGTCTGAGCCAAATTGAGCAAAGGCGGCCACTTCGCGATATTGTGCCAATTCAAGTTTTAAACTACCGCAGACTTGTTTCATAGCTTTCAACTGAGCGGCAGACCCGACGCGCCTCTCGCATTTTTTATATATAA
<210> 2
<211> 686
<212> DNA
<213>alfalfa
cCoAOMTnucleic acid fragment (as the inverse kernel acid fragment)
<400> 2
CCTTGCCGGCTAGCTGAGCTATGAACAGTCTGCGGTAGTTTAAAACTTGAATTGGCACAATATCGCGAAGTGGCCGCCTTTGCTCAATTTGGCTCAGACCTTGATGCTGCGACTCAGGCATTACTCAATAGAGGTGCAAGGCTTACAGAAGTACTAAAACAACCACAATATGCACCACTTCCAATTGAAAAACAAATTCTAGTAATTTATGCAGCTGTCAATGGATTCTGTGATCGAATGCCATTAGACAAAATTGCTCAATATGAAAGAGACATTCTAAGCACTATCAA ACCAGAATTACTAGAATCACTAAAAGGTGGACTAACTGGCGAAAGAAAGATAGAACCAGATGCATTCTTAAAAGAAAAAGCGCTAACGAATTAGGTAGGATGCAATGCACAAATTCTGATGGGCCAACCCAACCCGATGCGATGAAGGGGCCCCTTTCTTTCTGGATCAAGGTTAGTTTTCCTTTGTGAATCTTTCTCCCATGCATAATTTGTTGGTCAACAACCACAACTCAATAGAATTCATTCTTTAAGACTCCGGACAGAAAGAGAGTCCGGGGGGAATCATTGTTTATAAAGAAATAATATGGAGAAGTATACCCAAGATTTTCTTCGCAGGATGCGCGAATTTGCCCTACTAATTATCCTTTGCTTTCCTTCTCCGCCCCGGGGGGAAGG
Claims (4)
1. one kind is suppressed the synthetic plant RNA interference carrier of xylogen, it is characterized in that described plant RNA interference carrier is: by the alfalfa shown in sequence table SEQ ID NO.1
cCoAOMTthe part nucleotide sequence is as the alfalfa shown in forward kernel acid fragment and sequence table SEQ ID NO.2
cCoAOMthe part nucleotide sequence, as the inverse kernel acid fragment, inserts in plant expression vector pFGC5941.
2. the construction process of the synthetic plant RNA interference carrier of the described inhibition xylogen of claim 1 is characterized in that comprising the following steps:
1) extraction of the total RNA of alfalfa;
2) reverse transcription obtains alfalfa cDNA;
3) with corresponding restriction enzyme site, respectively as the alfalfa of forward kernel acid fragment and inverse kernel acid fragment
cCoAOMTthe pcr amplification of nucleotide sequence;
4) the forward kernel acid fragment of pcr amplification and inverse kernel acid fragment reclaim through cutting glue, are connected respectively on the T carrier;
5) double digestion is connected to forward kernel acid fragment and the plant expression vector pFGC5941 on the T carrier, and electrophoresis reclaims the purpose fragment, and the T4 ligase enzyme connects, and obtains intermediate carrier pFGC5941-CCoAOMT1;
6) double digestion is connected to inverse kernel acid fragment and the pFGC5941-CCoAOMT1 on the T carrier, and electrophoresis reclaims the purpose fragment, and the T4 ligase enzyme connects, and obtains plant RNA interference carrier pFGC5941-CCoAOMTi.
3. a restructuring agrobacterium tumefaciens, is characterized in that plant RNA interference carrier pFGC5941-CCoAOMTi is transformed to agrobacterium tumefaciens, obtains the restructuring agrobacterium tumefaciens.
4. the application of the described plant RNA interference carrier of claim 1 in cultivating low content of lignin plant is characterized in that method is as follows:
1) adopt the leaf dish method restructuring agrobacterium tumefaciens conversion of plant blade that contains plant RNA interference carrier pFGC5941-CCoAOMTi;
2) vanes is cultivated and is obtained regeneration plant;
3) Transplantation of Regenerated Plantlets is obtained to transfer-gen plant to the basin that Nutrition Soil is housed.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310079414.3A CN103146745B (en) | 2013-03-13 | 2013-03-13 | Plant RNA (Ribose Nucleic Acid) interference vector for inhibiting lignin from synthesizing, and construction method and application of plant RNA interference vector |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310079414.3A CN103146745B (en) | 2013-03-13 | 2013-03-13 | Plant RNA (Ribose Nucleic Acid) interference vector for inhibiting lignin from synthesizing, and construction method and application of plant RNA interference vector |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103146745A true CN103146745A (en) | 2013-06-12 |
| CN103146745B CN103146745B (en) | 2015-07-15 |
Family
ID=48545063
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310079414.3A Active CN103146745B (en) | 2013-03-13 | 2013-03-13 | Plant RNA (Ribose Nucleic Acid) interference vector for inhibiting lignin from synthesizing, and construction method and application of plant RNA interference vector |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103146745B (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103642827A (en) * | 2013-10-17 | 2014-03-19 | 吉林省农业科学院 | RNA interference vector suitable for herbicide selection marker Bar gene |
| CN105532251A (en) * | 2016-01-26 | 2016-05-04 | 西北农林科技大学 | Cultivation method for raising alfalfa digestibility |
| CN114854788A (en) * | 2022-06-08 | 2022-08-05 | 郑州大学 | Plant expression vector and application thereof in degradation of rice lignin |
-
2013
- 2013-03-13 CN CN201310079414.3A patent/CN103146745B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| DIANJING GUO等: "Downregulation of Caffeic Acid 3-o-Methyltransferase and Caffeoyl CoA 3-o-Methyltransferase in Transgenic Alfalfa: Impacts on lignin Structure and Implications for the Biosynthesis of G and S Lignin", 《THE PLANT CELL》 * |
| 邓晶等: "苎麻CCoAOMT基因干扰表达载体构建及对烟草的转化", 《湖南农业大学学报(自然科学版)》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103642827A (en) * | 2013-10-17 | 2014-03-19 | 吉林省农业科学院 | RNA interference vector suitable for herbicide selection marker Bar gene |
| CN105532251A (en) * | 2016-01-26 | 2016-05-04 | 西北农林科技大学 | Cultivation method for raising alfalfa digestibility |
| CN114854788A (en) * | 2022-06-08 | 2022-08-05 | 郑州大学 | Plant expression vector and application thereof in degradation of rice lignin |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103146745B (en) | 2015-07-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105543270A (en) | Double resistance CRISPR/Cas9 carrier and application | |
| CN107365793A (en) | A kind of method of extensive genome editor suitable for plant | |
| CN102002101B (en) | Plant root development related protein ZmNR1 and coding gene thereof | |
| CN105087640B (en) | Adjust gene and its application of vegetable seeds development | |
| CN103333901B (en) | Liriodendron hybrid LhWOX1 gene and application thereof | |
| CN108660140B (en) | Application of SlSL4 gene in regulation and control of tomato fruit ripening | |
| CN108192896A (en) | The slow anion channel albumen NtSLAH1 of one tobacco and its application | |
| CN104711259B (en) | A kind of double miRNA suppress expression vector and its construction method and application | |
| CN103146745B (en) | Plant RNA (Ribose Nucleic Acid) interference vector for inhibiting lignin from synthesizing, and construction method and application of plant RNA interference vector | |
| CN113717978B (en) | sgRNA for reducing cotton gossypol content and expression vector and application thereof | |
| CN101451140B (en) | Genetic transformation method of creeping type ground-cover chrysanthemum | |
| CN103183731B (en) | Dendrobe DnMYB type transcription factor, coding gene, carrier and engineering bacteria and application thereof | |
| CN105039345B (en) | The clone of miRNA for enhancing mulberry tree salt resistance ability a kind of and its application | |
| CN102286527A (en) | Genetic transformation method for DREB (Dehydration Responsive Element Binding) gene transformation Anthurium | |
| CN103361365B (en) | Coniothyrium-minitans siderophore transporter (CmSit1) gene as well as preparation method and application thereof | |
| CN112351680A (en) | Plants with improved digestibility and marker haplotype | |
| CN107058324A (en) | Rice root specific expression promoter POsRO4 and corresponding rice cultivating method | |
| CN105002194A (en) | Eucalyptus TPS gene, RNA interference vector and application thereof | |
| CN107177596A (en) | A kind of paddy rice water logging induction type tissue specificity expression promoter Possub5 and its application | |
| CN104059938B (en) | The rna interference vector of citrus fruit fly paravoltage dependent sodium channel gene and construction method thereof and application | |
| CN102533762B (en) | Method for obtaining novel desensitization transgenic soybean material | |
| CN104911198B (en) | Blueberry salt tolerant, anti-drought gene VcLON2 and its coding albumen and application | |
| CN104059912B (en) | Paddy rice iron deficiency evoked promoter and application thereof | |
| CN108866080A (en) | Tomato stress response gene, its recombinant expression carrier and its application in cultivation salt tolerant tomato | |
| CN110863006B (en) | Method for improving tillering and regeneration of rice |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant |