CN103145820B - Cyclic-permutation fluorescent protein and preparation method and application of cyclic permutation fluorescent protein - Google Patents
Cyclic-permutation fluorescent protein and preparation method and application of cyclic permutation fluorescent protein Download PDFInfo
- Publication number
- CN103145820B CN103145820B CN201310063382.8A CN201310063382A CN103145820B CN 103145820 B CN103145820 B CN 103145820B CN 201310063382 A CN201310063382 A CN 201310063382A CN 103145820 B CN103145820 B CN 103145820B
- Authority
- CN
- China
- Prior art keywords
- fluorescin
- gly
- glu
- leu
- asp
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a cyclic-permutation fluorescent protein and a preparation method and an application of the cyclic permutation fluorescent protein and belongs to the field of biotechnologies. The cyclic-permutation fluorescent protein is coded and expressed by a fusion gene, is formed spontaneously and quickly in a cyclizing way after being catalyzed by an introne therein, can generate fluorescent light after being hydrolyzed by a corresponding proteolytic enzyme and can serve as a proteolytic enzyme activity indicator hereby. According to the design, the cyclic-permutation fluorescent protein is used as the substrate of the proteolytic enzyme to detect the activity of the proteolytic enzyme quickly, accurately, sensitively, intuitively and conveniently in a short time by taking the fluorescent light generated from reaction as an index without the necessity of damaging a sample. The cyclic-permutation fluorescent protein can be used for monitoring the activity of the proteolytic enzyme in a cell in real time and detecting the activity of the proteolytic enzyme in vitro conveniently. Because the fluorescence method facilitates detection and is convenient to operate, the cyclic-permutation fluorescent protein and the expressing gene thereof can be prepared into reagents or kits for detecting the activities of proteolytic enzymes.
Description
Technical field
The present invention relates to biotechnology, specifically a kind of cyclisation cyclic permutation fluorescin and its production and use.
Background technology
Separate green fluorescent protein (the Green fluorescent protein from Victoria's multitube jellyfish in the sixties in 20th century, GFP) and through " GFP family " albumen of transforming the mutant formation obtaining obtain develop rapidly, progressively become and explore active somatic cell anabolism, katabolism ultimate principle, understand the important means of the function of various enzymes, for furtheing investigate and effectively utilizing and lay the first stone.
Fluorescin application mainly comprises: (1) genetic transcription or as a kind of reporter gene of being combined with goal gene.Fluorescence protein gene engages with heterologous gene the mosaic gene that enough becomes encoding fusion protein at N end or C end, and its expression product had both kept the biological activity of foreign protein, showed again the fluorescent characteristic with natural fluoresence protein similar.This specific character of fluorescin provides a kind of fluorescent mark for protein, not only can be used in vivo following the trail of synthesizing, transport and location of a certain specific protein, also, for composition analysis and the observation of emiocytosis process etc. of the dynamic observation of organoid, mitotic research, cytoskeleton, even also can analyze and research in the dynamic change of viable cell to some DNA sequence dna.There is higher sensitivity compared with traditional antibody labeling technology, simplify the operation stepss such as cell is fixed, osmotic pressure adjustment, antibody cultivation, available fluorescent microscope is directly observed, and fluorescin do not have toxicity, can high level expression in different biologies and do not affect its physiological function.(2) bimolecular fluorescence complementary technology (Bimolecular fluorescence complementation, BiFC).Fluorescin is cut in some specific site, form 2 polypeptide of not fluorescent N end and C end, be called N fragment and C fragment.These two fragments in cell when coexpression or external mixing, can not be spontaneous be assembled into complete fluorescin, in the time of the excitation of this fluorescin, can not produce fluorescence.But when the fragment of these two fluorescins is connected respectively on one group of interactional target protein, in cell when this two fusion roteins of coexpression or external mixing, due to the interaction of target protein, two fragments of fluorescin are spatially mutually near complementary, be reconfigured to the activated fluorescin molecule of complete tool, and under the excitation of this fluorescin, distribute fluorescence.BiFC technology is used widely rapidly once occurring, successfully for the interaction of multiple proteins, as intestinal bacteria, yeast cell, filamentous fungus, mammalian cell etc.The advantage of this technology is applied widely, the albumen of studying is among its natural environment, the interaction of observing protein intuitively, and consuming time shorter compared with being widely used the yeast-two hybrid technique of studying protein interactions i (invivo).(3) fluorescence resonance energy switch technology (Fluorescence Resonance Energy Transfer, FRET).When a fluorescence molecule is (as fluorescin, as donor) emission spectrum and the absorption spectrum of another fluorescence molecule (as acceptor) have when overlapping, if these two fluorescence molecule distances are close, can there is radiationless energy by electromagnetism dipolar interaction between donor and acceptor and shift.Require the distance between donor and acceptor to be less than 10 nanometers owing to will there is energy transfer, therefore can be used for studying spatial relation and the interaction of molecule.Now develop the tens of kinds of different fluorescins that absorb emission spectrum, the fluorescin combination of existing many practicalities, making becomes one of most widely used fluorescence technique based on the FRET of fluorescin.And along with more how long the appearance of ripple fluorescin, emission spectrum is constantly being widened, and has developed again the application that multicolor fluorescence resonance transfer technology has further been expanded this technology.
Proteolytic ferment extensively exists in vivo, aspect adjusting biological function, is playing very important effect.Apoptosis is the abiogenous process of cell, is the programmed death of cell, and is subject to gene regulating, is that organism is grown and the indispensable part of function, comprises two main paties: exogenous death receptor pathway * and endogenous mitochondria pathway.Wherein a proteinoid lytic enzyme Caspase plays vital effect.
In the time that extracellular environment generation lethality changes, ectogenic apoptosis pathway is activated.Be present in the Fas outside born of the same parents, TNFa(Tumor Necrosis Factor) part receptors bind corresponding with it, apoptotic signal is passed to born of the same parents' intracellular domain by ectodomain, receptor oligomerization simultaneously, recruit and in conjunction with cofactor FADD (Fas-Associated Death Domain), TRADD(Tumor Necrosis Factor Receptor-1-Associated Death Domain), FADD, TRADD albumen is by DED (Death Effector Domain, death effector territory) and precursor L-Cysteine HCL Anhydrous Procaspase-8(Cysteine Proteases) combination, now form DISC (Death Inducing Signaling Complex, dead inducement signal complex body).In conjunction with Procaspase-8 activate by self splicing, article one, approach is to shear BID albumen (Bcl2 Interacting Protein, Bcl-2 interaction protein), its carboxyl terminal part inserts to plastosome, brings out CytoC(cytochrome C) release.The CytoC and the APAF1(Apoptotic Protease Activating Factor-1 that discharge, apoptosis protease-activating factor 1) combination, simultaneously in conjunction with dATP and Procaspase-9, and activates Caspase-9.The Caspase-9 of activation shears Procaspase-3 and makes its activation.Another approach is exactly that the Caspase-8 direct shearing Procaspase-3 activating makes its activation.The Caspase-3 of activation shears DNA cleavage factor ICAD(Inhibitor of Caspase-Activated Dnase, relies on the DNA enzyme inhibition factor that Caspase-activates), this factor exists with heterodimer form, comprises CAD and shears ICAD two portions.The ICAD shearing separates with CAD, and induction has the CAD oligomerization of DNA enzymic activity.The CAD oligomer of activation further causes the fracture of DNA between nucleosome, and chromatin concentrates, and cell finally moves towards apoptosis.
Apoptosis also can be induced generation by intrinsic pathway.Cell endogenous stress damage, as oncogene, DNA damage, anoxics etc. all can cause mitochondrial membrane permeability (Mitochondrial Membrane Permeabilization) to increase.There are two kinds of mechanism about the change of mitochondrial membrane permeability: one is VDAC(Voltage-Dependent Anion Channel, voltage dependence anion channel), ANT(Adenine Nucleotide Transporter, adenine nucleotide transport factor), PBR(Peripheral-type Benzodiazepine Receptor, periphery type benzodiazepine receptors) and CypD(Cyclophilin-D, cyclophilin D) jointly form PTPC(Permeability Transition Pore Complex, permeability is changed hole complex body).This complex body may with BAX(Bcl2 Associated X-protein, Bcl2 associated protein X), BAK1(Bcl2 Antagonist Killer-1, Bcl2 protein antagonist-1) acceleration line Mitochondria Membrane duct is open relevant.Another is that BAX discharges and inserts to plastosome from tenuigenin, and under apoptotic signal effect, oligomerization forms albumen duct.The increase of mitochondrial membrane permeability causes CytoC release to increase, and finally causes the activation of Caspase-9.The Caspase-9 of activation shears Caspase-3 subsequently, causes a series of variations in downstream passages, causes apoptosis.
As can be seen here, Caspases is the key protein lytic enzyme of apoptosis passage downstream, can reflect the survival condition of cell and cell to the monitoring of its activity inside and outside physiological and pathological change.
Summary of the invention
The present invention is exactly on the basis of existing fluorescin, and a kind of active cyclisation cyclic permutation fluorescin that detects proteolytic ferment and its production and use is provided.
The present invention realizes according to following technical scheme.
A kind of cyclisation cyclic permutation fluorescin, described albumen is cyclic protein, merged the genetic expression of cyclic permutation fluorescin by coding, and formed by the spontaneous cyclisation of albumen intron catalysis wherein rapidly, the VPAI that fusion gene coding taking fluorescin mVenus as template is expressed, containing the recognition site DEVDG of proteolytic ferment, after proteolytic ferment Caspase-3 hydrolysis, produce yellow fluorescence, become hydrolase of proteolysis indicator, the aminoacid sequence of VPAI is as shown in VPAI sequence in sequence table.
Wherein the recognition site DEVDG(of proteins encoded lytic enzyme Caspase-3 respectively corresponding aminoacid sequence be: aspartic acid, L-glutamic acid, α-amino-isovaleric acid, aspartic acid and glycine) nucleotide sequence be GACGAGGTGGACGGC.
Described cyclisation cyclic permutation fluorescin, the CPAI that fusion gene coding taking fluorescin Cerulean as template is expressed, containing the recognition site DEVDG of proteolytic ferment, after proteolytic ferment Caspase-3 hydrolysis, produce cyan fluorescence, become hydrolase of proteolysis indicator, the aminoacid sequence of CPAI is as shown in CPAI sequence in sequence table.
Described cyclisation cyclic permutation fluorescin, the GPAI that fusion gene coding taking fluorescent protein sfGFP as template is expressed, containing the recognition site DEVDG of proteolytic ferment, after proteolytic ferment Caspase-3 hydrolysis, produce green fluorescence, become hydrolase of proteolysis indicator, the aminoacid sequence of GPAI is as shown in GPAI sequence in sequence table.
Described cyclisation cyclic permutation fluorescin, the mCPAI that fusion gene coding taking fluorescin mCherry as template is expressed, containing the recognition site DEVDG of proteolytic ferment, after proteolytic ferment Caspase-3 hydrolysis, produce red fluorescence, become hydrolase of proteolysis indicator, the aminoacid sequence of mCPAI is as shown in mCPAI sequence in sequence table.
According to claim 1, the preparation method of cyclisation cyclic permutation fluorescin, the steps include:
1. the structure of cyclisation cyclic permutation fluorescence protein gene expression plasmid,
A. N end free linear fluorescent albumen and C end are shortened, retain the sequence of fluorescin function,
B. and at certain specific site of fluorescin cut off, form N end and C end two portions polypeptide fragment,
C. connect N end and C end after shortening, insert the recognition site of a certain proteolytic ferment simultaneously, make two polypeptide become a complete cyclic permutation fluorescin,
D. by the N of cyclic permutation fluorescin
1end and C
1the N end of end and albumen intron merges with C end polypeptide, forms cyclic permutation fluorescent fusion protein;
2. the cDNA of cyclic permutation fluorescent fusion protein is connected on expression vector, plasmid is imported in mammalian cell and expressed, the rapid spontaneous cyclisation of its product energy, obtains the cyclisation cyclic permutation fluorescin that is directly used in hydrolase of proteolysis in indicator cells.
The preparation method of described cyclisation cyclic permutation fluorescin, it is that the cDNA of cyclic permutation fluorescent fusion protein is connected on expression vector, plasmid is imported to bacterium, or fungi system, or expressed in insect cells, extract albumen, purifying, obtains the cyclisation cyclic permutation fluorescin of monitoring extracellular proteolytic enzyme activity.
The preparation method of described cyclisation cyclic permutation fluorescin, described plasmid imports in mammalian cell and expresses, and is that plasmid is imported in breast cancer cell MCF-7 and expressed, in real time the cyclisation cyclic permutation fluorescin of hydrolase of proteolysis in indicator cells.
The application of cyclisation cyclic permutation fluorescin in the reagent of preparation monitoring hydrolase of proteolysis according to claim 1:
A. cyclisation cyclic permutation fluorescin and gene thereof, preparing the application in hydrolase of proteolysis reagent in Real-Time Monitoring mammalian cell, are directly used in the activity of proteolytic ferment in indicator cells;
B. cyclisation cyclic permutation fluorescin and gene thereof the application in the active agent of preparation vitro detection intracellular proteolysis enzyme detects the activity of proteolytic ferment in enzyme reaction system;
C. the application in the active agent of cyclisation cyclic permutation fluorescin and gene thereof lytic enzyme in preparation detection breast cancer cell MCF-7, cyclisation cyclic permutation fluorescin is as the indicator of breast cancer cell MCF-7 apoptosis, and the generation of fluorescence means apoptosis.
Like this in the present invention of design, substrate taking cyclisation fluorescin as proteolytic ferment, taking the fluorescence that reacts rear generation as index, does not need to destroy sample, just can detect quickly and accurately the activity of the proteolytic ferment in sample, sensitive, directly perceived, convenient, save time.Not only can realize the activity of Real-Time Monitoring intracellular proteolysis enzyme, also the activity of the outer proteolytic ferment of detection bodies easily.Detect and operation because fluorescent method is convenient, therefore, cyclisation cyclic permutation fluorescin and expressing gene thereof can be prepared into the reagent that detects protolysate enzymic activity, or test kit.
Brief description of the drawings
Fig. 1 is the structural representation of gene encoding production PAI in the present invention;
Fig. 2 is the structural representation of cyclisation cyclic permutation fluorescin;
Fig. 3 is the hydrolase of proteolysis indicator design sketch being come by yellow fluorescence protein Venus transformation;
Fig. 4 transforms by green fluorescent protein sfGFP the hydrolase of proteolysis indicator design sketch coming;
Fig. 5 is the hydrolase of proteolysis indicator design sketch being come by cyan fluorescent protein Cerulean transformation;
Fig. 6 is the hydrolase of proteolysis indicator design sketch being come by red fluorescent protein mCherry transformation.
In Fig. 1,2, the 1st, the C end polypeptide of fluorescin, the 3rd, the N end polypeptide of fluorescin, the 2nd, the recognition sequence of proteolytic ferment, DnaEc is the C end of albumen intron, DnaEn is the N end polypeptide of albumen intron.
Embodiment
Below in conjunction with drawings and Examples, the present invention will be described in detail.
A kind of cyclisation cyclic permutation fluorescin, described albumen is cyclic protein, as shown in Figure 2, merged the genetic expression of cyclic permutation fluorescin by coding, and formed by the spontaneous cyclisation of albumen intron catalysis wherein rapidly, the VPAI that fusion gene coding taking fluorescin mVenus as template is expressed, containing the recognition site DEVDG of proteolytic ferment, after proteolytic ferment Caspase-3 hydrolysis, produce yellow fluorescence, become hydrolase of proteolysis indicator, the aminoacid sequence of VPAI is as shown in VPAI sequence in sequence table.
Wherein the recognition site DEVDG(of proteins encoded lytic enzyme Caspase-3 respectively corresponding aminoacid sequence be: aspartic acid, L-glutamic acid, α-amino-isovaleric acid, aspartic acid and glycine) nucleotide sequence be GACGAGGTGGACGGC.
Described cyclisation cyclic permutation fluorescin, the CPAI that fusion gene coding taking fluorescin Cerulean as template is expressed, containing the recognition site DEVDG of proteolytic ferment, after proteolytic ferment Caspase-3 hydrolysis, produce cyan fluorescence, become hydrolase of proteolysis indicator, the aminoacid sequence of CPAI is as shown in CPAI sequence in sequence table.
Described cyclisation cyclic permutation fluorescin, the GPAI that fusion gene coding taking fluorescent protein sfGFP as template is expressed, containing the recognition site DEVDG of proteolytic ferment, after proteolytic ferment Caspase-3 hydrolysis, produce green fluorescence, become hydrolase of proteolysis indicator, the aminoacid sequence of GPAI is as shown in GPAI sequence in sequence table.
Described cyclisation cyclic permutation fluorescin, the mCPAI that fusion gene coding taking fluorescin mCherry as template is expressed, containing the recognition site DEVDG of proteolytic ferment, after proteolytic ferment Caspase-3 hydrolysis, produce green fluorescence, become hydrolase of proteolysis indicator, the aminoacid sequence of mCPAI is as shown in mCPAI sequence in sequence table.
According to claim 1, the preparation method of cyclisation cyclic permutation fluorescin, the steps include:
1. the structure of cyclisation cyclic permutation fluorescence protein gene expression plasmid,
A. N end free linear fluorescent albumen and C end are shortened, retain the sequence of fluorescin function,
B. and at certain specific site of fluorescin cut off, form N end and C end two portions polypeptide fragment,
C. connect N end and C end after shortening, insert the recognition site of a certain proteolytic ferment simultaneously, make two polypeptide become a complete cyclic permutation fluorescin,
D. by the N of cyclic permutation fluorescin
1end and C
1the N end of end and albumen intron merges with C end polypeptide, forms cyclic permutation fluorescent fusion protein;
2. the cDNA of cyclic permutation fluorescent fusion protein is connected on expression vector, plasmid is imported in mammalian cell and expressed, the rapid spontaneous cyclisation of its product energy, obtains the cyclisation cyclic permutation fluorescin that is directly used in hydrolase of proteolysis in indicator cells.
The preparation method of described cyclisation cyclic permutation fluorescin, it is that the cDNA of cyclic permutation fluorescent fusion protein is connected on expression vector, plasmid is imported to bacterium, or fungi system, or expressed in insect cells, extract albumen, purifying, obtains the cyclisation cyclic permutation fluorescin of monitoring extracellular proteolytic enzyme activity.
The preparation method of described cyclisation cyclic permutation fluorescin, described plasmid imports in mammalian cell and expresses, and is that plasmid is imported in breast cancer cell MCF-7 and expressed, in real time the cyclisation cyclic permutation fluorescin of hydrolase of proteolysis in indicator cells.
The application of cyclisation cyclic permutation fluorescin in the reagent of preparation monitoring hydrolase of proteolysis according to claim 1:
A. cyclisation cyclic permutation fluorescin and gene thereof, preparing the application in hydrolase of proteolysis reagent in Real-Time Monitoring mammalian cell, are directly used in the activity of proteolytic ferment in indicator cells;
B. cyclisation cyclic permutation fluorescin and gene thereof the application in the active agent of preparation vitro detection intracellular proteolysis enzyme detects the activity of proteolytic ferment in enzyme reaction system;
C. the application in the active agent of cyclisation cyclic permutation fluorescin and gene thereof lytic enzyme in preparation detection breast cancer cell MCF-7, cyclisation cyclic permutation fluorescin is as the indicator of breast cancer cell MCF-7 apoptosis, and the generation of fluorescence means apoptosis.
The present invention is by PCR method by the two ends displacement of fluorescence protein gene, and the sequence of the C terminal amino acid of encoding is placed in 5 ' end, and the sequence of coding N terminal amino acid is placed in 3 ' end, produces two new ends simultaneously, is referred to as N
1end and C
1end; Use respectively 5 ' forward primer and middle reverse primer, middle forward primer and 3 ' reverse primer, carrying out two PCR taking the cDNA of fluorescin as template reacts, and then with 5 ' forward primer and 3 ' reverse primer, merge PCR taking the PCR product in above-mentioned two reactions as template, after two-wheeled PCR, the N that the sequence of proteins encoded intein C end polypeptide merges at cyclic permutation fluorescin cDNA
1end, the C that the sequence of proteins encoded intein N end polypeptide merges at cyclic permutation fluorescin cDNA
1end, makes two polypeptide become a complete cyclic protein, and be the encoded sequence replacing of proteolysis enzyme recognition site of the sequence of wherein encode original N and C terminal amino acid obtains the cDNA of cyclic permutation fluorescin (PAI);
In PAI, albumen intron fragment is identified mutually, and spontaneous mediation cpFP protein trans-splicing, forms a complete cyclic protein, and this cyclisation albumen is the actual hydrolase of proteolysis indicator (cPAI) playing a role.Free N end holds the spontaneous formation of the luminophore to fluorescin center to play conclusive effect with C, also connects by force N at the recognition sequence with proteolytic ferment
1end and C
1when end, change N
1locus, cause the change of fluorescin space conformation, fluorescin loss of function, therefore PAI can not fluoresce.After albumen intron Intein mediating proteins trans-splicing connects, self falling separates, and improves on the one hand the efficiency that fluorescin luminophore forms, and avoids on the other hand the combination between fluorescin bimolecular, produces background fluorescence.
(in body) application in the cell of one .cPAI
Embodiment 1:
The instrument of producing the key protein lytic enzyme caspase-3 in Real-Time Monitoring apoptosis taking mVenus fluorescin as masterplate, is referred to as cVPAI, and concrete operations are as follows:
1. build plasmid:
A. free Venus fluorescin N end and C end are reduced to shortly by PCR method, (N end and the C of generation hold, called after N to ensure the short sequence of fluorescin function
1and C
1).In this implementation column, use 6 to 229 residues of Venus.
B. Venus fluorescin 154 and 155 between cut off, form free N end and C end fragment (called after N
2and C
2).
C. use recognition site DEVDG(Asp, Glu, Val, Asp, the Gly of caspase-3) connect the N of wild-type after shortening
1end and C
1end inserts simultaneously, obtains cpVFP.
D. hold C2 and the N2 that (DnaE-C) merges respectively at cpVFP to hold at the N end (DnaE-N) of Npu DnaE intron and C.Obtain VPAI, nucleotide sequence is as shown in sequence table № 2.
E.VPAI can spontaneous cyclisation form cVPAI, is the indicator of Caspase-3.
The primer of f.VPAI,
5 ' forward primer: CGAATTCATGGACAAGCAGAAGAACGGCAT
3 ' reverse primer: CGGATCCGGCGGTGATATAGACGTTGTGGC
Middle forward primer:
TCGTGACCGCCGCCGGGATCGACGAGGTGGACGGCTTCACCGGGGTGGTGCCCAT
Middle reverse primer:
ATGGGCACCACCCCGGTGAAGCCGTCCACCTCGTCGATCCCGGCGGCGGTCACGA
2. the plasmid transfection of expressing VPAI is entered to cell, express VPAI, in cell, automatic ring changes into cVPAI.
3. cell death inducing activates Caspase-3 and and has a proteolytic ferment of activity the same with it.
4. fluorescence microscopy Microscopic observation change in fluorescence
Result shows (as Fig. 3), the plasmid of expressing VPAI is proceeded to MCF-7 cells, then adding inductor TNF-α can activate Caspase-3 cell death inducing, there is fluorescence in apoptotic cell, and the inhibitor V-ZAD of Capases-3 can suppress the generation of cell fluorescence.Illustrate at the proteolytic ferment of apoptotic process caspase-3-like and be activated, act on cVPAI, and make it produce yellow fluorescence.
Equally, PAI gene is imported in animal body by the method for plasmid transfection or virus infection, or preparation is containing the transgenic animal of PAI, gets final product the activity of the proteolytic ferment Capases-3 in Real-Time Monitoring animal body.
Below the aminoacid sequence of VPAI:
MIKIATRKYLGKQNVYDIGVERDHNFALKNGFIASNCFNEFMDKQKNGIKANFKIRHNVEDGSVQLADHYQQNTPIGDGPVLLPDNHYLSTQSKLSKDPNEKRDHMVLLEFVTAAGIDEVDGFTGVVPILVELDGDVNGHKFSVRGEGEGDATNGKLTLKFICTTGKLPVPWPTLVTTLTYGVQCFSRYPDHMKQHDFFKSAMPEGYVQERTISFKDDGTYKTRAEVKFEGDTLVNRIELKGIDFKEDGNILGHKLEYNFNSHNVYITAGSAEYCLSYETEILTVEYGLLPIGKIVEKRIECTVYSVDNNGNIYTQPVAQWHDRGEQEVFEYCLEDGSLIRATKDHKFMTVDGQMLPIDEIFERELDLMRVDNLPN。
Embodiment 2:
The primer of CPAI,
5 ' forward primer: cGAATTCATGGACAAGCAGAAGAACGGCAT
3 ' reverse primer: cGGATCCGGCGGTGATATAGACGTTGTCGC
Middle forward primer:
TCGTGACCGCCGCCGGGATCGACGAGGTGGACGGCTTCACCGGGGTGGTGCCCAT
Middle reverse primer:
ATGGGCACCACCCCGGTGAAGCCGTCCACCTCGTCGATCCCGGCGGCGGTCACGA
Taking Cerulean fluorescin as masterplate, according to the method in embodiment 1, produce the activated indicators of caspase-3, its cDNA called after CPAI, nucleotide sequence is as shown in sequence table № 4, and after cell inner expression, albumen automatic ring changes into cCPAI.CCPAI can be used as the activated indicators of caspase-3, the Caspase-3 effect being activated, and its product sends cyan fluorescence.As shown in Figure 4, CPAI expresses in MCF-7 cell, and the Caspase-3 in TNF-α activating cells makes the cCPAI being come by CPAI cyclisation produce cyan fluorescence.
Below the aminoacid sequence of CPAI:
MIKIATRKYLGKQNVYDIGVERDHNFALKNGFIASNCFNEFMDKQKNGIKANFKIRHNIEDGSVQLADHYQQNTPIGDGPVLLPDNHYLSTQSKLSKDPNEKRDHMVLLEFVTAAGIDEVDGFTGVVPILVELDGDVNGHKFSVSGEGEGDATYGKLTLKFICTTGKLPVPWPTLVTTLTWGVQCFARYPDHMKQHDFFKSAMPEGYVQERTIFFKDDGNYKTRAEVKFEGDTLVNRIELKGIDFKEDGNILGHKLEYNAISDNVYITAGSAEYCLSYETEILTVEYGLLPIGKIVEKRIECTVYSVDNNGNIYTQPVAQWHDRGEQEVFEYCLEDGSLIRATKDHKFMTVDGQMLPIDEIFERELDLMRVDNLPN。
Embodiment 3:
The primer of GPAI
,
5 ' forward primer: CGAACTTCAAGATCCGCCACAACGTCGAGG
3 ' reverse primer: CGGATCCGGCCGTGATATAGACGTTGTGGC
Middle forward primer:
TCGTGACCGCCGCCGGGATCGACGAGGTGGACGGCTTCACCGGGGTGGTGCCCAT
Middle reverse primer:
ATGGGCACCACCCCGGTGAAGCCGTCCACCTCGTCGATCCCGGCGGCGGTCACGA
Taking sfGFP fluorescin as masterplate, according to the method in embodiment 1, produce the activated indicators of caspase-3, its cDNA called after GPAI, nucleotide sequence is as shown in sequence table № 3, and after cell inner expression, albumen automatic ring changes into cGPAI.CGPAI can be used as the activated indicators of caspase-3, the Caspase-3 effect being activated, and its product sends green fluorescence.As shown in Figure 5, GPAI expresses in MCF-7 cell, and the Caspase-3 in TNF-α activating cells makes the cGPAI being come by GPAI cyclisation produce cyan fluorescence.
Below the aminoacid sequence of GPAI:
MIKIATRKYLGKQNVYDIGVERDHNFALKNGFIASNCFNEFMDKQKNGIKANFKIRHNVEDGSVQLADHYQQNTPIGDGPVLLPDNHYLSTQSKLSKDPNEKRDHMVLLEFVTAAGIDEVDGFTGVVPILVELDGDVNGHKFSVRGEGEGDATNGKLTLKFICTTGKLPVPWPTLVTTLTYGVQCFSRYPDHMKQHDFFKSAMPEGYVQERTISFKDDGTYKTRAEVKFEGDTLVNRIELKGIDFKEDGNILGHKLEYNFNSHNVYITAGSAEYCLSYETEILTVEYGLLPIGKIVEKRIECTVYSVDNNGNIYTQPVAQWHDRGEQEVFEYCLEDGSLIRATKDHKFMTVDGQMLPIDEIFERELDLMRVDNLPN。
Embodiment 4:
The primer of mCPAI,
5 ' forward primer: cGAATTCATGGGCGCCCTGAAGGGCGAGAT
3 ' reverse primer: cGGATCCGTCCTCGGGGTACATCCGCTCGG
Middle forward primer:
CCGAGGGCCGCCACTCCACCGACGAGGTGGACGGCATCATCAAGGAGTTCATGCG
Middle reverse primer:
CGCATGAACTCCTTGATGATGCCGTCCACCTCGTCGGTGGAGTGGCGGCCCTCGG
Taking mCherry fluorescin as masterplate, according to the method in embodiment 1, produce the activated indicators of caspase-3, its cDNA called after mCPAI, nucleotide sequence is as shown in sequence table № 5, and after cell inner expression, albumen automatic ring changes into cmCPAI.CmCPAI can be used as the activated indicators of caspase-3, the Caspase-3 effect being activated, and its product sends red fluorescence.As shown in Figure 6, mCPAI expresses in MCF-7 cell, and the Caspase-3 in TNF-α activating cells makes the cmCPAI being come by mCPAI cyclisation produce red fluorescence.
Below the aminoacid sequence of mCPAI:
MIKIATRKYLGKQNVYDIGVERDHNFALKNGFIASNCFNEFMGALKGEIKQRLKLKDGGHYDAEVKTTYKAKKPVQLPGAYNVNIKLDITSHNEDYTIVEQYERAEGRHSTDEVDGIIKEFMRFKVHMEGSVNGHEFEIEGEGEGRPYEGTQTAKLKVTKGGPLPFAWDILSPQFMYGSKAYVKHPADIPDYLKLSFPEGFKWERVMNFEDGGVVTVTQDSSLQDGEFIYKVKLRGTNFPSDGPVMQKKTMGWEASSERMYPEDGSAEYCLSYETEILTVEYGLLPIGKIVEKRIECTVYSVDNNGNIYTQPVAQWHDRGEQEVFEYCLEDGSLIRATKDHKFMTVDGQMLPIDEIFERELDLMRVDNLPN。
Extracellular (external) application of two .cPAI
At protein expression system as bacterium or expressed in insect cells purifying cPAI albumen, substrate using cPAI as corresponding proteolytic ferment, in vitro, in enzyme reaction buffer solution together with proteolytic ferment sample mix, hatch, then use the fluorescence intensity of light spectrophotometer detection reaction liquid, determine the activity of proteolytic ferment to be checked according to fluorescence intensity.
Purifying contains Caspase-3 hydrolysis site (DEVDG, aminoacid sequence) cVPAI as the substrate of Caspase-3, Caspase-3 sample and cVPAI substrate are blended in reaction system, detect the fluorescence intensity in reflection system, be the activity of known sample Caspase-3, the results are shown in Table 1.
Table 1, the activity taking PAI-C3 as substrate vitro detection Caspase-3.
| Caspase concentration (microgram) | CVPAI fluorescence intensity (arbitrary unit AU) |
| 0 | 0 |
| 2 | 524±23 |
| 4 | 1163±56 |
| 6 | 1683±78 |
| 8 | 2345±115 |
| 10 | 2534±98 |
CVPAI is with the transformation taking Venus fluorescin (a kind of yellow fluorescence protein) as template; Reaction system is 2 milliliters of phosphoric acid buffers (pH7.5); In the calculating of fluorescence intensity, deduct all background fluorescences, taking arbitrary value as unit.The result demonstration fluorescence intensity of cVPAI and the amount of Caspase are in direct ratio, show can detect in vitro very exactly taking cVPAI as substrate the activity of Caspase-3.
The present invention of design like this, taking cyclisation fluorescin as substrate, does not need to destroy sample, collects sample, sensitive, directly perceived, convenient, save time; Accomplish the activity of monitoring quickly and accurately the proteolytic ferment in sample.Not only can realize the activity that detects proteolytic ferment in Real-Time Monitoring body, also provide effective ways in order to separate the activity change of external proteolytic ferment in pathological processes.Detect and operation because fluorescent method is convenient, therefore, can set up easily the high flux screening platform of proteinase inhibitor, be prepared into the reagent that detects protolysate enzymic activity, or test kit.
Therefore, because life system is followed central dogma, except expressing in mammalian cell, technology described in the present invention and product also can be used for expressing in the species such as microorganism, fungi, plant, fruit bat and nematode, the activity of proteolytic ferment in their cells of Real-Time Monitoring.
SEQUENCE?LISTING
<110> Tumour Hospital Attached To Tianjin Medical Univ.
<120> cyclisation cyclic permutation fluorescin and its production and use
<130> 4
<160> 1
<170> PatentIn?version?3.3
<210> 1
<211> 376
<212> PRT
<213> 2?Ambystoma?laterale?x?Ambystoma?jeffersonianum
<220>
<221> VPAI
<222> (1)..(376)
<400> 1
Met?Ile?Lys?Ile?Ala?Thr?Arg?Lys?Tyr?Leu?Gly?Lys?Gln?Asn?Val?Tyr
1 5 10 15
Asp?Ile?Gly?Val?Glu?Arg?Asp?His?Asn?Phe?Ala?Leu?Lys?Asn?Gly?Phe
20 25 30
Ile?Ala?Ser?Asn?Cys?Phe?Asn?Glu?Phe?Met?Asp?Lys?Gln?Lys?Asn?Gly
35 40 45
Ile?Lys?Ala?Asn?Phe?Lys?Ile?Arg?His?Asn?Val?Glu?Asp?Gly?Ser?Val
50 55 60
Gln?Leu?Ala?Asp?His?Tyr?Gln?Gln?Asn?Thr?Pro?Ile?Gly?Asp?Gly?Pro
65 70 75 80
Val?Leu?Leu?Pro?Asp?Asn?His?Tyr?Leu?Ser?Thr?Gln?Ser?Lys?Leu?Ser
85 90 95
Lys?Asp?Pro?Asn?Glu?Lys?Arg?Asp?His?Met?Val?Leu?Leu?Glu?Phe?Val
100 105 110
Thr?Ala?Ala?Gly?Ile?Asp?Glu?Val?Asp?Gly?Phe?Thr?Gly?Val?Val?Pro
115 120 125
Ile?Leu?Val?Glu?Leu?Asp?Gly?Asp?Val?Asn?Gly?His?Lys?Phe?Ser?Val
130 135 140
Arg?Gly?Glu?Gly?Glu?Gly?Asp?Ala?Thr?Asn?Gly?Lys?Leu?Thr?Leu?Lys
145 150 155 160
Phe?Ile?Cys?Thr?Thr?Gly?Lys?Leu?Pro?Val?Pro?Trp?Pro?Thr?Leu?Val
165 170 175
Thr?Thr?Leu?Thr?Tyr?Gly?Val?Gln?Cys?Phe?Ser?Arg?Tyr?Pro?Asp?His
180 185 190
Met?Lys?Gln?His?Asp?Phe?Phe?Lys?Ser?Ala?Met?Pro?Glu?Gly?Tyr?Val
195 200 205
Gln?Glu?Arg?Thr?Ile?Ser?Phe?Lys?Asp?Asp?Gly?Thr?Tyr?Lys?Thr?Arg
210 215 220
Ala?Glu?Val?Lys?Phe?Glu?Gly?Asp?Thr?Leu?Val?Asn?Arg?Ile?Glu?Leu
225 230 235 240
Lys?Gly?Ile?Asp?Phe?Lys?Glu?Asp?Gly?Asn?Ile?Leu?Gly?His?Lys?Leu
245 250 255
Glu?Tyr?Asn?Phe?Asn?Ser?His?Asn?Val?Tyr?Ile?Thr?Ala?Gly?Ser?Ala
260 265 270
Glu?Tyr?Cys?Leu?Ser?Tyr?Glu?Thr?Glu?Ile?Leu?Thr?Val?Glu?Tyr?Gly
275 280 285
Leu?Leu?Pro?Ile?Gly?Lys?Ile?Val?Glu?Lys?Arg?Ile?Glu?Cys?Thr?Val
290 295 300
Tyr?Ser?Val?Asp?Asn?Asn?Gly?Asn?Ile?Tyr?Thr?Gln?Pro?Val?Ala?Gln
305 310 315 320
Trp?His?Asp?Arg?Gly?Glu?Gln?Glu?Val?Phe?Glu?Tyr?Cys?Leu?Glu?Asp
325 330 335
Gly?Ser?Leu?Ile?Arg?Ala?Thr?Lys?Asp?His?Lys?Phe?Met?Thr?Val?Asp
340 345 350
Gly?Gln?Met?Leu?Pro?Ile?Asp?Glu?Ile?Phe?Glu?Arg?Glu?Leu?Asp?Leu
355 360 365
Met?Arg?Val?Asp?Asn?Leu?Pro?Asn
370 375
<220>
<221> GPAI
<222> (1)..(376)
<400> 1
Met?Ile?Lys?Ile?Ala?Thr?Arg?Lys?Tyr?Leu?Gly?Lys?Gln?Asn?Val?Tyr
1 5 10 15
Asp?Ile?Gly?Val?Glu?Arg?Asp?His?Asn?Phe?Ala?Leu?Lys?Asn?Gly?Phe
20 25 30
Ile?Ala?Ser?Asn?Cys?Phe?Asn?Glu?Phe?Met?Asp?Lys?Gln?Lys?Asn?Gly
35 40 45
Ile?Lys?Ala?Asn?Phe?Lys?Ile?Arg?His?Asn?Val?Glu?Asp?Gly?Ser?Val
50 55 60
Gln?Leu?Ala?Asp?His?Tyr?Gln?Gln?Asn?Thr?Pro?Ile?Gly?Asp?Gly?Pro
65 70 75 80
Val?Leu?Leu?Pro?Asp?Asn?His?Tyr?Leu?Ser?Thr?Gln?Ser?Lys?Leu?Ser
85 90 95
Lys?Asp?Pro?Asn?Glu?Lys?Arg?Asp?His?Met?Val?Leu?Leu?Glu?Phe?Val
100 105 110
Thr?Ala?Ala?Gly?Ile?Asp?Glu?Val?Asp?Gly?Phe?Thr?Gly?Val?Val?Pro
115 120 125
Ile?Leu?Val?Glu?Leu?Asp?Gly?Asp?Val?Asn?Gly?His?Lys?Phe?Ser?Val
130 135 140
Arg?Gly?Glu?Gly?Glu?Gly?Asp?Ala?Thr?Asn?Gly?Lys?Leu?Thr?Leu?Lys
145 150 155 160
Phe?Ile?Cys?Thr?Thr?Gly?Lys?Leu?Pro?Val?Pro?Trp?Pro?Thr?Leu?Val
165 170 175
Thr?Thr?Leu?Thr?Tyr?Gly?Val?Gln?Cys?Phe?Ser?Arg?Tyr?Pro?Asp?His
180 185 190
Met?Lys?Gln?His?Asp?Phe?Phe?Lys?Ser?Ala?Met?Pro?Glu?Gly?Tyr?Val
195 200 205
Gln?Glu?Arg?Thr?Ile?Ser?Phe?Lys?Asp?Asp?Gly?Thr?Tyr?Lys?Thr?Arg
210 215 220
Ala?Glu?Val?Lys?Phe?Glu?Gly?Asp?Thr?Leu?Val?Asn?Arg?Ile?Glu?Leu
225 230 235 240
Lys?Gly?Ile?Asp?Phe?Lys?Glu?Asp?Gly?Asn?Ile?Leu?Gly?His?Lys?Leu
245 250 255
Glu?Tyr?Asn?Phe?Asn?Ser?His?Asn?Val?Tyr?Ile?Thr?Ala?Gly?Ser?Ala
260 265 270
Glu?Tyr?Cys?Leu?Ser?Tyr?Glu?Thr?Glu?Ile?Leu?Thr?Val?Glu?Tyr?Gly
275 280 285
Leu?Leu?Pro?Ile?Gly?Lys?Ile?Val?Glu?Lys?Arg?Ile?Glu?Cys?Thr?Val
290 295 300
Tyr?Ser?Val?Asp?Asn?Asn?Gly?Asn?Ile?Tyr?Thr?Gln?Pro?Val?Ala?Gln
305 310 315 320
Trp?His?Asp?Arg?Gly?Glu?Gln?Glu?Val?Phe?Glu?Tyr?Cys?Leu?Glu?Asp
325 330 335
Gly?Ser?Leu?Ile?Arg?Ala?Thr?Lys?Asp?His?Lys?Phe?Met?Thr?Val?Asp
340 345 350
Gly?Gln?Met?Leu?Pro?Ile?Asp?Glu?Ile?Phe?Glu?Arg?Glu?Leu?Asp?Leu
355 360 365
Met?Arg?Val?Asp?Asn?Leu?Pro?Asn
370 375
<220>
<221> CPAI
<222> (1)..(376)
<400> 1
Met?Ile?Lys?Ile?Ala?Thr?Arg?Lys?Tyr?Leu?Gly?Lys?Gln?Asn?Val?Tyr
1 5 10 15
Asp?Ile?Gly?Val?Glu?Arg?Asp?His?Asn?Phe?Ala?Leu?Lys?Asn?Gly?Phe
20 25 30
Ile?Ala?Ser?Asn?Cys?Phe?Asn?Glu?Phe?Met?Asp?Lys?Gln?Lys?Asn?Gly
35 40 45
Ile?Lys?Ala?Asn?Phe?Lys?Ile?Arg?His?Asn?Ile?Glu?Asp?Gly?Ser?Val
50 55 60
Gln?Leu?Ala?Asp?His?Tyr?Gln?Gln?Asn?Thr?Pro?Ile?Gly?Asp?Gly?Pro
65 70 75 80
Val?Leu?Leu?Pro?Asp?Asn?His?Tyr?Leu?Ser?Thr?Gln?Ser?Lys?Leu?Ser
85 90 95
Lys?Asp?Pro?Asn?Glu?Lys?Arg?Asp?His?Met?Val?Leu?Leu?Glu?Phe?Val
100 105 110
Thr?Ala?Ala?Gly?Ile?Asp?Glu?Val?Asp?Gly?Phe?Thr?Gly?Val?Val?Pro
115 120 125
Ile?Leu?Val?Glu?Leu?Asp?Gly?Asp?Val?Asn?Gly?His?Lys?Phe?Ser?Val
130 135 140
Ser?Gly?Glu?Gly?Glu?Gly?Asp?Ala?Thr?Tyr?Gly?Lys?Leu?Thr?Leu?Lys
145 150 155 160
Phe?Ile?Cys?Thr?Thr?Gly?Lys?Leu?Pro?Val?Pro?Trp?Pro?Thr?Leu?Val
165 170 175
Thr?Thr?Leu?Thr?Trp?Gly?Val?Gln?Cys?Phe?Ala?Arg?Tyr?Pro?Asp?His
180 185 190
Met?Lys?Gln?His?Asp?Phe?Phe?Lys?Ser?Ala?Met?Pro?Glu?Gly?Tyr?Val
195 200 205
Gln?Glu?Arg?Thr?Ile?Phe?Phe?Lys?Asp?Asp?Gly?Asn?Tyr?Lys?Thr?Arg
210 215 220
Ala?Glu?Val?Lys?Phe?Glu?Gly?Asp?Thr?Leu?Val?Asn?Arg?Ile?Glu?Leu
225 230 235 240
Lys?Gly?Ile?Asp?Phe?Lys?Glu?Asp?Gly?Asn?Ile?Leu?Gly?His?Lys?Leu
245 250 255
Glu?Tyr?Asn?Ala?Ile?Ser?Asp?Asn?Val?Tyr?Ile?Thr?Ala?Gly?Ser?Ala
260 265 270
Glu?Tyr?Cys?Leu?Ser?Tyr?Glu?Thr?Glu?Ile?Leu?Thr?Val?Glu?Tyr?Gly
275 280 285
Leu?Leu?Pro?Ile?Gly?Lys?Ile?Val?Glu?Lys?Arg?Ile?Glu?Cys?Thr?Val
290 295 300
Tyr?Ser?Val?Asp?Asn?Asn?Gly?Asn?Ile?Tyr?Thr?Gln?Pro?Val?Ala?Gln
305 310 315 320
Trp?His?Asp?Arg?Gly?Glu?Gln?Glu?Val?Phe?Glu?Tyr?Cys?Leu?Glu?Asp
325 330 335
Gly?Ser?Leu?Ile?Arg?Ala?Thr?Lys?Asp?His?Lys?Phe?Met?Thr?Val?Asp
340 345 350
Gly?Gln?Met?Leu?Pro?Ile?Asp?Glu?Ile?Phe?Glu?Arg?Glu?Leu?Asp?Leu
355 360 365
Met?Arg?Val?Asp?Asn?Leu?Pro?Asn
370 375
<220>
<221> mCPAI
<222> (1)..(371)
<400> 1
Met?Ile?Lys?Ile?Ala?Thr?Arg?Lys?Tyr?Leu?Gly?Lys?Gln?Asn?Val?Tyr
1 5 10 15
Asp?Ile?Gly?Val?Glu?Arg?Asp?His?Asn?Phe?Ala?Leu?Lys?Asn?Gly?Phe
20 25 30
Ile?Ala?Ser?Asn?Cys?Phe?Asn?Glu?Phe?Met?Gly?Ala?Leu?Lys?Gly?Glu
35 40 45
Ile?Lys?Gln?Arg?Leu?Lys?Leu?Lys?Asp?Gly?Gly?His?Tyr?Asp?Ala?Glu
50 55 60
Val?Lys?Thr?Thr?Tyr?Lys?Ala?Lys?Lys?Pro?Val?Gln?Leu?Pro?Gly?Ala
65 70 75 80
Tyr?Asn?Val?Asn?Ile?Lys?Leu?Asp?Ile?Thr?Ser?His?Asn?Glu?Asp?Tyr
85 90 95
Thr?Ile?Val?Glu?Gln?Tyr?Glu?Arg?Ala?Glu?Gly?Arg?His?Ser?Thr?Asp
100 105 110
Glu?Val?Asp?Gly?Ile?Ile?Lys?Glu?Phe?Met?Arg?Phe?Lys?Val?His?Met
115 120 125
Glu?Gly?Ser?Val?Asn?Gly?His?Glu?Phe?Glu?Ile?Glu?Gly?Glu?Gly?Glu
130 135 140
Gly?Arg?Pro?Tyr?Glu?Gly?Thr?Gln?Thr?Ala?Lys?Leu?Lys?Val?Thr?Lys
145 150 155 160
Gly?Gly?Pro?Leu?Pro?Phe?Ala?Trp?Asp?Ile?Leu?Ser?Pro?Gln?Phe?Met
165 170 175
Tyr?Gly?Ser?Lys?Ala?Tyr?Val?Lys?His?Pro?Ala?Asp?Ile?Pro?Asp?Tyr
180 185 190
Leu?Lys?Leu?Ser?Phe?Pro?Glu?Gly?Phe?Lys?Trp?Glu?Arg?Val?Met?Asn
195 200 205
Phe?Glu?Asp?Gly?Gly?Val?Val?Thr?Val?Thr?Gln?Asp?Ser?Ser?Leu?Gln
210 215 220
Asp?Gly?Glu?Phe?Ile?Tyr?Lys?Val?Lys?Leu?Arg?Gly?Thr?Asn?Phe?Pro
225 230 235 240
Ser?Asp?Gly?Pro?Val?Met?Gln?Lys?Lys?Thr?Met?Gly?Trp?Glu?Ala?Ser
245 250 255
Ser?Glu?Arg?Met?Tyr?Pro?Glu?Asp?Gly?Ser?Ala?Glu?Tyr?Cys?Leu?Ser
260 265 270
Tyr?Glu?Thr?Glu?Ile?Leu?Thr?Val?Glu?Tyr?Gly?Leu?Leu?Pro?Ile?Gly
275 280 285
Lys?Ile?Val?Glu?Lys?Arg?Ile?Glu?Cys?Thr?Val?Tyr?Ser?Val?Asp?Asn
290 295 300
Asn?Gly?Asn?Ile?Tyr?Thr?Gln?Pro?Val?Ala?Gln?Trp?His?Asp?Arg?Gly
305 310 315 320
Glu?Gln?Glu?Val?Phe?Glu?Tyr?Cys?Leu?Glu?Asp?Gly?Ser?Leu?Ile?Arg
325 330 335
Ala?Thr?Lys?Asp?His?Lys?Phe?Met?Thr?Val?Asp?Gly?Gln?Met?Leu?Pro
340 345 350
Ile?Asp?Glu?Ile?Phe?Glu?Arg?Glu?Leu?Asp?Leu?Met?Arg?Val?Asp?Asn
355 360 365
Leu?Pro?Asn
370 。
SEQUENCE?LISTING
<110> Tumour Hospital Attached To Tianjin Medical Univ.
<120> cyclisation cyclic permutation fluorescin and its production and use
<130> 4
<160> 1
<170> PatentIn?version?3.3
<210> 1
<211> 376
<212> PRT
<213> 2?Ambystoma?laterale?x?Ambystoma?jeffersonianum
<220>
<221> VPAI
<222> (1)..(376)
<400> 1
Met?Ile?Lys?Ile?Ala?Thr?Arg?Lys?Tyr?Leu?Gly?Lys?Gln?Asn?Val?Tyr
1 5 10 15
Asp?Ile?Gly?Val?Glu?Arg?Asp?His?Asn?Phe?Ala?Leu?Lys?Asn?Gly?Phe
20 25 30
Ile?Ala?Ser?Asn?Cys?Phe?Asn?Glu?Phe?Met?Asp?Lys?Gln?Lys?Asn?Gly
35 40 45
Ile?Lys?Ala?Asn?Phe?Lys?Ile?Arg?His?Asn?Val?Glu?Asp?Gly?Ser?Val
50 55 60
Gln?Leu?Ala?Asp?His?Tyr?Gln?Gln?Asn?Thr?Pro?Ile?Gly?Asp?Gly?Pro
65 70 75 80
Val?Leu?Leu?Pro?Asp?Asn?His?Tyr?Leu?Ser?Thr?Gln?Ser?Lys?Leu?Ser
85 90 95
Lys?Asp?Pro?Asn?Glu?Lys?Arg?Asp?His?Met?Val?Leu?Leu?Glu?Phe?Val
100 105 110
Thr?Ala?Ala?Gly?Ile?Asp?Glu?Val?Asp?Gly?Phe?Thr?Gly?Val?Val?Pro
115 120 125
Ile?Leu?Val?Glu?Leu?Asp?Gly?Asp?Val?Asn?Gly?His?Lys?Phe?Ser?Val
130 135 140
Arg?Gly?Glu?Gly?Glu?Gly?Asp?Ala?Thr?Asn?Gly?Lys?Leu?Thr?Leu?Lys
145 150 155 160
Phe?Ile?Cys?Thr?Thr?Gly?Lys?Leu?Pro?Val?Pro?Trp?Pro?Thr?Leu?Val
165 170 175
Thr?Thr?Leu?Thr?Tyr?Gly?Val?Gln?Cys?Phe?Ser?Arg?Tyr?Pro?Asp?His
180 185 190
Met?Lys?Gln?His?Asp?Phe?Phe?Lys?Ser?Ala?Met?Pro?Glu?Gly?Tyr?Val
195 200 205
Gln?Glu?Arg?Thr?Ile?Ser?Phe?Lys?Asp?Asp?Gly?Thr?Tyr?Lys?Thr?Arg
210 215 220
Ala?Glu?Val?Lys?Phe?Glu?Gly?Asp?Thr?Leu?Val?Asn?Arg?Ile?Glu?Leu
225 230 235 240
Lys?Gly?Ile?Asp?Phe?Lys?Glu?Asp?Gly?Asn?Ile?Leu?Gly?His?Lys?Leu
245 250 255
Glu?Tyr?Asn?Phe?Asn?Ser?His?Asn?Val?Tyr?Ile?Thr?Ala?Gly?Ser?Ala
260 265 270
Glu?Tyr?Cys?Leu?Ser?Tyr?Glu?Thr?Glu?Ile?Leu?Thr?Val?Glu?Tyr?Gly
275 280 285
Leu?Leu?Pro?Ile?Gly?Lys?Ile?Val?Glu?Lys?Arg?Ile?Glu?Cys?Thr?Val
290 295 300
Tyr?Ser?Val?Asp?Asn?Asn?Gly?Asn?Ile?Tyr?Thr?Gln?Pro?Val?Ala?Gln
305 310 315 320
Trp?His?Asp?Arg?Gly?Glu?Gln?Glu?Val?Phe?Glu?Tyr?Cys?Leu?Glu?Asp
325 330 335
Gly?Ser?Leu?Ile?Arg?Ala?Thr?Lys?Asp?His?Lys?Phe?Met?Thr?Val?Asp
340 345 350
Gly?Gln?Met?Leu?Pro?Ile?Asp?Glu?Ile?Phe?Glu?Arg?Glu?Leu?Asp?Leu
355 360 365
Met?Arg?Val?Asp?Asn?Leu?Pro?Asn
370 375
<220>
<221> GPAI
<222> (1)..(376)
<400> 1
Met?Ile?Lys?Ile?Ala?Thr?Arg?Lys?Tyr?Leu?Gly?Lys?Gln?Asn?Val?Tyr
1 5 10 15
Asp?Ile?Gly?Val?Glu?Arg?Asp?His?Asn?Phe?Ala?Leu?Lys?Asn?Gly?Phe
20 25 30
Ile?Ala?Ser?Asn?Cys?Phe?Asn?Glu?Phe?Met?Asp?Lys?Gln?Lys?Asn?Gly
35 40 45
Ile?Lys?Ala?Asn?Phe?Lys?Ile?Arg?His?Asn?Val?Glu?Asp?Gly?Ser?Val
50 55 60
Gln?Leu?Ala?Asp?His?Tyr?Gln?Gln?Asn?Thr?Pro?Ile?Gly?Asp?Gly?Pro
65 70 75 80
Val?Leu?Leu?Pro?Asp?Asn?His?Tyr?Leu?Ser?Thr?Gln?Ser?Lys?Leu?Ser
85 90 95
Lys?Asp?Pro?Asn?Glu?Lys?Arg?Asp?His?Met?Val?Leu?Leu?Glu?Phe?Val
100 105 110
Thr?Ala?Ala?Gly?Ile?Asp?Glu?Val?Asp?Gly?Phe?Thr?Gly?Val?Val?Pro
115 120 125
Ile?Leu?Val?Glu?Leu?Asp?Gly?Asp?Val?Asn?Gly?His?Lys?Phe?Ser?Val
130 135 140
Arg?Gly?Glu?Gly?Glu?Gly?Asp?Ala?Thr?Asn?Gly?Lys?Leu?Thr?Leu?Lys
145 150 155 160
Phe?Ile?Cys?Thr?Thr?Gly?Lys?Leu?Pro?Val?Pro?Trp?Pro?Thr?Leu?Val
165 170 175
Thr?Thr?Leu?Thr?Tyr?Gly?Val?Gln?Cys?Phe?Ser?Arg?Tyr?Pro?Asp?His
180 185 190
Met?Lys?Gln?His?Asp?Phe?Phe?Lys?Ser?Ala?Met?Pro?Glu?Gly?Tyr?Val
195 200 205
Gln?Glu?Arg?Thr?Ile?Ser?Phe?Lys?Asp?Asp?Gly?Thr?Tyr?Lys?Thr?Arg
210 215 220
Ala?Glu?Val?Lys?Phe?Glu?Gly?Asp?Thr?Leu?Val?Asn?Arg?Ile?Glu?Leu
225 230 235 240
Lys?Gly?Ile?Asp?Phe?Lys?Glu?Asp?Gly?Asn?Ile?Leu?Gly?His?Lys?Leu
245 250 255
Glu?Tyr?Asn?Phe?Asn?Ser?His?Asn?Val?Tyr?Ile?Thr?Ala?Gly?Ser?Ala
260 265 270
Glu?Tyr?Cys?Leu?Ser?Tyr?Glu?Thr?Glu?Ile?Leu?Thr?Val?Glu?Tyr?Gly
275 280 285
Leu?Leu?Pro?Ile?Gly?Lys?Ile?Val?Glu?Lys?Arg?Ile?Glu?Cys?Thr?Val
290 295 300
Tyr?Ser?Val?Asp?Asn?Asn?Gly?Asn?Ile?Tyr?Thr?Gln?Pro?Val?Ala?Gln
305 310 315 320
Trp?His?Asp?Arg?Gly?Glu?Gln?Glu?Val?Phe?Glu?Tyr?Cys?Leu?Glu?Asp
325 330 335
Gly?Ser?Leu?Ile?Arg?Ala?Thr?Lys?Asp?His?Lys?Phe?Met?Thr?Val?Asp
340 345 350
Gly?Gln?Met?Leu?Pro?Ile?Asp?Glu?Ile?Phe?Glu?Arg?Glu?Leu?Asp?Leu
355 360 365
Met?Arg?Val?Asp?Asn?Leu?Pro?Asn
370 375
<220>
<221> CPAI
<222> (1)..(376)
<400> 1
Met?Ile?Lys?Ile?Ala?Thr?Arg?Lys?Tyr?Leu?Gly?Lys?Gln?Asn?Val?Tyr
1 5 10 15
Asp?Ile?Gly?Val?Glu?Arg?Asp?His?Asn?Phe?Ala?Leu?Lys?Asn?Gly?Phe
20 25 30
Ile?Ala?Ser?Asn?Cys?Phe?Asn?Glu?Phe?Met?Asp?Lys?Gln?Lys?Asn?Gly
35 40 45
Ile?Lys?Ala?Asn?Phe?Lys?Ile?Arg?His?Asn?Ile?Glu?Asp?Gly?Ser?Val
50 55 60
Gln?Leu?Ala?Asp?His?Tyr?Gln?Gln?Asn?Thr?Pro?Ile?Gly?Asp?Gly?Pro
65 70 75 80
Val?Leu?Leu?Pro?Asp?Asn?His?Tyr?Leu?Ser?Thr?Gln?Ser?Lys?Leu?Ser
85 90 95
Lys?Asp?Pro?Asn?Glu?Lys?Arg?Asp?His?Met?Val?Leu?Leu?Glu?Phe?Val
100 105 110
Thr?Ala?Ala?Gly?Ile?Asp?Glu?Val?Asp?Gly?Phe?Thr?Gly?Val?Val?Pro
115 120 125
Ile?Leu?Val?Glu?Leu?Asp?Gly?Asp?Val?Asn?Gly?His?Lys?Phe?Ser?Val
130 135 140
Ser?Gly?Glu?Gly?Glu?Gly?Asp?Ala?Thr?Tyr?Gly?Lys?Leu?Thr?Leu?Lys
145 150 155 160
Phe?Ile?Cys?Thr?Thr?Gly?Lys?Leu?Pro?Val?Pro?Trp?Pro?Thr?Leu?Val
165 170 175
Thr?Thr?Leu?Thr?Trp?Gly?Val?Gln?Cys?Phe?Ala?Arg?Tyr?Pro?Asp?His
180 185 190
Met?Lys?Gln?His?Asp?Phe?Phe?Lys?Ser?Ala?Met?Pro?Glu?Gly?Tyr?Val
195 200 205
Gln?Glu?Arg?Thr?Ile?Phe?Phe?Lys?Asp?Asp?Gly?Asn?Tyr?Lys?Thr?Arg
210 215 220
Ala?Glu?Val?Lys?Phe?Glu?Gly?Asp?Thr?Leu?Val?Asn?Arg?Ile?Glu?Leu
225 230 235 240
Lys?Gly?Ile?Asp?Phe?Lys?Glu?Asp?Gly?Asn?Ile?Leu?Gly?His?Lys?Leu
245 250 255
Glu?Tyr?Asn?Ala?Ile?Ser?Asp?Asn?Val?Tyr?Ile?Thr?Ala?Gly?Ser?Ala
260 265 270
Glu?Tyr?Cys?Leu?Ser?Tyr?Glu?Thr?Glu?Ile?Leu?Thr?Val?Glu?Tyr?Gly
275 280 285
Leu?Leu?Pro?Ile?Gly?Lys?Ile?Val?Glu?Lys?Arg?Ile?Glu?Cys?Thr?Val
290 295 300
Tyr?Ser?Val?Asp?Asn?Asn?Gly?Asn?Ile?Tyr?Thr?Gln?Pro?Val?Ala?Gln
305 310 315 320
Trp?His?Asp?Arg?Gly?Glu?Gln?Glu?Val?Phe?Glu?Tyr?Cys?Leu?Glu?Asp
325 330 335
Gly?Ser?Leu?Ile?Arg?Ala?Thr?Lys?Asp?His?Lys?Phe?Met?Thr?Val?Asp
340 345 350
Gly?Gln?Met?Leu?Pro?Ile?Asp?Glu?Ile?Phe?Glu?Arg?Glu?Leu?Asp?Leu
355 360 365
Met?Arg?Val?Asp?Asn?Leu?Pro?Asn
370 375
<220>
<221> mCPAI
<222> (1)..(371)
<400> 1
Met?Ile?Lys?Ile?Ala?Thr?Arg?Lys?Tyr?Leu?Gly?Lys?Gln?Asn?Val?Tyr
1 5 10 15
Asp?Ile?Gly?Val?Glu?Arg?Asp?His?Asn?Phe?Ala?Leu?Lys?Asn?Gly?Phe
20 25 30
Ile?Ala?Ser?Asn?Cys?Phe?Asn?Glu?Phe?Met?Gly?Ala?Leu?Lys?Gly?Glu
35 40 45
Ile?Lys?Gln?Arg?Leu?Lys?Leu?Lys?Asp?Gly?Gly?His?Tyr?Asp?Ala?Glu
50 55 60
Val?Lys?Thr?Thr?Tyr?Lys?Ala?Lys?Lys?Pro?Val?Gln?Leu?Pro?Gly?Ala
65 70 75 80
Tyr?Asn?Val?Asn?Ile?Lys?Leu?Asp?Ile?Thr?Ser?His?Asn?Glu?Asp?Tyr
85 90 95
Thr?Ile?Val?Glu?Gln?Tyr?Glu?Arg?Ala?Glu?Gly?Arg?His?Ser?Thr?Asp
100 105 110
Glu?Val?Asp?Gly?Ile?Ile?Lys?Glu?Phe?Met?Arg?Phe?Lys?Val?His?Met
115 120 125
Glu?Gly?Ser?Val?Asn?Gly?His?Glu?Phe?Glu?Ile?Glu?Gly?Glu?Gly?Glu
130 135 140
Gly?Arg?Pro?Tyr?Glu?Gly?Thr?Gln?Thr?Ala?Lys?Leu?Lys?Val?Thr?Lys
145 150 155 160
Gly?Gly?Pro?Leu?Pro?Phe?Ala?Trp?Asp?Ile?Leu?Ser?Pro?Gln?Phe?Met
165 170 175
Tyr?Gly?Ser?Lys?Ala?Tyr?Val?Lys?His?Pro?Ala?Asp?Ile?Pro?Asp?Tyr
180 185 190
Leu?Lys?Leu?Ser?Phe?Pro?Glu?Gly?Phe?Lys?Trp?Glu?Arg?Val?Met?Asn
195 200 205
Phe?Glu?Asp?Gly?Gly?Val?Val?Thr?Val?Thr?Gln?Asp?Ser?Ser?Leu?Gln
210 215 220
Asp?Gly?Glu?Phe?Ile?Tyr?Lys?Val?Lys?Leu?Arg?Gly?Thr?Asn?Phe?Pro
225 230 235 240
Ser?Asp?Gly?Pro?Val?Met?Gln?Lys?Lys?Thr?Met?Gly?Trp?Glu?Ala?Ser
245 250 255
Ser?Glu?Arg?Met?Tyr?Pro?Glu?Asp?Gly?Ser?Ala?Glu?Tyr?Cys?Leu?Ser
260 265 270
Tyr?Glu?Thr?Glu?Ile?Leu?Thr?Val?Glu?Tyr?Gly?Leu?Leu?Pro?Ile?Gly
275 280 285
Lys?Ile?Val?Glu?Lys?Arg?Ile?Glu?Cys?Thr?Val?Tyr?Ser?Val?Asp?Asn
290 295 300
Asn?Gly?Asn?Ile?Tyr?Thr?Gln?Pro?Val?Ala?Gln?Trp?His?Asp?Arg?Gly
305 310 315 320
Glu?Gln?Glu?Val?Phe?Glu?Tyr?Cys?Leu?Glu?Asp?Gly?Ser?Leu?Ile?Arg
325 330 335
Ala?Thr?Lys?Asp?His?Lys?Phe?Met?Thr?Val?Asp?Gly?Gln?Met?Leu?Pro
340 345 350
Ile?Asp?Glu?Ile?Phe?Glu?Arg?Glu?Leu?Asp?Leu?Met?Arg?Val?Asp?Asn
355 360 365
Leu?Pro?Asn
370
Claims (8)
1. a cyclisation cyclic permutation fluorescin, it is characterized in that: described albumen is cyclic protein, merged the genetic expression of cyclic permutation fluorescin by coding, and formed by the spontaneous cyclisation of albumen intron catalysis wherein rapidly, the VPAI that fusion gene coding taking fluorescin mVenus as template is expressed, containing the recognition site DEVDG of proteolytic ferment, after proteolytic ferment Caspase-3 hydrolysis, produce yellow fluorescence, become hydrolase of proteolysis indicator, the aminoacid sequence of VPAI is as shown in VPAI sequence in sequence table.
2. a cyclisation cyclic permutation fluorescin, it is characterized in that: described albumen is cyclic protein, merged the genetic expression of cyclic permutation fluorescin by coding, and formed by the spontaneous cyclisation of albumen intron catalysis wherein rapidly, the CPAI that fusion gene coding taking fluorescin Cerulean as template is expressed, containing the recognition site DEVDG of proteolytic ferment, after proteolytic ferment Caspase-3 hydrolysis, produce cyan fluorescence, become hydrolase of proteolysis indicator, the aminoacid sequence of CPAI is as shown in CPAI sequence in sequence table.
3. a cyclisation cyclic permutation fluorescin, it is characterized in that: described albumen is cyclic protein, merged the genetic expression of cyclic permutation fluorescin by coding, and formed by the spontaneous cyclisation of albumen intron catalysis wherein rapidly, the GPAI that fusion gene coding taking fluorescent protein sfGFP as template is expressed, containing the recognition site DEVDG of proteolytic ferment, after proteolytic ferment Caspase-3 hydrolysis, produce green fluorescence, become hydrolase of proteolysis indicator, the aminoacid sequence of GPAI is as shown in GPAI sequence in sequence table.
4. a cyclisation cyclic permutation fluorescin, it is characterized in that: described albumen is cyclic protein, merged the genetic expression of cyclic permutation fluorescin by coding, and formed by the spontaneous cyclisation of albumen intron catalysis wherein rapidly, the mCPAI that fusion gene coding taking fluorescin mCherry as template is expressed, containing the recognition site DEVDG of proteolytic ferment, after proteolytic ferment Caspase-3 hydrolysis, produce green fluorescence, become hydrolase of proteolysis indicator, the aminoacid sequence of mCPAI is as shown in mCPAI sequence in sequence table.
5. a preparation method for any one cyclisation cyclic permutation fluorescin described in claim 1-4, is characterized in that:
1. the structure of cyclisation cyclic permutation fluorescence protein gene expression plasmid,
A. N end free linear fluorescent albumen and C end are shortened, retain the sequence of fluorescin function,
B. and at certain specific site of fluorescin cut off, form N end and C end two portions polypeptide fragment,
C. connect N end and C end after shortening, insert the recognition site of a certain proteolytic ferment simultaneously, make two polypeptide become a complete cyclic permutation fluorescin,
D. by the N of cyclic permutation fluorescin
1end and C
1the N end of end and albumen intron merges with C end polypeptide, forms cyclic permutation fluorescent fusion protein;
2. the cDNA of cyclic permutation fluorescent fusion protein is connected on expression vector, plasmid is imported in mammalian cell and expressed, the rapid spontaneous cyclisation of its product energy, obtains the cyclisation cyclic permutation fluorescin that is directly used in hydrolase of proteolysis in indicator cells.
6. the preparation method of cyclisation cyclic permutation fluorescin according to claim 5, it is characterized in that: the cDNA of cyclic permutation fluorescent fusion protein is connected on expression vector, plasmid is imported to bacterium, or fungi system, or expressed in insect cells, extract albumen, purifying, obtains the cyclisation cyclic permutation fluorescin of monitoring extracellular proteolytic enzyme activity.
7. the preparation method of cyclisation cyclic permutation fluorescin according to claim 5, is characterized in that: described plasmid imports in mammalian cell and expresses, and is that plasmid is imported in breast cancer cell MCF-7 and expressed, in real time indicator cells
The cyclisation cyclic permutation fluorescin of interior hydrolase of proteolysis.
8. the application of cyclisation cyclic permutation fluorescin in preparation detection proteolytic ferment Caspase-3 active agent as described in any one in claim 1-4:
A. cyclisation cyclic permutation fluorescin, preparing the application in proteolytic ferment Caspase-3 active agent in Real-Time Monitoring mammalian cell, is directly used in the activity of proteolytic ferment Caspase-3 in indicator cells;
B. cyclisation cyclic permutation fluorescin, in the application of preparing in vitro detection intracellular proteolysis enzyme Caspase-3 active agent, detects the activity of proteolytic ferment Caspase-3 in enzyme reaction system;
C. cyclisation cyclic permutation fluorescin detects the application in hydrolytic enzyme activities reagent in breast cancer cell MCF-7 in preparation, and cyclisation cyclic permutation fluorescin is as the indicator of breast cancer cell MCF-7 apoptosis, and the generation of fluorescence means apoptosis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310063382.8A CN103145820B (en) | 2013-02-28 | 2013-02-28 | Cyclic-permutation fluorescent protein and preparation method and application of cyclic permutation fluorescent protein |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310063382.8A CN103145820B (en) | 2013-02-28 | 2013-02-28 | Cyclic-permutation fluorescent protein and preparation method and application of cyclic permutation fluorescent protein |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103145820A CN103145820A (en) | 2013-06-12 |
| CN103145820B true CN103145820B (en) | 2014-06-25 |
Family
ID=48544184
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310063382.8A Expired - Fee Related CN103145820B (en) | 2013-02-28 | 2013-02-28 | Cyclic-permutation fluorescent protein and preparation method and application of cyclic permutation fluorescent protein |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103145820B (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109385450A (en) * | 2017-08-02 | 2019-02-26 | 中国科学院武汉病毒研究所 | A kind of three segment fluorescence complementary systems and application based on fluorescin Venus |
| CN107686844A (en) * | 2017-09-29 | 2018-02-13 | 青岛大学 | Utilize the method for cyanophycin RbrA visual inspection destination protein expression and purifications |
| WO2024062417A1 (en) * | 2022-09-22 | 2024-03-28 | Instituto De Biologia Experimental E Tecnológica – Ibet | Protease-conditional targeted nucleic acid recombination, mehtod and uses thereof |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1396265A (en) * | 2001-05-24 | 2003-02-12 | 香港科技大学 | Process based on green fluoresin for detecting cell wither |
| WO2008076938A1 (en) * | 2006-12-14 | 2008-06-26 | University Of Iowa Research Foundation | Method of making cyclic polypeptides with inteins |
| CN102558310A (en) * | 2012-02-24 | 2012-07-11 | 李兵辉 | Preparation method and application method for indicator for monitoring activity of protease in real time |
-
2013
- 2013-02-28 CN CN201310063382.8A patent/CN103145820B/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1396265A (en) * | 2001-05-24 | 2003-02-12 | 香港科技大学 | Process based on green fluoresin for detecting cell wither |
| WO2008076938A1 (en) * | 2006-12-14 | 2008-06-26 | University Of Iowa Research Foundation | Method of making cyclic polypeptides with inteins |
| CN102558310A (en) * | 2012-02-24 | 2012-07-11 | 李兵辉 | Preparation method and application method for indicator for monitoring activity of protease in real time |
Non-Patent Citations (2)
| Title |
|---|
| Modification of transmembrane and GPI-anchored proteins on living cells by efficient protein trans-splicing using the Npu DnaE intein;Tulika Dhar，et al.;《Chemical Communications》;20110321;第47卷(第11期);第2993-3300页 * |
| 环式增强型绿色荧光蛋白热稳定性及Npu DnaE内含肽高反式剪接效率研究;叶丙雨等;《军事医学》;20120430;第36卷(第4期);第253-262页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103145820A (en) | 2013-06-12 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Thomas et al. | A protease cascade regulates release of the human malaria parasite Plasmodium falciparum from host red blood cells | |
| DE69936103T2 (en) | FUSION PROTEINS CONSISTING OF PROTEIN AND LIBRARIES OF RANDOM PEPTIDES | |
| Niu et al. | Partner choice during meiosis is regulated by Hop1-promoted dimerization of Mek1 | |
| Hampton et al. | In vivo examination of membrane protein localization and degradation with green fluorescent protein. | |
| Isles et al. | Pioneer neutrophils release chromatin within in vivo swarms | |
| US20070276129A1 (en) | Modular molecular clasps and uses thereof | |
| JP2002528136A (en) | System for cell-based screening | |
| CN103145820B (en) | Cyclic-permutation fluorescent protein and preparation method and application of cyclic permutation fluorescent protein | |
| US20040014100A1 (en) | In vivo production of cyclic peptides for inhibiting protein-protein interaction | |
| Erdogan et al. | Targeted in situ protein diversification and intra-organelle validation in mammalian cells | |
| WO2002068698A2 (en) | Use of nucleic acid libraries to create toxicological profiles | |
| CN108291229A (en) | For detecting, capturing and/or the Epitope tag and method of the polypeptide of purification tag | |
| CN101258242B (en) | Membrane-translocating peptides | |
| Uhe et al. | The mycorrhiza-dependent defensin MtDefMd1 of Medicago truncatula acts during the late restructuring stages of arbuscule-containing cells | |
| CN103290091A (en) | Protein interaction detection method with low false positive rate | |
| US7297482B2 (en) | Structurally biased random peptide libraries based on different scaffolds | |
| CN102558310A (en) | Preparation method and application method for indicator for monitoring activity of protease in real time | |
| KR20070029630A (en) | Isolated photoprotein mtclytin, and use thereof | |
| US6936421B2 (en) | Structurally biased random peptide libraries based on different scaffolds | |
| EP1572732B1 (en) | Isolated fluorescent protein from clytia gregaria cgfp and use thereof | |
| CN106397578A (en) | Production method of hemoprotein | |
| Kneissel et al. | A novel karyoskeletal protein: characterization of protein NO145, the major component of nucleolar cortical skeleton in Xenopus oocytes | |
| Zhang et al. | Detection of mitochondrial caspase activity in real time in situ in live cells | |
| Delandre et al. | Membrane-bound GFP-labelled vectors for Targeted DamID allow simultaneous profiling of expression domains and DNA binding | |
| CN117088990B (en) | Fluorescent reporting system for detecting activity of coronavirus protease inhibitor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140625 Termination date: 20160228 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |