CN103142650B - Therapeutical uses from human plasma interior-preparation and the composition of alpha inhibitor protein - Google Patents

Abstract

In the present invention relates to-alpha inhibitor protein (I α Ip). The invention still further relates to the method for purifying I α Ip composition and be used for the treatment of human disease as the purposes of pyemia and septic shock, rheumatoid joint, cancer and infectious disease.

Description

Therapeutical uses from human plasma interior-preparation and the composition of alpha inhibitor protein

The application is to be on November 5th, 2004 applying date, the divisional application of application for a patent for invention that application number is 200480040150.X, that denomination of invention is identical with the present invention.

Related application

The denomination of invention that the application comprises on November 8th, 2003 application for " therapeutical uses from human plasma interior-preparation and the composition of alpha inhibitor protein " temporary patent application series No.60/_______ in disclosed related subject, the disclosure of this application is incorporated herein by reference with its entirety at this.

Government supports

A part of the present invention appropriates funds R01GM053008, R01GM057468 and R43GM065667 to support by National Institute of Health.

Background of invention

In-alpha inhibitor protein (I α Ip) family is the serpin of one group of blood plasma association. The member of this family is made up of heavy chain and light chain polypeptide subunit, covalently bound by sugared aminoglycan. Light chain, also referred to as bikunin, undertakes the serpin activity of molecule. Name " bikunin " reflects the protease repression domain that has 2 Kunitz types. In normal blood plasma, find that most of bikunin is complex form, as interior-alpha inhibitor (I α I), it has the molecular weight of 225kDa, and front-alpha inhibitor (P α I), and it has the molecular weight of 120kDa. In I α I, bikunin connects 2 polypeptide heavy chains, H1 and H2, and, in P α I, only have single heavy chain (H3) to connect bikunin. In these complex forms, bikunin keeps passivation until discharge by Partial Protein hydrolytic degradation, and this is as the mechanism that regulates active mode. From compound, after division, by renal glomerular filtration, the bikunin of activation is removed fast from blood plasma, this is the process promoting by low-molecular-weight and receptor-mediated absorption. US patent No.6,489,128 and 6,660,482 relate to cancer diagnosis and pyemic purposes separately. Also disclose and suppressed shift and treat pyemic method, but composition not pure and has the problem of stability, i.e. short-decayed problem in fact.

Although introduced antibiotic before more than 50 years, its death rate of really having seen pyemia induction is reduced to 35% from 55%, and medical science does not significantly reduce and is benefited from pyemia individual death rate. In fact, to continue be that one of intensive care unit's cause of death is died from septic shock and MOF subsequently with a large amount of pyemia individualities to pyemia. Pyemia is to infecting the systemic reaction that for example bacterium infects. It is normally caused by the endotoxin of gramnegative bacterium or the exotoxin of gram-positive bacterium (it can cause the reaction of endotoxin sample). Systemic reaction can cause septic shock, it is characterized in that blood pressure drops, cardiovascular collapse and/or MOF. The death rate being diagnosed as in septic shock individuality can be up to 35-45%. Be difficult to treat fast and reliably pyemia with conventional medicine.

Pyemia is relevant to the activation of congenital immunity and blood coagulation system with septic shock. Pyemia and septic shock clinically be characterized as systemic inflammatorome, coagulopathy, low blood pressure and many organ dysfunction (J.-L.Vincent etc., AnnualsofMedicine34(2002) 606-613). In several pyemia processes, the net of specific proteases activates clotting factor, the fibrinolysis factor and complement factor. These protease can also cause tissue and organ damage and improve non-specific proteolysis (J.Wite etc., the IntensiveCareMedicine of clotting factor and complementary factor in blood plasma8(1982)215-222；S.J.Weiss，NewEnglandJournalofMedicine320(1989)365-376)。

Invention summary

The present invention relates to Purification of Human blood plasma interior-method of alpha inhibitor protein (I α Ip) and uses thereof, be used for the treatment of human disease, as pyemia, acute inflammation disease, serious shock, septic shock, rheumatoid arthritis, cancer, metastasis of cancer, infectious disease and preterm delivery; Or for reducing pyemia, acute inflammation disease, serious shock, septic shock, rheumatoid arthritis, cancer, metastasis of cancer, mortality risk that infectious disease is relevant with preterm delivery.

According on the one hand, produce the method for the I α Ip composition that is derived from blood plasma, wherein I α I and P α I are present in mixture with physiology ratio, comprise the blood plasma fraction that contains I α I and P α I from plasma separation, and wherein I α I and P α I exist with physiology ratio; Assigning to obtain I α Ip purity with purifying blood plasma level is approximately 85% to approximately 100% pure I α Ip composition.

According on the other hand, in I α Ip composition comprises-mixture of alpha inhibitor protein (I α I) and front-alpha protein (P α I), wherein I α I and P α I are present in described mixture with physiology ratio, and approximately 85% to approximately 100% is pure.

In related fields, I α Ip composition comprises the mixture of interior-alpha inhibitor protein (I α I) and front-alpha protein (P α I), and wherein I α I and P α I are present in described mixture with physiology ratio and have high trypsase rejection ratio activity.

In another related fields, I α Ip composition comprises that the half-life was higher than I α I and the P α I of a hour.

In related fields, I α Ip composition comprises I α I and P α I again, wherein I α I and P α I by with three heavy chain H1, H2 and H3 at least one combination interior-light chain of alpha inhibitor protein forms.

In another related fields, the composition of I α Ip comprises the mixture of interior-alpha inhibitor protein (I α I) and front-alpha protein (P α I), wherein I α I and P α I are present in mixture with physiology ratio, comprise with four heavy chain H1, H2, H3 and H4 at least one combination interior-light chain of alpha inhibitor protein.

In related fields, make I α Ip according to following methods again, the method comprises isolates the blood plasma fraction that contains I α I and P α I from blood plasma, and wherein I α I and P α I exist with physiology ratio; Assigning to obtain I α Ip purity with purifying blood plasma level is approximately 85% to approximately 100% pure I α Ip composition.

On the other hand, pharmaceutical composition according to the present invention comprises treats acceptable carrier on the I α Ip composition described herein of effective dose and materia medica.

Relate on the other hand the method for the treatment of individual inflammation related disease, cancer or infectious disease, it comprises the I α Ip that any method of the following stated produces that passes through of drug treatment effective dose.

In another related fields, treat individual method and comprise the front level of treatments one or more in I α I, P α I, I α Ip, H3, H4, H1, H2 and LC of measuring; And the I α Ip for the treatment of effective dose is delivered medicine to individuality.

In related fields, the method for prediction to I α Ip therapeutic response described. The method comprises that the sample that test obtains from individuality detects one or more level I α I, P α I, I α Ip, H3, H4, H1, H2 and LC; The level qualification that wherein detected can sound response I α Ip treatment individuality.

In another related fields, describe the method for the individual progress for the treatment of of monitoring I α Ip treatment, and comprised the front level of treatments one or more in I α I, P α I, I α Ip, H3, H4, H1, H2 and LC of measuring; The I α Ip for the treatment of effective dose is delivered medicine to individuality; And in the just individual one or more levels of after date mensuration of I α Ip treatment, wherein after I α Ip treatment, the raising of individual level represents that individuality may have good clinical response to I α Ip treatment.

On the other hand, describe the medicine box for I α Ip treatment, comprised one or more in I α I, P α I, I α Ip, H3, H4, H1, H2 and LC; With the description that is used for the treatment of use.

In related fields, described the composition that comprises container, container comprises I α Ip and is inserted with label or the packaging about I α Ip being delivered medicine to individual explanation.

In related fields, medicine box is described again, the description that it comprises composition as above and is used for the treatment of use.

Following discloses other embodiments of the present invention.

Accompanying drawing summary

Fig. 1 has described the histopathology of spleen. In control-animal (A); protection white pulp, around broom shape artery, loses red myelocyte solvent on a large scale, in I α Ip treatment animal (B); have normally around white pulp and slight supracellular red pulp (H&E dyeing, amplify 20 ×).

Fig. 2 has described the amino acid sequence of H4.

The change that when Fig. 3 has described after caecum ligation and puncture (CLP) or sham-operation (Sham) 5 and 20 hours, in liver, bikuninmRNA expresses. Data are expressed as on average ± SE (n=8/ group) and compare by a tail analysis (ANOVA) and the Tukey test of variance:^＊P < 0.05 is to sham-operation. Fig. 3 a has shown amplification and by the mRNA of size separation on gel, and Fig. 3 b with chart drawing be normalized to the result of the bikunin level of G3PDH expression.

The t of 125I-I α I when Fig. 4 has described after caecum ligation and puncture (CLP) or sham-operation (Sham) 5 and 20 hours_1/2Change. Data are expressed as on average ± SE (n=5/ group) and compare by a tail analysis (ANOVA) and the Tukey test of variance:

Fig. 5 has described the change of the ligation of vehicle treatment caecum and puncture and caecum excision (CLP+ carrier) and the treatment caecum ligation of interior alpha inhibitor and puncture (CLP+I α Ip) survival rate after 10 days. Every group of 12 animals. Calculate survival rate and test and compare by logarithm level by Kaplan-Meier method.^＊P < 0.05 is to CLP+ carrier.

Fig. 6 has described the change of the ligation of vehicle treatment caecum and puncture and caecum excision (CLP+ carrier) and the treatment caecum ligation of interior alpha inhibitor and puncture (CLP+I α Ip) survival rate after 10 days. Every group of 11 to 12 animals. Calculate survival rate and test and compare by logarithm level by Kaplan-Meier method.^＊P < 0.05 is to CLP+ carrier.

Fig. 7 has described the change of the ligation of vehicle treatment caecum and puncture and caecum excision (CLP+ carrier) and the treatment caecum ligation of interior alpha inhibitor and puncture (CLP+I α Ip) survival rate after 10 days. Every group of 16 animals. Calculate survival rate and test and compare by logarithm level by Kaplan-Meier method.^＊P < 0.05 is to CLP+ carrier.

Fig. 8 a and 8b have described according to the present invention from the sketch map of human plasma purifying I α Ip.

Fig. 9 beneficial effect of highly purified I α Ip in pyemia zooscopy that presented in diagrammatic form.

Detailed Description Of The Invention

Disclosed herein is new method from blood plasma purifying I α Ip. Further disclosed at this is the therapeutic combination of purifying I α Ip, treats acute inflammation disease, pyemia, serious shock, septic shock, rheumatoid arthritis, cancer, metastasis of cancer, infectious disease and preterm delivery for delivering medicine to individuality.

The pollutant that known purifying contains factor X (FX) before, detects the band into 80kDa by western blot analysis. In blood coagulation test, FX also detected. It is important removing FX, if because think that FX is thrombosed and delivers medicine to people and be harmful to. The FX pollution problem of I α Ip composition before method described herein has solved.

In-alpha inhibitor protein (I α Ip) is serpin family relevant in structure, finds in human plasma, to be relatively high concentration (400-800mg/L). I α Ip is large, multicomponent compound, as insulin-type protease inhibitors. Different with other inhibitor molecules, the inhibitor of this family by the composition of polypeptide chain (light chain and heavy chain) uniquely covalently bound chondroitin sulfate chain form. In-heavy chain (H1, H2 and H3) of alpha protein also referred to as hyaluronic acid (HA) in conjunction with albumen. The principal mode of finding in human plasma is interior-α-inhibitor (I α I), it is made up of two heavy chains (H1&H2) and single light chain (L), with front-α-inhibitor (P α I), it is made up of a heavy chain (H3) and a light chain (L). Known light chain (extensively suppresses blood plasma serine protease also referred to as bikunin (two-kunitz inhibitor has two Kunitz domains). Compound has demonstrated the importance in protease inhibition array, and protease array comprises neutrophilia elastoser, plasmin, trypsase, cathepsin G and acrosin.

Have been found that I α I and P α I and H4 are compound, H4 is another heavy chain of I α Ip protein. According to the present invention, the I α Ip composition of particular comprises and P α I, I α I or P α I and the compound H4 of I α I.

Do not wish to be subject to the restriction of any scientific theory, we infer heavy chain combination HA from compound discharges of I α Ip, to prevent that HA is in conjunction with its acceptor CD44. When the heavy chain of I α Ip does not exist, HA is in connection with CD44 and cause the secretion of the proinflammatory factor. For example, TNF-α, and cause inflammation. Therebetween, the light chain of I α Ip, just presents antiprotease activity once discharge from compound.

" I α Ip composition " refers to the preparation of I α Ip protein, comprises I α I and the P α I of physiology ratio. As used in this physiology ratio refer to comprise do not infected or the human or animal of illness in the ratio found, and/or the ratio of the I α I of natural appearance in human plasma and P α I. Physiology ratio is generally approximately 60% to about 80%I α I and approximately 40% to about 20%P α I. Due to the normal variation that genes of individuals forms, physiology ratio can be different from these scopes.

As used in this, " mixture of interior-alpha inhibitor protein (I α I) and front-alpha protein (P α I) " refers to the composition that contains I α I and P α I complex. Mixture can also contain buffer, salt or other compositions for separating of I α Ip compound. In particular aspects, I α I and P α I are present in mixture with physiology ratio.

The I α I existing in blood plasma fraction and P α I have approximately 60 apparent molecular weights to about 280kDa. Carry out determining molecular weight by SDS-PAGE.

The time quantum of half when " half-life " I α Ip activity of referring to administration is administration as used in this. According to the present invention, the half-life of I α Ip composition is, for example, is greater than approximately 1,1.5,2,2.5,3,3.5,4,4.5,5,7.5 or 10 hour. In preferred embodiment, the half-life of I α Ip composition was higher than approximately 5 hours. In particularly preferred embodiment, the half-life of I α Ip composition was higher than approximately 10 hours. The preferably longer half-life, for example, because need to deliver medicine to individual dosage lower along with the time.

I α Ip composition of the present invention has high trypsin inhibition activity. Be approximately 1000 to about 2000IU/mg according to the trypsase rejection ratio activity of I α Ip composition of the present invention. Preferably trypsase rejection ratio activity is about 1200IU/mg, more preferably from about 1500IU/mg. Suppress test L-BAPA by trypsase and measure trypsase rejection ratio activity as substrate. Referring to, HUBergmeyer, editor: vol5, the 3rd edition, 119 (1984) VerlagChemie, Weinheim:Chromogenicsubstratefortheassayoftrypsin (testing tryptic chromophoric substrate): R.Geiger, H.Fritz, MethodsofEnzymaticAnalysis.

The composition of I α Ip is the mixture of interior-alpha inhibitor protein (I α I) and front-alpha protein (P α I), wherein I α I and P α I are present in described mixture with physiology ratio, in comprising-and the light chain of alpha inhibitor protein is in conjunction with at least one in three heavy chain H1, H2 and H3. In also having according to composition of the present invention-light chain of alpha inhibitor protein is in conjunction with at least one in four heavy chain H1, H2, H3 and H4. In I α Ip complex, the example of each albumen is as follows: BikuninGenbank accession number: AAB84031, P02760; H1GenBank accession number: P19827, NP_002206; H2GenBank accession number: NP_002207, P19823; H3GenBank accession number: NP_002208; H4GenBank accession number: Q14624, NP_002209, be eachly incorporated herein by reference with its entirety at this.

" be derived from blood plasma " as used in this and refer at first from plasma separation or purifying. , the natural environment of composition is blood plasma.

" blood plasma fraction " is that original source is from blood plasma from the fraction of for example chromatogram of isolated or purified step as used in this. Blood plasma fraction according to the present invention can be, for example, the accessory substance obtaining from purifying blood coagulation factors IX, the accessory substance obtaining from the compound concentrate of purifying blood coagulation proenzyme, the cold supernatant obtaining from CPP (is described in Hoffer etc., JournalofChromatographyB669(1995) 187-196), or cold barren blood plasma (poorplasma), cold barren blood plasma is used alternatingly at this and cold supernatant. Cold barren blood plasma is the supernatant obtaining from cryoprecipitate.

Accessory substance example according to the present invention obtains from purifying blood coagulation factors IX. Show that I α I/P α I mixture is present in the accessory substance of factors IX (FIX) purge process generation. The method that obtains accessory substance from purifying blood coagulation factors IX is described in Hoffer etc., JournalofChromatographyB669(1995) 187-196, it is incorporated herein by reference with its entirety at this. Other examples of accessory substance comprise from the accessory substance of purifying FIX or from the accessory substance of the compound concentrate of purifying blood coagulation proenzyme, as are described in D.Josic etc., ThrombosisResearch100(2000) 433-441, it is incorporated herein by reference with its entirety at this; And obtain as blood plasma cryoprecipitate the accessory substance that cold supernatant separates. (for example, suitable cryoprecipitate method is described in Hoffer etc., JournalofChromatographyB669(1995) 187-196). For comprising reinforcing yin essence ion-exchange fraction and monolithic chromatogram fraction from other blood plasma fractions of blood purifying I α Ip complex, will in following embodiment, describe.

According to the present invention, blood plasma fraction can be from people, primate, ox, pig, cat or dog source.

As used in this, term " acquisition " comprises purchase, synthesizes, separates or obtain in addition one or more materials used in the invention process.

Therefore, " acquisition blood " as used in this, for example comprises and obtains blood from people, primate, ox, pig, cat or dog source. For example, can originate to obtain and/or buy blood from blood bank, hospital, collecting post, private company, WARF or any other blood.

" acquisition blood plasma " as used in this, for example comprise from people, primate, ox, pig,, cat or dog source obtain blood plasma. For example, can originate to obtain and/or buy blood plasma from blood bank, hospital, collecting post, private company, WARF or any other blood. Or, once obtain blood, also can be from blood separated plasma. The appropriate method of separated plasma comprises gravity and centrifugal.

As used in this, " obtaining the accessory substance fraction obtaining from purifying blood coagulation factors IX ", comprises that for example company or the hospital from daily purification of factor IX obtains and/or buy the accessory substance fraction obtaining from purifying blood coagulation factors IX.

As used in this, " obtaining the accessory substance fraction obtaining from the compound concentrate of purifying blood coagulation proenzyme ", comprises that for example company, research organization or the hospital from purifying blood coagulation proenzyme compound obtains and/or buy accessory substance fraction.

As used in this, " obtain obtain from blood plasma cryoprecipitate cold supernatant " for example comprises and obtains and/or buy cold supernatant from the hospital to be applicable to mode CPP of the present invention, research organization or company.

" solid carrier " refers to the solid material that can derive or connect in addition with capture agent capture agent. Example solid carrier comprises probe, microtiter plate and chromatography resin.

" absorption " refers to the non-covalent combination that detects of analyte and adsorbent or capture agent. Adsorbent surface refers to the surface in conjunction with adsorbent (also referred to as " capture agent " or " affinity reagent "). Adsorbent be can bound analyte (for example, target polypeptides or nucleic acid) any material.

Chromatographic adsorbent refers to common material used in chromatogram. Chromatographic adsorbent comprises, for example, and ion exchange material, metal-chelator (for example, nitrilo-acetic acid or iminodiacetic acid), fixing metal chelate, hydrophobicity exchange adsorbing substance, hydrophily exchange adsorbing substance, dyestuff, simple biomolecules is (for example, nucleotides, amino acid, monose and aliphatic acid) and the adsorbent (for example, hydrophobic adsorption/electrostatic repulsion adsorbent) of mixed mode.

Biologic specificity adsorbent refers to the adsorbent that comprises biomolecule, and for example, nucleic acid molecules (for example for biomolecule, aptamer), polypeptide, polysaccharide, lipid, steroids or these conjugate are (for example, glycoprotein, lipoprotein, glycolipid, nucleic acid (for example, DNA)-protein conjugate). In specific embodiment, biologic specificity adsorbent be macromolecular structure as polyprotein compound, biomembrane or virus. The example of biologic specificity adsorbent is antibody, receptor protein and nucleic acid. Biologic specificity adsorbent is conventionally high than chromatographic adsorbent to the specificity of target analytes.

" eluant, eluent " or " wash solution " refers to for affecting or changing the absorption of analyte and adsorbent surface and/or remove the not reagent of bond material, normally solution from surface. The wash-out characteristic of for example eluant, eluent depends on pH, ionic strength, hydrophobicity, chaotic tropism's degree, detergent intensity and temperature.

" analyte " refers to any composition of expecting to obtain detection in sample. Term can refer to single composition or the Multiple components of planting in sample.

Term " polypeptide ", " peptide " and " protein " can be used alternatingly at this, are used for representing the polymer of amino acid residue. Term is applicable to the amino acid polymer that wherein one or more amino acid residues are the corresponding analog of natural generation amino acid or analogies, and is applicable to the amino acid polymer of natural generation. Polypeptide can be modified, and for example, forms glycoprotein by adding carbohydrate. Term " polypeptide ", " peptide " and " protein " comprise glycoprotein and non-glycoprotein.

" immunoassay " is the test that uses the antibody of specific binding antigen (for example, I α Ip compound). Immunoassay is characterised in that the specific binding characteristic that uses specific antibodies and separator, target, and/or quantitative antigen.

" antibody " refers in fact the polypeptide ligand by an immunoglobulin gene or multiple immunoglobulin gene or its fragment coding, its combination specifically and identification epitope (for example, antigen). Known immunoglobulin gene comprises κ and the constant fragment gene of γ light chain, α, γ, δ, ε and the constant fragment gene of μ heavy chain, and countless immunoglobulin variable fragment genes. Multiple fragments of the abundant sign that for example antibody produces as complete immunoglobulin (Ig) or as various peptide enzymic digestions exist. This comprises, for example, and Fab ' and F (ab) '₂Fragment. Antibody comprises polyclonal antibody and monoclonal antibody, chimera, and strand and humanized antibodies, and Fab fragment, comprise the product in Fab or other immunoglobulin expression libraries.

Phrase " specificity (or selective) combination " antibody or " specificity (or selective) immune response ", in the time relating to protein or peptide, refer to and in the multiple colony of protein and other biological goods, determine the association reaction that protein exists. Therefore,, under the immunoassay condition of specifying, specific antibody at least doubles background in conjunction with specific protein and there is no that other protein that exist are combined with significant quantity in sample. Under condition, need to select the specificity of antibody to specific protein with the specific binding of antibody like this. For example, can select to cause specific species as the polyclonal antibody of rat, mouse or people's I α Ip compound only obtain with I α Ip complex specific immune response and not with those polyclonal antibodies of other proteins reacts, except the allele of multiform variant and I α Ip complex. Obtain this selection by eliminating and the antibody of the I α Ip complex molecule cross reaction of other species. Can select and the antibody of specified protein specific immune response by various immunoassay forms. For example, conventionally with solid phase ELISA immunoassay select with the immunoreactive antibody of protein specific (referring to, for example, Harlow&Lane, Antibodies, ALaboratoryManual (1988), has described immunoassay form and condition for measuring specific immune response). Conventionally specificity or selective reaction at least double background signal or noise, more generally higher than 10 to 100 times of backgrounds.

" function equivalent " refers to present and substantially goes up in similar body to said I α Ip protein or any albumen of external activity as used in this, for example, affects pyemic reduction.

For example, confirm structure and the purity of I α Ip product by HPLC or other chromatographic processes well known by persons skilled in the art.

" I α Ip complex " is used for the biologically active variant of all natural generations that comprise I α Ip protein as used in this, comprises the protein that contains deletion, insertion, adds and replace. " the natural variant " of I α Ip protein is defined as the peptide with one or more amino acid change sequences obtaining from blood plasma. Variant can have " conservative " and change, and the amino acid wherein replacing has similar structure or chemical characteristic, and for example, isoleucine substitutes leucine. In another embodiment, variant can have " non-conservation " and change, and for example tryptophan substitutes glycine. Similar variant can also comprise that amino acid is deleted or insertion, or both. Use computer program well known in the art, for example, which and how many amino acid residues DNASTAR software, can find to measure and be substituted, insert or detect and do not eliminate biological or immunocompetent guidance.

" deletion " is defined as wherein one or more amino acid or nucleotide residue non-existent amino acid or nucleotide sequence change separately.

" insertion " or " interpolation " is and the I α Ip composite bulk phase comparison of natural generation, makes separately amino acid or nucleotide sequence that one or more amino acid or nucleotide residue add change.

Separately by different amino acid or the one or more amino acid of nucleotide substitution or nucleotides formation " replacement ".

Term " biologically active " refers to structure, adjusting or the biochemical function with natural generation I α Ip complex. Equally, " immunocompetence " orientates the ability that natural, restructuring or synthetic I α Ip complex or its any oligopeptides are induced specific immune response in suitable animal or cell and be combined with specific antibodies as.

Term " derivative " refers to the chemical modification of the nucleic acid of coding I α Ip complex or the I α Ip complex of coding as used in this. Such modification illustrates by alkyl, acyl group or amino instead of hydrogen. Nucleic acid derivative retains coding the polypeptide of the substantive biological nature of natural I α Ip complex.

" purifying " refers to from I α Ip and removes albumen unwanted or that pollute or one-tenth assigns to produce the step of purifying I α Ip complex as used in this. The blood plasma level of the I α I that for example, can contain physiology ratio by continuous chromatography step process and the P α I purifying I α Ip composition of assigning to.

As used in this " separation " refer to from blood plasma and produce blood plasma fraction, the I α I that it contains physiology ratio and P α I. For example, by being carried out to chromatogram, blood plasma obtains separated plasma fraction according to the present invention. Separate refer to from its primal environment (for example, if natural generation for natural environment) in the material that takes out, and therefore " pass through people " from its native state and change. For example, the polypeptide of separation or protein can be the compositions of blood plasma, maybe can be contained in cell and think " separation ", because blood plasma or specific cells can not be the primal environments of polypeptide.

Chromatogram can comprise anion-exchange chromatography as used in this. Anion-exchange chromatography can be based on particle, for example, and DEAESepharose, DEAESephadexA50, ToyopearlDEAE, TMAEFractogel, DEAEFractogel or Q-Sepharose. Anion-exchange chromatography can also pass through integral carriers, for example, with the CIM of immobilization anion exchange part as DEAE-CIM or Q-CIM. SEPHAROSE is the Pharmacia of New Jersey, the trade name of Inc. to high molecular weight material, the separation that this material filters for large molecular gel. Anion-exchange column has two parts, matrix and parts. Matrix can be for example cellulose, glucan, agarose or polystyrene. Part can be diethylamino ethyl (DEAE), polymine (PEI) or quaternary ammonium functional group. The intensity of anion-exchange column refers to the ionization state of part. Reinforcing yin essence ion exchange column, as there are those of quaternary ammonium part, within the scope of wide pH with permanent positive charge. In weak anionic exchange column, as DEAE and PEI, the pH of pillar is depended in the existence of positive charge. Preferably reinforcing yin essence ion exchange column for example, as QSepharoseFF or metal-chelating Sepharose (, Cu2+-chelating Sepharose). Anion-exchange column loads the low salt buffer agent of pH higher than alpha-Glucosidase pI conventionally.

I α Ip composition of the present invention is preferably approximately 85% to approximately 100% pure. As used in this, term " pure " refers to the I α Ip composition taking out from its natural environment, separation or separate, and at least about 85% to approximately 100% nothing, preferably 90% nothing, more preferably 95% without and its natural other relevant compositions. In preferred embodiment, the protein of purifying will form in composition higher than 85%, 87.5%, 90%, 92.5%, 95%, 99% or even higher protein substantially.

That peptide, polypeptide or protein have wherein peptide, polypeptide or protein and substantially goes up the purity level without other protein and biotic component as used to the peptide of " being purified to homogeneous " of the present invention, polypeptide or the protein meaning. One or more separating steps that any suitable materials and methods can be used for carrying out blood plasma obtain the I α Ip of purifying.

Conventionally, the preparation of I α Ip relates to the separation of sample and collection is used for measuring the fraction that contains target protein. Separate method comprise, for example, solid phase extractions, chromatogram, for example, anion-exchange chromatography, size exclusion chromatogram, ion-exchange chromatography, heparin chromatogram, affinity chromatography, continuously extract, gel electrophoresis and liquid chromatogram. Preparation can also comprise purifying, and it comprises chromatographic step, for example, ion-exchange chromatography, heparin chromatogram, affinity chromatography, extracts gel electrophoresis and liquid chromatogram continuously.

In an embodiment of the present invention, by anion-exchange chromatography by twice of Sample Purification on Single. Anion-exchange chromatography according to their charge characteristic by the purifying roughly of protein in sample. For example, can use Q anion exchange resin (for example, QHyperDF, Biosepra), and with the continuous elution sample of elutriant of different pH. Anion-exchange chromatography is separated the biomolecule of more negative electrical charges in sample from the biomolecule of other types. With the albumen of the eluent elution of high pH may be weak negative electrical charge, with the fraction of the eluent elution of low pH may be strong negative electrical charge. Therefore,, except reducing the complexity of sample, anion-exchange chromatography carrys out isolated protein according to their binding characteristic.

In an embodiment, by heparin chromatogram, sample is further purified again. Heparin chromatogram is further purified the I α Ip complex in sample, be also based on the interactional compatibility of heparin and charge characteristic. Heparin, sulphation mucopolysaccharide, in connection with the I α Ip complex with positive charge part, and with the continuous elution sample of eluent of different pH or salinity. With the I α Ip complex of the eluent elution of low pH may be more weak positive charge. With the I α Ip complex of the eluent elution of high pH may be stronger positive charge. Therefore, heparin chromatogram has also reduced the complexity of sample and has separated I α Ip complex according to their binding characteristic.

Can catch I α Ip complex with the capture agent that is fixed on carrier, carrier is as any biochip, porous microtiter plate, resin or have subsequently the NC Nitroncellulose film of probe as albumen. Especially, can on laser desorption/ionization (SEIDI) protein bio-chip of surface-raising, catch I α Ip complex of the present invention. Can on chromatographic surface or biologic specificity surface, catch. Any SELDI protein-biochips that comprises reactive surfaces can be for catching and detect I α Ip complex of the present invention. These biological new films can derive with the antibody that specificity is caught I α Ip complex, maybe can derive with capture agent, and capture agent is as the albumin A of binding domain-immunoglobulin or Protein G. Then using specific antibody that I α Ip complex is trapped in to solution neutralizes by the I α Ip complex of capture agent separating trap on chip.

The whole bag of tricks of the quantitative albumen of disclosure according to the present invention, polypeptide or peptide purification degree is well known to a person skilled in the art. These comprise, for example, measure the specified protein activity of fraction, or measure the quantity of polypeptide in fraction by gel electrophoresis.

Except those technology of following detailed description, the various other technologies that are applicable to protein purification are well known to a person skilled in the art. These comprise, for example, by precipitations such as ammonium sulfate, PEG, antibody or by thermal denaturation, then centrifugal; Chromatographic step is as ion-exchange step, gel filtration step, anti-phase step, hydroxyapatite step, step that lecithin is affine, immune affinity chromatographic and other affinity chromatography steps; Isoelectric focusing; Gel electrophoresis, HPLC; Combination with these and other technology. In addition,, if think needs, can carry out other purification step by the method for this area standard. These methods can fully give the pure preparation of height of protein.

In other embodiments, can use gel chromatography or molecular sieve chromatography. Gel chromatography is the particular type partition chromatography based on molecular size. Principle after gel chromatography is pillar, with making containing foraminate fine grained inert substance, when through or young pathbreaker is more macromolecular from less molecule, separates according to large during around hole. As long as the material of granulation does not adsorb molecule, the unique factor that determines flow velocity is size. Therefore, molecule with size elution from pillar of successively decreasing, as long as shape is relatively constant. Gel chromatography is incompetent for the molecule that separates different sizes, because separate with every other factor as irrelevant in pH, ionic strength, temperature etc. In fact also do not have absorption, the area distribution of minimizing is the simple factors relevant to molecular weight with elution volume.

In another embodiment, can use affinity chromatography. Affinity chromatography is the chromatographic process that relies on specificity compatibility between material to be separated and specific binding molecules. , for example, receptor-ligand type interacts. Can be by synthesizing pillar material in connection with the insoluble matrix of one of gametophyte covalent bond. Then pillar material can be from solution specific adsorption material. For example, carry out elution (for example, changing pH, ionic strength and temperature) by condition being changed over to those that combination can not occur.

Method described herein is suitable for large-scale production, and forms protein, comprises the I α Ip complex and the H4 that are suitable for treating form of medication.

If needed, any isolated or purified step that can repeat said method obtains higher purity. Chromatographic step can be in batch or pillar form.

The method for optimizing of producing the I α Ip composition that is derived from blood plasma of the present invention comprises isolates the blood plasma fraction that contains I α I and P α I from blood plasma, and wherein I α I and P α I exist with physiology ratio; And purifying blood plasma level assigns to obtain the pure I α Ip composition of purity approximately 85% to approximately 100%.

The method according to this invention can also comprise being further purified of blood plasma fraction, for example, passes through the effluent of (not combination) fraction by heparin affinity column collection.

Implementing in the present invention useful method can also be included in before or after purification and separation step blood plasma fraction and/or purifying I α Ip inactivation of virus. Usual method comprises by solvent/detergent treatment or hot deactivation inactivation of virus. Hot deactivation or the pasteurize of the present composition can be the xeothermic of for example approximately 55 to approximately 65 DEG C or 70 to 120 DEG C.

For solvent detergent-treatment, the particular combinations of solvent and detergent, as, 0.3% 3-n-butyl phosphoric acid salt (TnBP) is in conjunction with 1% Tween-80,24 DEG C 6 hours, effectively deactivation enveloped virus (Horowitz etc. (1985) Transfusion25, pp.516-522). Or, under stabilizing agent exists, the I α Ip of fraction or purifying is enough to any virus that deactivation exists 55-65 DEG C of pasteurize.

In the process of purifying or separating step, add stabilizing agent. The final composition of I α Ip can also contain stabilizing agent. For example, suitable stabilizing agent comprises albumin, polyethylene glycol, and α, α-trehalose, amino acid, salt, glycerine, omega amino acid is as lysine, polylysine, arginine, EACA and tranexamic acid, sugar, as sucrose, or its combination.

I α Ip protein of the present invention and composition can be used for the treatment of human disease. Such disease comprises, for example, acute inflammation disease, septicopyemia just, serious shock, septic shock, rheumatoid arthritis, cancer, metastasis of cancer, preterm delivery and infectious disease. Assign to make by isolate the blood plasma level that contains I α I and P α I from blood plasma the I α Ip composition that is used for the treatment of disease, wherein I α I and P α I exist with physiology ratio; Assigning to obtain I α Ip purity with purifying blood plasma level is approximately 85% to approximately 100% pure I α Ip composition.

The present invention also comprises the pharmaceutical composition of I α Ip. The pharmaceutical composition of I α Ip can be acceptable carrier on treatment described herein any I α Ip composition of effective dose and materia medica.

For example, it can be the I α Ip composition for the treatment of effective dose according to pharmaceutical composition of the present invention, it is interior-mixture of alpha inhibitor protein (I α I) and front-alpha protein (P α I), wherein I α I and P α I are present in described mixture with physiology ratio, for approximately 85% to approximately 100% pure. Pharmaceutical composition can also be the I α Ip composition for the treatment of effective dose, it is interior-mixture of alpha inhibitor protein (I α I) and front-alpha protein (P α I), wherein I α I and P α I are present in described mixture with physiology ratio, comprise with three heavy chain H1, H2 and H3 or H1, H2, H3 and H4 at least one combination interior-light chain of alpha inhibitor protein. Pharmaceutical composition can also be the I α Ip composition for the treatment of effective dose, it is interior-mixture of alpha inhibitor protein (I α I) and front-alpha protein (P α I), wherein I α I and P α I are present in described mixture with physiology ratio, and have high trypsin inhibitor specific activity. Pharmaceutical composition can also be the I α Ip composition for the treatment of effective dose, it is interior-mixture of alpha inhibitor protein (I α I) and front-alpha protein (P α I), wherein I α I and P α I are present in described mixture with physiology ratio, and have the half-life higher than one hour, five hours or ten hours.

Term " acceptable carrier or adjuvant on materia medica " refers to and delivers medicine to individuality and do not destroy its pharmaceutically active when enough transmitting the administration of therapeutic dose composition and be atoxic carrier or adjuvant together with composition of the present invention.

Acceptable carrier on materia medica used in pharmaceutical composition of the present invention, adjuvant and excipient comprise, but be not limited to, ion-exchanger, aluminium, aluminum stearate, lecithin, self-emulsifying drug transfer system (SEDDS) is as d-alpha-tocopherol cetomacrogol 1000 succinate, surfactant used in pharmaceutical dosage form is as tween or other similar polymerizations transmission matrix, haemocyanin, as human serum albumins, buffer substance is as phosphate, glycerine, sorbic acid, potassium sorbate, the partial glycerol ester admixture of saturated vegetable fatty acid, water, salt or electrolyte, as protamine sulfate, sodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salt, cabosil, magnesium trisilicate, polyvinylpyrrolidone, based on cellulosic material, polyethylene glycol, sodium carboxymethylcellulose, polyacrylate, wax, polyethylene-polyoxypropylene block polymer, polyethylene glycol and lanolin. cyclodextrin as α-, β-, gamma-cyclodextrin, or the derivative of chemical modification is as hydroxyalkyl cyclodextrin, comprises 2-and 3-HP-β-CD, or the derivative of other dissolvings also can be advantageously used in the transmission that improves said composition.

Pharmaceutical composition of the present invention can oral, non-enteron aisle, suck spraying, part, rectum, nose, cheek, vagina or carry out administration by implantation storage, preferably by oral administration or pass through drug administration by injection.

Pharmaceutical composition of the present invention can contain acceptable carrier, adjuvant or excipient on the atoxic materia medica of any routine. In certain situation, improve the stability of compositions formulated or its delivery form with the pH of acceptable acid on materia medica, alkali or buffer adjusting preparation. Within the non-enteron aisle of this term used comprises subcutaneous, intracutaneous, intravenous, intramuscular, joint, in artery, in synovia, in web, in film, in chamber and intracranial injection or inculcate technology. Suitable medication can be tablet, capsule, or by intravenous injection. Especially the preferably administration of injection form.

Pharmaceutical composition can be the form of aseptic injection preparation, for example, and as aseptic injection water or oleagenous suspension. Can prepare this suspension according to technology known in the art, use suitable dispersion or wetting agent (for example, as,, Tween 80) and suspending agent. Aseptic injection preparation can also be aseptic injectable solution or the suspension in the acceptable diluent of nontoxic non-enteron aisle or solvent, for example, and as 1,3-BDO solution. What can accept to use in carrier and solvent is sweet mellow wine, water, Ringer's solution and isotonic sodium chlorrde solution. In addition, aseptic, nonvolatile oil is typically used as solvent or suspension media. For this object, can use the nonvolatile oil of any gentleness, comprise synthetic list-or two glyceride. Aliphatic acid, as oleic acid and glyceride ester derivatives thereof can be used in ejection preparation, and acceptable oil on natural materia medica, as olive oil or castor oil, especially their polyoxy ethylization form. These oil solutions or suspension can also contain long-chain alcohol diluent or dispersant, or carboxymethyl cellulose or be generally used for materia medica can accept formulation as emulsion with or suspension preparation in similar dispersant. For the object of preparing, on materia medica, can accept other conventional surfactants conventional in the manufacture of solid, liquid or other formulations and also can use as tween or sapn and/or other similar emulsifying agents or bioavilability improving agent.

Pharmaceutical composition of the present invention can carry out oral administration with any oral acceptable formulation, includes, but not limited to capsule, tablet, emulsion and aqueous suspension, dispersion and solution. In the situation of the tablet orally using, carrier used comprises lactose and cornstarch conventionally. Conventionally also add lubricant, as dolomol. For the oral administration of capsule form, useful diluent comprises lactose and dry cornstarch. In the time of oral administration aqueous suspension and/or emulsion, will suspend or be dissolved in active component in oil phase in conjunction with emulsifying agent and/or suspending agent. If need, can add specific sweetener and/or flavor enhancement and/or pigment.

Pharmaceutical composition of the present invention can also be with the form administration of suppository for rectally. By composition of the present invention is mixed to prepare these compositions with suitable non-irritating excipient, this excipient room temperature be solid but rectal temperature be liquid and therefore in rectum melt come release of active ingredients. Such material includes, but not limited to cocoa butter, beeswax and polyethylene glycol.

In the time that required treatment relates to topical application and holds accessible position or organ, the topical of pharmaceutical composition of the present invention is useful. For the topical application of skin, pharmaceutical composition should be prepared with containing to suspend or be dissolved in together with the suitable ointment of the active component in carrier. Carrier for present composition topical includes, but not limited to mineral oil, liquid petroleum, white oil, polypropylene glycol, polyoxyethylene, polyoxypropylene composition, emulsifying wax and water. Or pharmaceutical preparation can be prepared with suitable washing lotion or emulsion together with suitable emulsifying agent, washing lotion or emulsion contain and suspend or be dissolved in the active compound in carrier. Suitable carrier includes, but not limited to mineral oil, sorbitan stearate monoesters, polysorbate 60, cetyl esters wax, whale aryl alcohol, 2-octyldodecanol, phenmethylol and water. Pharmaceutical composition of the present invention also uses to lower intestinal tract by rectal suppository or suitable enema agent part. The present invention also comprises the local sticking patch through skin.

Pharmaceutical composition of the present invention can or suck administration by nose aerosol. Prepare such composition and can make salting liquid according to the known technology of field of pharmaceutical preparations, use phenmethylol or other suitable anticorrisive agents, improve sorbefacient, fluorocarbon and/or other stabilizing agents known in the art or the dispersant of bioavailability.

Treat the method for individual disease according to the present invention, comprise that administration is according to the I α Ip composition of the treatment effective dose of the inventive method generation, these diseases comprise that inflammation related disease for example, rheumatoid arthritis, pyemia or septic shock, head trauma/damage and meningitis, IBD (regional ileitis), chronic obstructive pulmonary disease, rhinitis; Cancer, preterm delivery or infectious disease.

Be approximately 1 to 50mg/kg body weight at the dosage of this composition, preferred dose is 500mg to 1000mg/ agent, every 4 to 120 hours, or according to the needs of certain drug. Comprise that in this method the composition of effective dosage obtains required or described effect. Conventionally pharmaceutical composition every day of the present invention or every other day with continuous infusion administration approximately 1 to approximately 6 time. Such administration can be used as chronic or acute treatment. The active component content that produces single dose form in conjunction with carrier mass changes according to host to be treated and specific administering mode. Exemplary formulations is by containing having an appointment 5% to approximately 95% active compound (w/w). Or such preparation is containing having an appointment 20% to approximately 80% active compound.

Also be favourable higher or lower than above-mentioned those dosage. Given dose and therapeutic scheme for particular individual will depend on many factors, comprise the activity of particular composition used, the age, body weight, general health situation, sex, meals, administration time, excretion rate, drug regimen, the order of severity of disease and process, illness or symptom, the individual disposal to disease, illness or symptom, and treatment doctor's judgement.

If needed, when illness is improved, the present composition or mixture that can administration maintenance dose. Subsequently, as the function of symptom, can, by the dosage of administration or frequency or both, be reduced to the level of improving illness that maintains, alleviate to desired level when symptom, treatment should stop. But, based on any recurrence of disease symptoms, the intermittent therapy that individual need is long-term. Can also the I α Ip level based in liver judge the improvement of illness. If the I α Ip in discovery liver is normal physiological level and judges that by patient and treatment doctor patient's symptom is improved, individual with maintenance dose treatment.

In the time that composition of the present invention comprises the mixture of I α Ip composition and one or more other treatment agent or prophylactic, the dosage level that composition and other medicaments exist be in common single therapeutic scheme administration approximately 1 to 100%, more preferably from about 5 to 95% dosage. Other medicament can separate administration with composition of the present invention, as a part for multiple dose scheme. Or those medicaments can be parts for single dose form, be mixed in single composition with composition of the present invention.

Treat individual acute inflammation disease, pyemia, serious shock, septic shock, rheumatoid arthritis, cancer, metastasis of cancer, infectious disease, and/or the method for preterm delivery, comprise the following steps: measure I α I, P α I, I α Ip, H3, H4, H1, level before one or more treatment in H2 and LC; And the I α Ip for the treatment of effective dose is delivered medicine to individuality. I α I, P α I, I α Ip, H3, H4, H1, before the treatment of H2 and LC, level is the individual proteins level before administration I α Ip or any I α Ip compound protein for the first time. Level after treatment is the I α Ip level of measuring after administration I α Ip. Method of the present invention comprises measures just after date I α I of I α Ip treatment, P α I, I α Ip, H3, H4, H1, level after one or more treatment in H2 and LC. The adjusting of I α Ip level represents that treatment is producing good clinical response. The initial stage for the treatment of is the time that the I α Ip PC of acquisition stable state needs.

For example measure I α I by immunization method, P α I, I α Ip, H3, H4, H1, the level of H2 and LC. For example, can detect and/or measure I α Ip complex by various detection methods, comprise, for example, gas phase ion spectrometry method, optical means, electrochemical method, atomic force microscopy, radio frequency method, surface plasma body resonant vibration, oval symmetrical immunity and Atomic Force Microscopy.

In another embodiment, can carry out the I α Ip complex in determination and analysis sample with immunoassay. The method comprises: the specific binding I α Ip antibody of complex (a) is provided; (b) sample is contacted with antibody; (c) detect the existence in conjunction with the antibody complex of I α Ip complex in sample. Suitable antibodies for the inventive method comprises, MAb69.31, MAb69.26, anti-I α Ip polyclonal antibody (R16 or R20), and anti-bikunin monoclonal or polyclonal antibody.

Immunoassay is the test that uses the antibody of specific binding antigen (for example, I α Ip complex). Immunoassay is characterised in that the specific binding characteristic that uses specific antibodies and separator, target, and/or quantitative antigen. Phrase " specificity (or selective) combination " antibody or " specificity (or selective) immune response ", in the time relating to protein or peptide, refer to and in the multiple colony of protein and other biological goods, determine the association reaction that protein exists. Therefore,, under the immunoassay condition of specifying, specific antibody at least doubles background in conjunction with specific protein and there is no that other protein that exist are combined with significant quantity in sample. Under condition, need to select the specificity of antibody to specific protein with the specific binding of antibody like this. For example, can select to cause specific species as the polyclonal antibody of rat, mouse or people's I α Ip compound only obtain with I α Ip complex specific immune response and not with those polyclonal antibodies of other proteins reacts, except the allele of multiform variant and I α Ip complex. Obtain this selection by eliminating and the antibody of the I α Ip complex molecule cross reaction of other species.

Be suitable for can being accredited as with the individuality of I α Ip treatment suffer from inflammation, wound/damage, tumour invasion, metastases, pyemia, septic shock or infectious disease. Individuality can be oneself identify or by doctor diagnosed for suffering from inflammation, tumour invasion, metastases, pyemia, septic shock or infectious disease. Individuality can be primate, people or other animals.

Method also comprises the co-administered with other treatment agent. for example, other therapeutic agent can be anticancer, antiinflammatory, anticoagulant or immunomodulator. for example, di-deoxynucleoside, for example, Zidovudine (AZT), 2 ', 3 '-dideoxyinosine (ddI) and 2 ', 3 '-dideoxycytidine (ddC), Lamivudine (3TC), stavudine (d4T) and TRIZIVIR (Abacavir+Zidovudine+Lamivudine), non-nucleosides, for example, efavirenz (DMP-266, DuPontPharmaceuticals/BristolMyersSquibb), nevirapine (BoehringerIngleheim) and delaviridine (Pharmacia-Upiohn), TAT antagonist breast Ro3-3335 and Ro24-7429, protease inhibitors, for example, indinavir (Merck), Ritonavir (Abbott), inverase (HoffmannLaRochw), viracept see nelfinaivr (AgouronPharmaceuticals), 141W94 (Galxo-Wellcome), atazanavir (BristolMyersSquibb), VX-478 (GlaxoSmithKline), fosamprenavir (GlaxoSmithKline), for Pune's Wei (BoehringerIngleheim), KALETRA (Lopinavir+Ritonavir, Abbott), with other medicament breasts 9-(2-hydroxy ethoxy methyl) guanine (acyclovir), interferon, for example, alpha-interferon, the inhibitor of interleukin II and phosphonoformic acid salt (Foscarnet) or registration, for example T20 (enfuvirtide, or UK-427 Roche/Trimeris), 857 (Pfizer), levamisol or thymosin extrasin, cis-platinum, NSC-241240, Docetaxel, taxol, fluorouracil, capecitabine, gemcitabine, Irinotecan, TPT, etoposide, mitomycin, gefitinib, vincristine, vincaleukoblastinum, adriamycin, endoxan, Sai-Mi-Xi-Bu, rofecoxib, Valdecoxib, brufen, naproxen, Ketoprofen, dexamethasone, prednisone, prednisolone, hydrocortisone, acetaminophen, Misonidazole, Amifostine, Tamsulosin, phenazopyridine, Ondansetron, Ge Feisiqiong, A Luosi, palonosetron, fenazil, Trimethobenzamide, aprepitant, diphenoxylate and atropine, and/or Loperamide. anticoagulant is as Antithrombin III, and APC and protease inhibitors are as furin inhibitor.

Method also comprises the reaction of prediction to I α Ip treatment, measures the sample obtaining from individuality and detects I α I, P α I, I α Ip, H3, H4, H1, one or more level in H2 and LC; The level wherein detecting represents that individuality can react I α Ip treatment well. For example, the reduction that I α I and/or P α I can detection levels represents that the individual administration from I α Ip benefits.

Method also comprises the individual process of monitoring I α Ip treatment, measures I α I, P α I, I α Ip, H3, H4, H1, level before one or more treatment in H2 and LC; The I α Ip for the treatment of effective dose is delivered medicine to individuality; And measure one or more level in the first after date individuality of I α Ip treatment, wherein after I α Ip treatment, the raising of individual level represents that individuality may have good clinical response to I α Ip treatment.

Medicine box for I α Ip treatment comprises I α I, P α I, I α Ip, H3, H4, H1, one or more in H2 and LC; With the description that is used for the treatment of use. Medicine box also comprises I α Ip composition described herein and operation instructions. For example, medicine box can contain I α I, P α I and the description that related dosage information, form of medication and preservation condition are provided.

Also relate to container, container comprises I α Ip and is inserted with the label or the packaging that I α Ip are delivered medicine to individual description. Description provides the explanation of dosage, form of medication and preservation condition.

Embodiment

Not will be understood that by recognizing the present invention is limited to described at present embodiment; On the contrary, will be understood that all equivalent variations that present invention resides in this any and all application and those skilled in the art's technical scope providing.

Embodiment 1

As the feature of the H4 of an I α Ip complex part

SELDI-TOF mass spectral analysis shows that heavy chain 4 (H4) is also present in 125kDa band (P α I) and 250kDa band (I α I) (data do not show). H4 in 250kDa band exists more obvious. This represents that I α I (H1+H2+LC) and P α I (H3+LC) another kind of complex protein in addition may be present in some compositions of the present invention. The H4 of complex form was not also described up to now. Free H4 is less than 125 or 250kDa. Due to mass spectrum result, we think that H4 may with bikunin (light chain) or other be compound.

Embodiment 2

Pyemic animal model

Male Sprague-Dawley rat (275-325g) is housed in the room of controlling temperature to bright/dark circulation of 12-h the solid type feed of feeding standard P urina rat. Before induction pyemia, by rat overnight fasting, but can arbitrarily drink water. With isoflurane inhalation anesthesia rat, abdomen neck, belly and groin are shaved to Mao Bingyong 10% PVP-I washing. Carry out 2-cm center line laparotomy. Caecum is exposed, and in the ligation of ileocaecal sphineter tip, to avoid intestinal obstruction, with the pin puncture twice of 18-specification, slight extruding is flowed out a small amount of fecal matter from hole, and gets back to abdominal cavity; Then sew up from level to level abdominal incision. Sham-operation is moved animal (, control-animal) and is stood identical program, does not puncture except caecum has not both had ligation liquid. After operation, with subcutaneous 3ml/100gBW physiological saline, animal is revived immediately. Then Animal Anesthesia is carried out collection organization's sample by the different time interval after caecum ligation and puncture (CLP) or sham-operation. All experiments are carried out according to the animal used as test usage criteria of National Inst. of Health (NationalInstitutesofHealth). This project obtains the approval of the InstitutionalAnimalCareandUseCommittee of NorthShoreLongIslandJewishResearchInstitute.

Preparation and the administration of people I α Ip

Accessory substance as the program designing from human plasma purifying blood coagulation Factor IX separates people I α Ip (I α I and P α I). This program relates to ion-exchange and the size exclusion chromatogram of cryoprecipitate. After chromatographic isolation, obtain approximately 70% purity. This preparation that contains I α Ip has very little side effect with regard to toxicity, thrombosis or low blood pressure. When pyemia outbreak rear 1,5,10 or 20h, under isoflurane anesthesia, use polyethylene 50-cannula in left femoral vein. People I α Ip concentrate or isopyknic carrier (physiological saline, 1.5ml/ rat) by thigh conduit with the constant rate of inculcating intravenous administration 30mg/kgBW dosage. In experiment before, the administration of people I α Ip is in infusion procedure or after this do not change mean arterial pressure or heart rate (data do not show).

The mensuration of RNA extraction and liver bikunin gene

Liver is the main source of bikunin. therefore the bikuninmRNA that, we measure in liver expresses. extract total RNA by Tri-Reagent (MolecularResearchCenter, Cincinnati, OH) from liver. by the 100mg hepatic tissue homogeneous in 1.5mlTri-Reagent, by adding chloroform to be separated into water and organic phase, and centrifugal. by adding isopropyl alcohol to isolate RNA from water, and wash with ethanol. that 0.1%DEPC-processes by being precipitated and dissolved in, in deionized distilled water. by 260 and 280nm measure absorptance and measure concentration and the purity of RNA. by 5 μ gRNA of each tissue reverse transcription in 20 μ l reaction volumes, reaction solution contains 50mMKCl, 10mMTris-HCl, 5mMMgCl2,1mMdNTP, 20URNA enzyme inhibitor, few d (T) 16 primers of 2.5mM and 50U reverse transcriptase. reverse transcription reaction solution is hatched to 1h at 42 DEG C, then 95 DEG C of heating 5 minutes. with the cDNA of 3 ' and 5 ' the primer amplification l μ l of 0.15 μ M separately, primer pair rat bikuin specificity (633bp) (5 ' TGAGGAATATGCCATTTTCC3 ', 5 ' CCACAGTACTCCTTGCACTCC3 ') (accession number No.S87544), (983bp) (5 ' TGAAGGTCGGTGTCAACGGATTTGGC3 ' of rat Glyceraldehyde-3-phosphate-dehydrogenase 7 (G3PDH) (24), 5 ' CATGTAGGCCATGAGGTCCACCAC3 '), in 25 μ lPCR mixtures, contain 50mMKCl, 10mMTris-HCl, 2mMMgCl2, 0.2mMdNTP and 0.7UAmpliTaqDNA polymerase. at the enterprising performing PCR of Bio-Rad thermal cycler. after RT-PCR, by the reactant mixture of 5 μ l electrophoresis in the 1.2%TBE-agarose that contains 0.22g/ml ethidium bromide. then produce gel and use Bio-Rad PS (Hercules, CA) by G3PDH by band intensity standardization.

The mensuration of the radioiodination of protein and I α Ip half-life

Use Na¹²⁵The I α Ip of I (Amersham, ArlingtonHeights, IL) radioiodination purifying, uses 1,3,4,6-tetrachloro-3a-6a-diphenylglycoluril (IODO-GEN iodating agent; Pierce, Rockford, IL) will. Reactant mixture is used to removing on ExcelluloseGF-5 desalting column (Pierce) uncorporated¹²⁵I. In gamma counter (Pharmacia-LKB, Piscataway, NJ), measure radioactivity. After CLP and sham-operation 12 hours time, suck Animal Anesthesia with isoflurane. Intravenous injection yellow Jackets (～30mg/kgBW) maintain calm stable state subsequently. Polyethylene-50 conduit is put into right jugular vein and left femoral artery, and by the I α Ip bolus injection (～500,000cpm/ rat) of neck sleeve pipe administration 125I-mark. Measure remaining radioactivity in syringe with gamma counter, and counting deducts radiocounting and measures the radioactivity of clean injection from initial injection. After injection, collect immediately blood sample, then within every 2 hours, measure in circulation₁₂₅Half-life (the t of I-I α Ip_1/2) 8 hours. Use gamma counter to measure the radioactivity (cmp) of each sample. According to WuR, ZhouM, CuiX etc.: t is calculated in the removing (Chrelinclearanceisreducedatthelatestageofpolymicrobialse psis) that has reduced ghrelin in many microorganisms pyemic late period_1/2。IntJMolMed.2003；12：777-782。

Survival research

Carry out as mentioned above CLP. After CLP 1,5,10 or 10 and 20 hour time, intravenous is inculcated people I α Ip concentrate (30mg/kgBW) or carrier (physiological saline, 1.5ml/ rat, after CLP 1 hour time or after CLP 10 and 20 hours time). After CLP 20 hours time, excise downright bad caecum and use SPSS solution that 40ml is warm by abdominal cavity washed twice. Then abdominal incision is sewed up layer by layer. Simulation is carried out the caecum excision program in CLP animal with regard to removing the clinical setting of septicopyemia focus whenever possible. Then allow animal arbitrarily take food and drink water and monitor over 10 days and record survival.

Statistical analysis

Result is expressed as on average ± SE. Use variance one tail analysis (ANOVA) and Tukey to test animal used as test more on the same group. Calculate survival rate and compare by the test of logarithm level by Kaplan-Meier method. If the difference of P < 0.05 value of thinking is significant.

The change that after CLP, bikuninmRNA expresses

Bikunin is the active part of I α Ip. Liver is the main source of bikunin. Therefore, we select the bikuninmRNA in liver to express to react the generation of I α Ip. As shown in Figure 3, after CLP, when 5h, in liver, the mrna expression of bikunin does not change, but, after CLP, compare in the animal of the water of doing evil through another person when 20h, find to reduce by 32% (P < 0.05).

After CLP¹²⁵The t of I-I α Ip_1/2Change

The half-life that changes to calculate I α Ip by measuring the blood content of the radioactive label I α Ip injecting when pyemia is shown effect rear 12h. As shown in Figure 4, after CLP¹²⁵The t of I-I α Ip_1/2Significantly improve to 11.8 ± 2.7h (P < 0.05) from 5.6 ± 0.3h

The effect of I α Ip to survival rate

The survival rate of single carrier administration after the excision of CLP and caecum when 1h (after CLP) was 75% at the 2nd day and was reduced to 50% (Fig. 5) at 5-10 days. But administration people I α Ip is increased to survival rate 92% (P < 0.05 in the observation stage of whole 10 days when 1h after CPL; Fig. 5). Although after CLP 5 or when 10h administration people I α Ip survival rate is increased to 64% and 73% separately, these raisings do not have significance,statistical (Fig. 6). The survival rate of twice carrier administration after the excision of CLP and caecum when 20h (after CLP 10 and) was 56% at the 2nd day and was reduced to 44% (Fig. 7) at 5-10 days there is no significant difference compared with a carrier administration (Fig. 5). But, after CLP 10 and when 20h administration people I α Ip in the observation stage of whole 10 days, survival rate is increased to 81%, be (the P < 0.05 of significant difference compared with vehicle group; Fig. 7).

Pyemia is the clinical symptoms that are characterised in that systemic inflammatorome, coagulopathy, respiratory failure, myocardial dysfunction, renal insufficiency and neuro-cognitive defect. It has been generally acknowledged that this symptom is to be caused by the endogenous inflammatory mediator of the excessive initiation of invading micro-organism. These media comprise that the monocyte, macrophage, endothelial cell of activation and material that neutrophil discharges are as cell factor, reactive oxygen species and protease. In serious inflammatory reaction, various blood and histocyte, comprise multinuclear type granulocyte, and born of the same parents discharge bacteriolyze protease outward and enter in circulation. In such protease and phagocytosis, the normal born of the same parents' inner oxide matter producing, can cause tissue and organ damage and improve the clotting of plasma and the non-specific hydrolysis of complement factor. The release of neutrophil cell protease, especially HLE, related to the progress of the individual complication of pyemia. The order of severity of their blood plasma level and infection induced inflammation and closely related by the Height Prediction of the organ failure occurring.

In the process of people's septic shock, except the proteinase activity improving, also report the I α Ip level reducing. The serious individuality reducing of I α Ip concentration has the higher death rate. Gene expression that our result shows bikunin in CLP animal's liver is significantly lower than in sham-operation animal. In primate, pig and rodentine various tissues, detect and interior-mrna expression that alpha inhibitor family protein is relevant. These researchs show that the gene in all members of I α Ip family source is mainly at liver transcription. Our result has also shown to compare with sham-operation, and after CLP, 5 or 20 hours time, the bikunin gene expression in other organs (, intestines and kidney) does not significantly change (data do not show).

After CLP, only in liver, observing remarkable downward shows that this organ is the important sources of I α Ip 20 hours time, and in addition, in pyemic late period, the bikunin gene expression in liver significantly reduces. In treatment, report that bikunin has beneficial effect to people as the prophylactic treatment of the organ damage after the pancreatitis or the alleviation openheart surgery that prevent after gastrectomy. The research of measuring bikunin effect in the bacteremic acute canine model of pathogenic escherichia coli has shown similar result, has the improvement of Hemodynamics variable and kinemic standardization and mean arterial pressure. Because the plasma half-life of bikunin very short (approximately 10 minutes), the half-life that therefore extends bikumin maintains the lasting beneficial effect of this medicament and shows importance. Our result shows that the I α Ip half-life in sham-operation animal is 5.6h. In the time that we inject radiolabeled I α Ip in the time that pyemia is shown effect rear 12h, we find that the Increased Plasma Half-life of I α Ip is to 11.8h. These results show that I α Ip clearance rate significantly reduces in pyemia process. But even if having the clearance rate of reduction, in pyemia individuality, the blood plasma level of I α Ip is still significantly lower. That research before us has shown is early stage after pyemia outbreak (, after CLP 1 hour), and administration low-purity I α Ip maintains whole body oxygen consumption and the whole body oxygen recovery rate of cardiac output and whole body oxygen transmission and raising. In addition, after CLP, I α Ip lowers the generation of TNF-α and reduces hepatocellular injury and lactic acidosis when 20h. In addition when, pyemia is shown effect rear 1h, administration I α Ip has improved the survival of pyemia animal.

Separate people I α Ip albumen as the accessory substance of commercial scale blood plasma classification. Separation method height, Sync enrichment containing the main blood plasma form of bikunin albumen (I α I and P α I). Therefore,, in this preparation, obtained the physiology composition of blood plasma I α Ip. Survival rate when CLP and caecum are excised latter 10 days by administration I α Ip when the death rate result of study of carrying out shows after CLP 1 hour is increased to 92% from 50%. Although administration people I α Ip is increased to survival rate 64% and 73% separately 5 or 10 hours time after CLP, these raisings do not have significance,statistical.

But, after CLP 10 and when 20h administration people I α Ip significantly survival rate is increased to 81% from 44%. Therefore, to appear be that useful additive is for improving the survival rate of many microorganisms pyemia progression to I α Ip. In a word, in pyemic process, bikunin gene expression in liver reduces and the half-life of I α Ip was increased to 11.8 ± 2.7 hours from 5.6 ± 0.3 hours, although show that clearance rate reduction lowered the bikunin in pyemia. After CLP, administration I α Ip is increased to 92% by survival rate from 50% 1 hour time, and when after CLP 5 or when 10h administration I α Ip do not significantly improve. But 10 and 20 hours double injection I α Ip are increased to 81% by survival rate from 44% after CLP. The administration people I α Ip postponing but repeat has improved the survival rate after CLP.

Embodiment 3

The purifying of I α Ip

Eluate after application dialysis or ultrafiltration/diafiltration is with after DEAESephadexA50 solid phase extractions, receive/0.0055M of the 0.005M citric acid sodium phosphate buffer that contains 0.28M sodium chloride with pH6.0 (is described in Hoffer etc., JournalofChromatographyB from the composition of DEAE-SepharoseFF post elution weak binding669(1995) 187-196). In step before, receive/0.0055M of the 0.005M citric acid sodium phosphate buffer washing pillar with pH6.0 containing 0.20M sodium chloride.

After 0.005M sodium phosphate buffer dialysis to pH7.0 or ultrafiltration/diafiltration (UF/DF), eluate is used to hydroxyapatite column. I α Ip does not collect in conjunction with pillar and as flowing out fraction. Can carry out elution impurity protein by the sodium phosphate buffer gradient of progressive concentration, be mainly FII, FVII and FX. I α I/P α I contains the target protein higher than 90%, is mainly I α I and P α I.

Embodiment 4

Flow out purifying I α Ip fraction from factors IX

The unbinding protein of heparin-agarose affinity chromatography (L.Hoffer etc., J.ofChromatographyB) is used to DEAE-SepharoseFF anion-exchange resin column. After 0.005M phosphate buffer washing pillar with three column volume pH7.0 of minimum, carry out the fraction that elution contains I α Ip/P α I with the 0.005M phosphate buffer that contains 0.55M sodium chloride (elution buffer solution) of pH7.0. Eluate is containing the I α I/P α I of the 30-40% that has an appointment. After 0.005M sodium phosphate buffer dialysis to pH7.0 or ultrafiltration/diafiltration (UF/DF), the eluate of DEAESepharoseFF is used to hydroxyapatite column. I α I/P α I does not collect in conjunction with pillar and as flowing out fraction. Can carry out elution impurity protein by the sodium phosphate buffer gradient of progressive concentration, be mainly FII and FX. The I α I/P α I of purifying contains the target protein higher than 90%.

Embodiment 5

By cold barren blood plasma at DEAE-SephadexA50 (L.Hoffer etc., or Q-SephadexA50 (D.Josic etc. J.ofChromatographyB), ThrombosisResearch, with reference to above) on the elutriant of solid phase extractions use to thering is (reference on the DEAC-CIM pipe monolith of 80mL column volume, K.Branovic etc., J.ofChromatographyA903(2000) 21-32). Collect unconjugated fraction (effluent). Use subsequently 0.02MTris-HCl (level pad) the washing pillar of the pH7.4 of three column volumes. In first step, with the unconjugated protein of 0.02MTris-HCl elution (eluate 1) of the pH7.4 that contains 0.35Mol/L sodium chloride, in second step, use the 0.02MTris-HCl (elution 2) of the pH7.4 that contains 0.55M sodium chloride. In outflow fraction and eluate 1, find I α I/P α I. Flow out the I α I/P α I of fraction containing the 35-45% that has an appointment. In eluate 1, the amount of these target proteins is 20-30%. The fraction that contains I α I/P α I is accepted to dialysis or the ultrafiltration/diafiltration (UF/DF) of the 0.005M sodium phosphate buffer to pH7 and used to hydroxyapatite column. I α Ip does not collect in conjunction with pillar and as flowing out fraction. Flow out fraction and contain the I α I/P α I higher than 90%.

Fig. 8 a and 8b have described the exemplary purification schemes of the I α Ip with flowcharting presenting as embodiment 3-5.

Embodiment 6

The beneficial effect of highly purified I α Ip in zooscopy

In male Sprague-Dawley rat, induce many microorganisms pyemia by caecum ligation and puncture (CLP). Animal feed is spent the night but can arbitrarily be drunk water carrying out before CLP. When experiment, suck rat anesthesia by methyl fluothane, and carry out 2-cm center line and cut open the belly. Caecum is exposed, only avoid enteremphraxis in the ligation of ileocaecal sphineter distally, with the pin puncture twice of 18-specification, leniently extrude a small amount of ight soil, then return to abdominal cavity. Abdominal incision is sewed up layer by layer, after CLP using animal immediately the subcutaneous 30mL/kg of acceptance body weight normal saline solution revive as fluid. In this experiment, use two groups of rats, every group of n=12. After CLP, treatment group is accepted the highly purified I α Ip of 30mg/kg body weight 10 and 20 hours time. Control group is accepted salt solution. After CLP 20 hours time, excise downright bad caecum and with the warm SPSS solution of 40mL by abdominal cavity washed twice. Then abdominal incision is sewed up layer by layer. The caecum excision program of carrying out in CLP animal is simulated the clinical setting of wherein removing septicopyemia focus. Allow animal used as test arbitrarily take food and monitor the death of recording non-viable person over 10 days. Test the death rate between more different treated animals and measure p value by Kaplan-Meier method by logarithm level. Compare with saline control group, observe significantly improve (in treatment group, 81.3% surviving animals is to 44% survival (p value=0.0293) in control group) of surviving in treatment group, show that highly purified I α Ip is bioactive and effective in the pyemia associated death that reduces pyemia animal. The results are shown in Fig. 9.

The comparison of table 1.I α Ip rejection ratio activity

TIU=TIU; On average ± SD is from single independently experiment

The rejection ratio activity of the I α Ip (carrying out self cooling barren blood plasma) of computed altitude purifying is also compared with the I α Ip of cryoprecipitate purifying, and cryoprecipitate is the accessory substance that the FVIII factor is produced. Suppress to use product look substrate L-BAPA (N (α)-benzoyl-L-arginine-4-p-nitroanilide hydrochloride) (FlukaChemicals) to measure the biologically active of I α Ip in test at trypsase. This test is the ability that suppresses L-BAPA hydrolysis based on I α Ip. δ absorptance by 410nm place/minute rate reduction monitor inhibition. Test quantitative measurment protein concentration by BioRad protein, and measure I α Ip concentration by competitive ELISA with MAb69.31, as Lim etc., J.ofInfectiousDisease, described in 2003. There is no significant difference (p value=0.939) from the specificity trypsin inhibition activity between the I α Ip preparation of cold barren blood plasma and cryoprecipitate purifying, show that two kinds of I α Ip in fraction have suitable biologically active.

Embodiment 7

From the accessory substance of FIX purifying

" washing fraction " is from the clotting factor FIX chromatogram purification on DEAE-SepharoseFF (Josic etc., JournalofChromatography, above drawn). Carry out this fraction of elution with the 0.01-0.1M that contains 0.25M sodium chloride natrium citricum/0.005-0.1M sodium phosphate buffer of pH6.0. I α I and P α I are the main components in this fraction. In next step, contain the fraction of FIX from the elution of DEAE-SepharoseFF post with the 0.01-0.1M that contains 0.3-0.6M sodium chloride natrium citricum/0.005-0.1M sodium phosphate buffer of pH6.0. In this fraction, also contain other vitamin K-dependent clotting factors as the I α Ip of the proconvertin (FVII) of prothrombin (FII), Stuart factor (FX), lower content and residual quantity. Reduce after the dialysis of osmotic pressure and salinity, by the affinity chromatography on fixing heparin and increase progressively salinity and osmotic buffering agent in elution step collect the remaining I α Ip in FIX fraction. Fraction in the lavation buffer solution of early stage elution step contains the I α Ip and the low-down FIX impurity that exceed 80%. In higher salt concentrations after the elution of FIX occurs in and osmotic pressure buffer solution step. Also exist not in conjunction with the outflow fraction of pillar, be without FIX's and contain I α Ip (30-40%), vitamin K-dependent clotting factor and for the mixture of the solvent/detergent (S/D) of inactivation of virus. Can in other DEAE-SepharoseFF chromatographic step, remove S/D.

Collect containing the fraction of I α Ip from DEAE-Sepharose, the effluent that is fixed on heparin or heparin can be further purified or individually as the set of hydroxyapatite. Use any method, final preparation contains the ITI higher than 90%.

Use the concentrate of these program purifying to contain the I α I/P α I higher than 90%. By solvent/detergent treatment by inactivation of virus. Can introduce with or without the final heating more than 30 minutes in the final container of stabilizing agent or under stabilizing agent exists 55-65 DEG C of pasteurize be used as second inactivation of virus step and actively significantly do not lose.

With S/D processing or as second inactivation step, use or heat 30 minutes final the protein of purifying without stabilizing agent, or 55-65 DEG C of pasteurize is by the obtained concentrate inactivation of viruses higher than 90%I α I/P α I that contains under stabilizing agent exists.

Reinforcing yin essence ion-exchange fraction

Substitute the eluate after weak anionic exchange DEAESephadexA50 solid phase extractions, can use the eluate after reinforcing yin essence ion-exchange QSephadexA50 solid phase extractions. The condition of elution is described in German patent DE 4342131C1. The mixture of I α I and P α I not in conjunction with or just faintly in conjunction with overall anion-exchange support DEAE-CIM. In the fraction of separating, elution goes out other protein as clotting factor FII, FVII, FIX and FX, Coagulative inhibitors agent PC, PS and PZ, adhesion protein vitronectin and Protease F SAP. In next step, use hydroxyapatite chromatography can obtain the further separation of residual impurity.

Monolithic chromatogram fraction

DEAECIM entirety (film) can substitute DEAESepharoseFF or other anion exchangers (referring to DE4342132C1) based on particle for the chromatographic isolation in FIX purifying. Surprisingly, I α I and P α I not in conjunction with or just faintly in conjunction with integral carriers. Other protein, as FIX, vitronectin and FII, FVII (low amount) and FX obtain elution as the fraction of separating. In this purification step, mainly from proteolytic activity (J.Roemisch, the BiologicalChemistry of factor VII activator protein enzyme (FASP)383(2002) 1119-1124) also obtain separating fully. In next step, obtain the further separation containing the residual impurity of I α I/P α I fraction, i.e. trace vitamin K-dependent clotting factor FII, FVII and FX with hydroxyapatite chromatography.

All publications of quoting in this application and patent document are incorporated herein by reference for all objects to same degree with its entirety, are to represent separately as each independently publication and patent document. Unless otherwise noted, there is in these all technology used and scientific terminology the meaning that those skilled in the art in the invention understand conventionally. Following bibliography provides the General Definition of many terms used: Singleton etc. in the present invention to technical staff, microorganism and molecular biology dictionary (DictionaryofMicrobiologyandMolecularBiology) (the 2nd edition, 1994); Cambridge technical dictionary (TheCambridgeDictionaryofScienceandTechnology) (Walker edits, 1988); Science of heredity term (TheGlossaryofGenetics), the 5th edition, R.Rieger etc. (editor), SpringVerlag (1991); And Hale&Marham, HarperCollins biology dictionary (TheHarperCollinsDictionaryofBiology) (1991).

Introduce bibliography

The content that runs through all bibliography (comprising bibliography, disclosed patent, disclosed patent application and co-pending patent application) that the application quotes is specially incorporated herein by reference with its entirety at this.

Equivalent

Those skilled in the art use not transnormal experiment to recognize the many equivalents that maybe can determine particular of the present invention described herein. Determine that such equivalent is included by following claim.

Claims (55)

1.I α Ip composition is for the preparation of the purposes of medicine, described medicine is used for the treatment of the inflammation related disease in individuality, described inflammation related disease is selected from meningitis, chronic obstructive pulmonary disease, rhinitis and IBD, described composition comprise physiology ratio interior-mixture of alpha inhibitor protein (I α I) and front-alpha protein (P α I).

2. the purposes of claim 1, wherein said I α Ip composition is the I α Ip composition that is derived from blood plasma.

3. the purposes of claim 1, wherein said I α I and P α I have high trypsase rejection ratio activity.

4. the purposes of claim 3, wherein said high trypsase rejection ratio activity is 1000 to 2000IU/mg.

5. the purposes of claim 4, the described high trypsase rejection ratio activity of wherein said composition is 1500 to 2000IU/mg.

6. the purposes of claim 1, wherein said I α I and P α I have the half-life higher than one hour.

7. the purposes of claim 6, the I α Ip existing in wherein said composition has the half-life of at least 5 hours.

8. the purposes of claim 7, the I α Ip existing in wherein said composition has the half-life of at least 10 hours.

9. the purposes of claim 1, wherein said I α I and P α I comprise with three heavy chain H1, H2 and H3 in the light chain of I α I of at least one combination.

10. the purposes of claim 1, wherein said I α I and P α I comprise with four heavy chain H1, H2, H3 and H4 in the light chain of I α I of at least one combination.

The purposes of 11. claims 1, wherein said medicine is with the form preparation of tablet, capsule or injection.

The purposes of 12. claims 1, the I α I existing in wherein said composition and P α I have 60,000 to 280,000Da apparent molecular weight.

The purposes of 13. claims 1, wherein said composition further comprises antiinflammatory, anticoagulant or immunomodulator.

The purposes of 14. claims 1, wherein said composition further comprises acceptable carrier on materia medica.

The purposes of 15. claims 1, wherein said I α I and described P α I are present in described mixture with physiology ratio, are 85% to 100% pure.

The purposes of 16. claims 1, wherein said I α Ip comprises 60% to 80% I α I and 40% to 20% P α I.

The purposes of 17. claims 1, wherein said physiology ratio is the ratio of the natural I α I presenting and P α I in human plasma.

The purposes of 18. claims 1, wherein said composition further comprises stabilizing agent.

The purposes of 19. claims 18, wherein said stabilizing agent is albumin, polyethylene glycol, α, α-trehalose, amino acid, salt, glycerine, omega-amino acid, sugar or its combination.

The purposes of 20. claims 2, wherein said I α I separates from blood plasma fraction with P α I.

The purposes of 21. claims 20, wherein said blood plasma fraction comprises the accessory substance fraction obtaining from purifying blood coagulation factors IX.

The purposes of 22. claims 20, wherein said blood plasma fraction comprises the accessory substance fraction obtaining from purifying blood coagulation proenzyme complex concentrate.

The purposes of 23. claims 20, the cold supernatant that wherein said blood plasma fraction obtains from CPP and obtaining.

The purposes of 24. claims 20, wherein said blood plasma fraction obtains from cold barren blood plasma.

The purposes of 25. claims 20, wherein said blood plasma fraction is from people, primate, ox, pig, cat or dog.

The purposes of 26. claims 1, wherein said I α I separates by affinity chromatography with P α I.

The purposes of 27. claims 12, wherein said apparent molecular weight is measured by SDS-PAGE.

The purposes of 28. claims 1, wherein said I α Ip composition is processed with inactivation of viruses.

The purposes of 29. claims 28, wherein said I α Ip composition is processed by solvent/detergent treatment or hot deactivation.

The purposes of 30. claims 29, wherein said hot deactivation is in the temperature of 55 to 65 DEG C or xeothermic at 70 to 120 DEG C.

The purposes of 31. claims 1, wherein said I α Ip composition carries out pasteurize.

The purposes of 32. claims 1, wherein said I α I and P α I obtain from blood.

The purposes of 33. claims 32, wherein said I α I and P α I obtain from blood plasma.

The purposes of 34. claims 1, is characterized in that before described treatment in described individuality after measured level before treatments one or more in following level:

(i) level of I α I;

(ii) level of P α I;

(iii) level of I α Ip;

(iv) level of H3;

(v) level of H4;

(vi) level of H1;

(vii) level of H2; With

(viii) level of LC.

The purposes of 35. claims 34, it is characterized in that during the first after date of described drug administration measure described in described individuality levels one or more in level, described in individuality, the raising of level represents that described individuality may have good clinical response to described medicine described in wherein said just after date.

The purposes of any one in 36. claim 1-35, wherein said inflammation related disease is meningitis.

The purposes of any one in 37. claim 1-35, wherein said inflammation related disease is chronic obstructive pulmonary disease.

The purposes of any one in 38. claim 1-35, wherein said inflammation related disease is rhinitis.

The purposes of any one in 39. claim 1-35, wherein said inflammation related disease is IBD.

The purposes of 40. claims 39, wherein said IBD is regional ileitis.

41.I α Ip composition is for the preparation of the purposes of medicine, described medicine is used for the treatment of in the method for individual inflammation related disease, described inflammation related disease is selected from meningitis, chronic obstructive pulmonary disease, rhinitis and IBD, and described method comprises: (a) measure in described individuality level before treatments one or more in following level: (i) level of I α I; (ii) level of P α I; (iii) level of I α Ip; (iv) level of H3; (v) level of H4; (vi) level of H1; (vii) level of H2; (viii) level of LC; (b) by described drug administration in described individuality.

The purposes of 42. claims 41, wherein said method further comprises: (c) measure just level after one or more treatment in level described in after date of described medicine treatment, wherein the adjusting of I α Ip level represents that described treatment produces good clinical response.

The purposes of 43. claims 42, the wherein said treatment initial stage is the I α Ip needed time of PC that obtains stable state.

The purposes of 44. claims 42, wherein said adjusting is the raising of I α Ip level.

The purposes of 45. claims 41, wherein the level of I α I, P α I, I α Ip, H3, H4, H1, H2 and LC is measured by immunization method.

The purposes of 46. claims 41, wherein said composition further comprises anticancer, antiinflammatory, anticoagulant or immunomodulator.

The purposes of any one in 47. claim 41-46, wherein said IBD is regional ileitis.

48.I α Ip composition is for the preparation of the purposes of medicine, described medicine is for predicting the reaction of the individuality of suffering from inflammation related disease to I α Ip treatment, described inflammation related disease is selected from meningitis, chronic obstructive pulmonary disease, rhinitis and IBD, and described prediction comprises: measure the sample obtaining from individuality and detect with lower one or more level: (i) I α I; (ii) P α I; (iii) I α Ip; (iv) H3; (v) H4; (vi) H1; (vii) H2; (viii) LC; The level of wherein said detection represents the individuality to described I α Ip treatment sound response.

The purposes of 49. claims 48, the level of wherein said detection is the reduction of I α I and P α I level.

The purposes of 50. claims 48 or 49, wherein said IBD is regional ileitis.

51.I α Ip composition is for the preparation of the purposes of medicine, described medicine is for monitoring the individual progress of suffering from inflammation related disease for the treatment of with I α Ip, described inflammation related disease is selected from meningitis, chronic obstructive pulmonary disease, rhinitis and IBD, and described monitoring comprises: (a) measure in described individuality level before treatments one or more in following level: (i) level of I α I; (ii) level of P α I; (iii) level of I α Ip; (iv) level of H3; (v) level of H4; (vi) level of H1; (vii) level of H2; (viii) level of LC; (b) the described I α Ip composition for the treatment of effective dose is delivered medicine to described individuality; (c) measure just one or more level in level described in individuality described in after date of described medicine treatment, after wherein said medicine treatment, the raising of level described in described individuality represents that described individuality may have good clinical response to I α Ip treatment.

The purposes of 52. claims 51, wherein said IBD is regional ileitis.

The composition of the I α Ip of 53. mixtures that comprise I α I and P α I, wherein said I α I and described P α I are present in described mixture with physiology ratio, and there is 1000 to 2000IU/mg high trypsase rejection ratio activity, and wherein said composition is suitable for delivering medicine to people, and there is the purity that scope is 85% to 100% I α Ip.

The composition of 54. claims 53, wherein said trypsase rejection ratio activity is 1500 to 2000IU/mg.

The I α Ip composition of 55. claims 53 or 54, it is used for the treatment of the inflammation related disease in individuality, and described inflammation related disease is selected from meningitis, chronic obstructive pulmonary disease, rhinitis and IBD.