CN103131799B - Primer group for detecting plantain lily plant virus and application thereof - Google Patents
Primer group for detecting plantain lily plant virus and application thereof Download PDFInfo
- Publication number
- CN103131799B CN103131799B CN201310072636.2A CN201310072636A CN103131799B CN 103131799 B CN103131799 B CN 103131799B CN 201310072636 A CN201310072636 A CN 201310072636A CN 103131799 B CN103131799 B CN 103131799B
- Authority
- CN
- China
- Prior art keywords
- primer
- testing sample
- virus
- sequence
- hosta
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a primer group for detecting plantain lily plant viruses and an application of the primer group. The primer group disclosed by the invention comprises a primer 1, a primer 2, a primer 3, a primer 4, a primer 5 and a primer 6, or comprises the primer 1, the primer 2, the primer 3 and the primer 4, wherein the nucleotide sequences of the primer 1, the primer 2, the primer 3, the primer 4, the primer 5 and the primer 6 are respectively a sequence 1, a sequence 2, a sequence 3, a sequence 4, a sequence 5 and a sequence 6. Tests show that the effective amplification can be accomplished within 15min by using the primer group; the result can be judged by naked eyes through turbidity precipitation reaction or fluorochrome color reaction, no expensive or large-sized instruments are needed, a plantain lily plant virus X in a sample can be rapidly detected on site, the requirements on rapid quarantine inspection at a port are met, and powerful guarantees for effectively controlling the incoming and outflow of the plantain lily plant virus X and for prompting the development of Chinese flower industry are provided.
Description
Technical field
The invention belongs to biological quarantine authenticate technology field, relate to a kind of primer sets and application thereof for detection of hosta virus X.
Background technology
Hosta virus X(Hosta virus X, HVX) be the linear Viraceae of A type (Alphaflexiviridae) potexvirus (Potexvirus) virus, be a kind of virus that infects specially hosta (Hosta Tratt), can cause the symptoms such as the hosta floral leaves such as jade hairpin (H.plantaginea Aschers.) and Hosta ventricosa (H.ventricosa Stearn), mottled and leaf abscission.HVX can propagate by approach such as seed, nursery stock and garden tool sets.There are Holland, France, Korea S, the U.S. in the country of having seen HVX report at present.HVX imports into after the U.S., U.S.'s hosta has been caused to serious harm, and product loss is huge, badly influences the economic benefit of hosta.The U.S. has classified HVX as limited non-quarantine harmful organisms.For supporting the healthy nursery stock plan (clean stock program) of U.S. domestic, the hosta product of continental United States is just towards the future development infecting without HVX, in order to respond HVX, infect and cause serious economic impact and support domestic healthy nursery stock plan, U.S. animal and plant quarantine bureau (being called for short APHIS) is formulating the hosta import requirement that meets domestic situation, APHIS is by port of importation, the hosta material to all imports carries out HVX detection, if HVX infection rate is prohibited from entering higher than 5%.
Hosta originates in China and Japan, in China, is widely distributed, and wherein the beautiful flower garden ornamental plant such as jade hairpin (H.plantaginea Aschers.) and Hosta ventricosa (H.ventricosa Stearn), is keeping good export abroad record for many years.In order to protect the industry of flowers and plants of China, State General Administration for Quality Supervision sends the epidemic situation warning of HVX, reminds vast flower plants and nursery stock import and export enterprise and each port quarantine office; the special project that should strengthen HVX detects; to remove a hidden danger, guarantee China's flowers safety in production, promote the flower export of China simultaneously.In order effectively to improve detection efficiency, need to set up corresponding detection technique.
At present in the detection of hosta virus X, more conventional method has two kinds, a kind of is Serology test, common are DAS-ELISA, Serology test is except Shortcomings in sensitivity, and the specificity of its detection is also restricted (detection belonging to together between member often has cross reaction); Another kind is molecular biology for detection, wherein common with RT-PCR, but PCR needs special instrument (PCR instrument).The time that both detections need to be longer simultaneously, serological method approximately needs 2 days, and molecular biology method approximately needs 5 hours, cannot meet the requirement of port rapid quarantine.
Ring mediated constant temperature nucleic acid amplification technology (loop-mediatedisothermal amplification, LAMP), is the constant temperature nucleic acid amplification method in a kind of novelty of invention in 2000 by Notomi T etc., and it is a kind of high-sensitive strand displacement technology.LAMP feature is 6 special primers of 6 zone design for target gene, utilize a kind of strand displacement archaeal dna polymerase-Bst DNA polymerase to react and can complete nucleic acid amplification reaction in 0.5-1 hour under the condition of constant temperature (60 ℃-65 ℃), by the direct visual colorimetry of fluorescent dye, just can obtain reaction result clearly.Do not need long temperature cycle, do not need the expensive instruments such as PCR instrument, do not need the loaded down with trivial details processes such as electrophoresis ultraviolet observation.Disease detection and quick diagnosis that the mankind and the various virus of animals and plants, bacterium and parasite etc. cause have been widely used at present, and some patented mandates, as having on plant virus: a kind of method (application number: 201110119658.0 of the LAMP of utilization rapid detection Papaya leaf curl China virus; Granted publication number: CN102154526B), utilize rice black-streaked dwarf virus (application number: 201110071894.X in RT-LAMP method rapid detection plant; Granted publication number: CN102154518B), utilize rice black-streaked dwarf virus (application number: 201110071930.2 in RT-LAMP method rapid detection plant hopper body; Granted publication number: CN102168151B) etc.
LAMP method due to have advantages of the reaction times short, without specific apparatus, detection sensitivity is high and specificity good, well overcome the deficiency of currently used DAS-ELISA and RT-PCR two class methods, had not yet to see the report that uses the method to detect hosta virus X.LAMP method had both guaranteed the susceptibility and the specificity that detect, had simplified again operation simultaneously, provided cost savings, for the inspection and quarantine of passing in and out provides a kind of simple effective means.
Summary of the invention
An object of the present invention is to provide a kind of loop-mediated isothermal amplification (LAMP) primer group for detection of hosta virus X.
Loop-mediated isothermal amplification (LAMP) primer group for detection of hosta virus X provided by the present invention, can be primer sets A or primer sets B; Described primer sets A is specifically comprised of primer 1, primer 2, primer 3, primer 4, primer 5 and primer 6; Described primer sets B is specifically comprised of described primer 1, described primer 2, described primer 3 and described primer 4;
Described primer 1(F3), described primer 2 (B3), described primer 3(FIP), described primer 4(BIP), described primer 5(LF) and described primer 6(LB) nucleotide sequence be respectively sequence 1, sequence 2, sequence 3, sequence 4, sequence 5 and the sequence 6 in sequence table.
In described primer sets A, the mol ratio of described primer 1, described primer 2, described primer 3, described primer 4, described primer 5 and described primer 6 can be 1:1:8:8:4:4; In described primer sets B, the mol ratio of described primer 1, described primer 2, described primer 3 and described primer 4 can be 1:1:8:8.
More concrete, described primer 1(F3) and the final concentration of described primer 2 (B3) in loop-mediated isothermal amplification system be 0.2 μ M; Described primer 3(FIP) and described primer 4(BIP) final concentration in loop-mediated isothermal amplification system is 1.6 μ M; Described primer 5(LF) and described primer 6(LB) final concentration in loop-mediated isothermal amplification system is 0.8 μ M.
In described primer sets, primer 1(F3) and primer 2 (B3) composition outside primer pair; Primer 3(FIP) and primer 4(BIP) form inner side primer pair; Primer 5(LF) and primer 6(LB) form annular primer pair.Sequence 1 is comprised of 18 Nucleotide, and sequence 2 is comprised of 18 Nucleotide, and sequence 3 is comprised of 40 Nucleotide, and sequence 4 is comprised of 40 Nucleotide, and sequence 5 is comprised of 20 Nucleotide, and sequence 6 is comprised of 20 Nucleotide.
Another object of the present invention is to provide a kind of ring mediated isothermal amplification reagent or test kit for detection of hosta virus X.
Ring mediated isothermal amplification reagent or test kit for detection of hosta virus X provided by the present invention, contain described primer sets A or described primer sets B.
In the present invention, described reagent or test kit, except comprising described primer sets A or described primer sets B, specifically also comprise 2 * reaction buffer (RM), enzyme solution and deionized water (DW).Described 2 * reaction buffer (RM), described enzyme solution (EM) and described deionized water (DW) are Peking blue spectrum bio tech ltd product, and being present in article No. is in the RT-LAMP reverse transcription loop-mediated isothermal amplification kit of LMP221.
Certainly, the described 2 * reaction buffer (RM) in described reagent or test kit, described enzyme solution (EM) and described deionized water (DW) are replaced with to conventional reversed transcriptive enzyme, strand displacement type archaeal dna polymerase, trimethyl-glycine, dNTPs, Mg
2+etc. formed reverse transcription loop-mediated isothermal amplifing reagent or test kit, also belong to protection scope of the present invention.
According to actual needs, in described reagent or test kit, also can comprise fluorescent color-developing agent.
In one embodiment of the invention, described fluorescent color-developing agent is specially fluorexon (Calcein).
The application whether described primer sets or described reagent or test kit contain in hosta virus X in evaluation or assistant identification testing sample also belongs to protection scope of the present invention.
An also object of the present invention is to provide a kind of method that whether contains hosta virus X in evaluation or assistant identification testing sample.
The method that whether contains hosta virus X in evaluation provided by the present invention or assistant identification testing sample, can be following (A) or (B):
(A) specifically comprise following (a1) and step (a2):
(a1) take the total RNA extracting from testing sample is template, with described primer sets or described reagent or test kit, carries out reverse transcription loop-mediated isothermal amplification;
(a2) according to the amplification of step (a1), determine as follows and in described testing sample, whether contain hosta virus X: if white depositions appears in described testing sample reaction solution, in described testing sample, contain or candidate is contained hosta virus X; Otherwise, described testing sample not containing or candidate do not contain hosta virus X;
(B) specifically comprise following (b1) and step (b2):
(b1) take the total RNA extracting from testing sample is template, with the described reagent or the test kit that contain fluorexon, carries out reverse transcription loop-mediated isothermal amplification;
(b2) according to the amplification of step (b1), in definite described testing sample, whether contain as follows hosta virus X: if described testing sample reaction solution, for green, contains in described testing sample or candidate is contained hosta virus X; If described testing sample reaction solution is orange, in described testing sample, do not contain or candidate is not contained hosta virus X.
In above-mentioned application or method, described testing sample can be plant sample or microbiological specimens.In one embodiment of the invention, described testing sample is specially and has infected hosta virus X(HVX) jade hairpin (Hosta spp.) blade, infected this life cigarette (Nicotiana benthamiana) blade of potato virus X (PVX) and infected goosefoot (Chenopodium quinoa) blade of arabis mosaic virus (ArMV).
In aforesaid method, described reverse transcription loop-mediated isothermal amplified reaction is 63 ℃ of isothermal reactions under condition.
The time of described reaction is advisable with 50min, when 15min, can start to adopt above-mentioned steps (a2) or (b2) described in method amplification is judged.
Experimental results show that, use primer sets provided by the present invention, can in 15min, there is effective amplified reaction, by turbidity precipitin reaction or fluorescence dye color reaction, can to result, carry out visual inspection differentiation easily, the instrument that does not need valuable or large volume, can to the hosta virus X in sample, carry out rapid detection at the scene, meet port quarantine requirement fast, for effectively controlling importing into of X of hosta virus, spread out of, promote the development of China's industry of flowers and plants that sound assurance is provided.Also can in plant test station for plant protection, scientific research institutions, imported and exported flowers manufacturing enterprise and peasant household at home, be applicable on a large scale simultaneously.
Accompanying drawing explanation
Fig. 1 is RT-LAMP turbidity precipitation naked-eye observation result.Wherein, 1a is hosta virus X; 1b is blank; The negative contrast of 1c.
Fig. 2 is RT-LAMP fluorescence dye color reaction detected result (specificity).Wherein, 2a is hosta virus X; 2b is blank; The negative contrast of 2c; 2d is potato virus X; 2e is arabis mosaic virus.
Fig. 3 is RT-LAMP turbidimeter nephelometric analysis result (sensitivity).Wherein, 10:10
-1diluent; 100:10
-2diluent; 1000:10
-3diluent; 10000:10
-4diluent; 100000:10
-5diluent; 1000000:10
-6diluent; Healthy: without the jade hairpin sample of virus infection.
Embodiment
The experimental technique using in following embodiment if no special instructions, is ordinary method.
In following embodiment, material used, reagent etc., if no special instructions, all can obtain from commercial channels.
Infected hosta virus X(HVX) jade hairpin (Hosta spp.) blade: be documented in " M.S.Wei; Y.J.Zhang; G.F.Li; et al.First report of Hosta virus X infecting Hosta plants in China.2013; Plant disease.http: //apsjournals.apsnet.org/doi/abs/10.1094/PDIS-09-12-0810-P DN " literary composition upper, public Ke Cong China Inst. of Quarantine Inspection Sciences obtains.
Infected this life cigarette (Nicotiana benthamiana) blade of potato virus X (PVX): be documented in " application DPO primer detects the multiple RT-PCR technical study of potato virus. Plant Pathology; 2009; 39(4): 431-434. " and a literary composition is upper, and public Ke Cong China Inst. of Quarantine Inspection Sciences obtains.
Infected goosefoot (Chenopodium quinoa) blade of arabis mosaic virus (ArMV): be documented in " foundation of arabis mosaic virus RT-PCR amplified production colloidal gold chromatographic and enzyme connection detection method. Plant Quarantine; 2011; 25(5): 33-36. " civilian going up, public Ke Cong China Inst. of Quarantine Inspection Sciences obtains.
One, for detection of the preparation of the RT-LAMP primer sets of hosta virus X
The loop-mediated isothermal amplification (LAMP) primer group that the present embodiment detects hosta virus X is comprised of primer 1, primer 2, primer 3, primer 4, primer 5 and primer 6.These six primers are prepared as follows: the nucleotide sequence (GenBank:NC_011544.1) of the hosta virus X having reported according to NCBI, after analyzing by software DNAMAN, find out the more special region of this viral nucleic acid as template reference sequences, use online LAMP primer-design software primer Explorer V4(http: //primerexplorer.jp/elamp4.0.0/index.html) design synthetic primer, sequence is as shown in table 1.
Table 1 is for detection of the LAMP primer of hosta virus X
| Primer title | Sequence (5 ' → 3 ') | Position on NC_011544.1 |
| FIP | ACTCCCTGAGTGTGGCTAGAGA-CCAGGCACAACGGTCAAC(sequence 3) | 6060-6081/6015-6032 |
| BIP | AGGTACTTCGCCCCCATCATCTCTTTGTAGCCCATCGCCG(sequence 4) | 6087-6108/6151-6168 |
| F3 | ACCCTCATCCCAGGACTC(sequence 1) | 5994-6011 |
| B3 | AAAGCCGCGTACTTCGTG(sequence 2) | 6173-6190 |
| LF | TGCCGCGAGGGAGGTGTA(sequence 5) | 6033-6050 |
| LB | GCGATCGAGCACAAGATTCC(sequence 6) | 6117-6136 |
Two, for detection of preparation and the using method thereof of the RT-LAMP test kit of hosta virus X
RT-LAMP test kit for detection of hosta virus X comprises the component of (1)-(2) or the component of (1)-(3) as follows:
(1) primer sets that prepared by step 1;
(2) RT-LAMP reverse transcription loop-mediated isothermal amplification kit (Peking blue spectrum bio tech ltd product, article No.: the 2 * reaction buffer providing LMP221) (RM), enzyme solution (EM) and deionized water (DW);
(3) fluorexon fluorescence dye (Loopamp FD luciferase assay reagent).
This test kit can be used as follows:
(a) preparation reaction system, for following (a1) or (a2):
(a1) reaction system (25 μ L): RNA sample 2 μ L(concentration to be measured are about 121ng/ μ L); Primers F IP and BIP(concentration are 40pmol/ μ L) each 1 μ L; Primer LF and LB(concentration are 20pmol/ μ L) each 1 μ L; Primers F 3 and B3(concentration are 10pmol/ μ L) each 0.5 μ L; 2 * reaction buffer (RM), 12.5 μ L; Enzyme solution (EM) 1 μ L; Deionized water (DW) 4.5 μ L.
(a2) reaction system (26 μ L): add 1 μ L fluorexon fluorescence dye in the reaction system of step (a1).
(b) according to following response procedures, react: 63 ℃ of temperature of reaction, reaction times 50min.
(c) result is judged: when reaction proceeds to 15min, and after reaction finishes, observe respectively the color of each sample reaction product, according to following (c1) or standard (c2), result is judged:
(c1) turbidity precipitation detects, and when corresponding reaction system (a1): LAMP reaction is carried out, the pyrophosphate salt of generation can the magnesium ion in system be combined and be produced magnesium pyrophosphate white precipitate.Whether therefore, directly estimate reaction tubes produces white opacity and can determine whether positive reaction.If white depositions appears in described testing sample reaction solution, in described testing sample, contain or candidate is contained hosta virus X; Otherwise, described testing sample not containing or candidate do not contain hosta virus X;
(c2) fluorescence dye color reaction detects, corresponding reaction system (a2): if described testing sample reaction solution be green, in described testing sample, contain or candidate is contained the viral X of hosta; If described testing sample reaction solution is orange, in described testing sample, do not contain or candidate is not contained hosta virus X.
In the use procedure of this test kit, also blank and negative control can be set, as follows:
Blank: take distilled water as template;
Negative control: the total RNA of healthy jade hairpin (without virus infection) of take is template.
Three, the test kit of preparing by step 2 detects hosta virus X
1, nanometer magnetic bead method is extracted total RNA
Sample extraction damping fluid: take Na
2hPO
412H
2o3.58g, KH
2pO
40.27g, NaCl8g, KCl0.2g, Na
2sO
31.3g, polyvinylpyrrolidone (PVP) MW24-4000020g, NaN
30.2g, chicken egg protein 2.0g, Tween-2020mL, be dissolved in 1000mL deionized water, and regulating pH value is 7.5.
PBS: take NaCl8.0g, Na
2hPO
41.15g, KH
2pO
40.2g, KCl0.2g, add 900mL distilled water to dissolve, and regulates pH value to 7.4, and adding distil water is settled to 1L.
(1) jade hairpin (Hosta spp.) the leaf sample 0.1g acquisition of sample preparation liquid: take and infected hosta virus X(HVX), add 1mL sample extraction damping fluid to grind, after grinding evenly, move in 1.5mL centrifuge tube, centrifugal 5min under 10000r/min condition, get supernatant liquor, obtain sample preparation liquid.
(2) acquisition of total RNA: add 20 μ L nanometer magnetic beads (Wuhan Wawasye Technology Development Co., Ltd., catalog number: EX1010), in 200 μ L centrifuge tubes, use magnet adsorption nanometer magnetic bead, abandon supernatant; Add 200 μ LPBS to clean nanometer magnetic bead; After abandoning supernatant, add 150 μ L sample preparation liquid, suction is beaten and is mixed, and puts room temperature 10min, every 2min, puts upside down and mixes 1 time; Again with abandoning supernatant after magnet adsorption nanometer magnetic bead; Add 50 μ L ddH
2o Eddy diffusion nanometer magnetic bead, processes 5min for 95 ℃; After magnet adsorption nanometer magnetic bead, draw supernatant liquor and be total RNA.
2, RT-LAMP amplification
According to the reaction system (25 μ L) of the using method preparation (a1) of test kit in step 2, and when reaction proceeds to 15min, and after reaction finishes, according to the standard of (c1), result is judged.Experiment repeats 3 times.
Result shows, when reaction proceeds to 15min, range estimation reaction tubes can see that adularescent muddiness starts to occur, after reaction finishes, white precipitate is more obvious, specifically as shown in Figure 1, and the 1a total RNA of jade hairpin blade of hosta virus X that has been step 1 infection of extracting wherein, reaction occurs being judged to be the positive by white opacity; 1b and 1c are respectively blank and negative control, and after reaction, solution is still transparent, is judged to be feminine gender.
Embodiment 2, for detection of the specificity analyses of the RT-LAMP test kit of hosta virus X
In order to verify the specificity of the RT-LAMP test kit for detection of hosta virus X of embodiment 1 preparation, the present embodiment is selected with the potato virus X (PVX) of the same genus of hosta virus X though and do not belong to that can to infect the arabis mosaic virus (ArMV) of common host plant viral in contrast together.
1, nanometer magnetic bead method is extracted total RNA
(1) acquisition of sample preparation liquid: with reference to the method in embodiment 1 step 3, from having infected hosta virus X(HVX) jade hairpin (Hosta spp.) blade, infected potato virus X (PVX) this life cigarette (Nicotiana benthamiana) blade with infected goosefoot (Chenopodium quinoa) leaf sample of arabis mosaic virus (ArMV), make respectively 3 duplicate samples and prepare liquid.
(2) acquisition of total RNA: with reference to the methods involving in embodiment 1 step 3, from 3 duplicate samples of step (1) gained, prepare liquid and obtain respectively 3 parts of total RNA, to be measured.
2, RT-LAMP amplification
By the reaction system (26 μ L) of the using method preparation (a2) of the RT-LAMP test kit in embodiment 1 step 2, and when reaction proceeds to 15min, and after reaction finishes, according to the standard of (c2), result is judged.Blank (take distilled water as template) and negative control total RNA of healthy jade hairpin (take be template) are set simultaneously.Experiment repeats 3 times.
Result shows, when reaction proceeds to 15min, the reaction solution of hosta virus X reaction tubes starts there is colour-change (by orange to green transition), after reaction finishes, the green of hosta virus X reaction tubes reaction solution is more obvious, specifically as shown in Figure 2, only have 2a(hosta virus X) reaction tubes in occur greenly, be judged to be positive reaction; And 2b(blank), 2c(negative control), 2d(potato virus X) and 2e(arabis mosaic virus) reaction tubes in be shown as orangely, be judged to be negative reaction; Result conforms to expection.Above result shows that the RT-LAMP test kit for detection of hosta virus X of embodiment 1 preparation has good specificity.
Embodiment 3, for detection of the sensitivity analysis of the RT-LAMP test kit of hosta virus X
The present embodiment is analyzed the sensitivity of the RT-LAMP test kit for detection of hosta virus X of embodiment 1 preparation.Specific as follows:
1, nanometer magnetic bead method is extracted total RNA
(1), jade hairpin (Hosta spp.) the leaf sample acquisition of sample preparation liquid: with reference to the method in embodiment 1 step 3, from having infected hosta virus X(HVX), make sample preparation liquid.
(2) acquisition of total RNA: with reference to the methods involving in embodiment 1 step 3, obtain total RNA from the sample preparation liquid of step (1) gained.
2, RT-LAMP amplification
By total RNA(concentration of step 1 gained, be 121ng/ μ l) carry out 10 doubling dilutions, respectively with 10
-1-10
-6totally six dilution total RNA sample liquid are template, prepare the reaction system (25 μ L) of (a1), and carry out, in process, with turbidimeter, reaction solution being carried out to turbidity Real-Time Monitoring in reaction by the using method of the RT-LAMP test kit in embodiment 1 step 2.Negative control (total RNA of take without the jade hairpin of virus infection is template) is set simultaneously.Experiment repeats 3 times.
Result as shown in Figure 3, when being 121ng/ μ l by total RNA(concentration of step 1 gained) carry out (total RNA quality is about 24.2pg) after 10000 times of dilutions, when reaction proceeds to 40min, infected hosta virus X(HVX) the turbidity of reaction solution of jade hairpin (Hosta spp.) the total RNA of blade be 0.4, the visible white precipitate of naked eyes simultaneously.Above result shows that the RT-LAMP test kit for detection of hosta virus X of embodiment 1 preparation has good sensitivity.
Claims (10)
1. detect hosta virus X(Hosta virus X, HVX) loop-mediated isothermal amplification (LAMP) primer group, be primer sets A or primer sets B; Described primer sets A is comprised of primer 1, primer 2, primer 3, primer 4, primer 5 and primer 6; Described primer sets B is comprised of described primer 1, described primer 2, described primer 3 and described primer 4;
The nucleotide sequence of described primer 1, described primer 2, described primer 3, described primer 4, described primer 5 and described primer 6 is respectively sequence 1, sequence 2, sequence 3, sequence 4, sequence 5 and the sequence 6 in sequence table.
2. primer sets according to claim 1, is characterized in that: the mol ratio of primer 1 described in described primer sets A, described primer 2, described primer 3, described primer 4, described primer 5 and described primer 6 is 1:1:8:8:4:4; The mol ratio of primer 1 described in described primer sets B, described primer 2, described primer 3 and described primer 4 is 1:1:8:8.
3. detect hosta virus X(Hosta virus X, HVX) ring mediated isothermal amplification reagent or test kit, it is characterized in that: described reagent or test kit contain primer sets described in claim 1 or 2.
4. reagent according to claim 3 or test kit, is characterized in that: in described reagent or test kit, also comprise fluorescent color-developing agent.
5. reagent according to claim 4 or test kit, is characterized in that: described fluorescent color-developing agent is fluorexon.
Described in claim 1 or 2 in primer sets or claim 3-5 arbitrary described reagent or test kit identify or assistant identification testing sample in whether contain the application in hosta virus X.
7. application according to claim 6, is characterized in that: described testing sample is plant sample or microbiological specimens.
8. identify or assistant identification testing sample in whether contain hosta virus X(Hosta virus X, HVX) method, for following (A) or (B):
(A) comprise following (a1) and step (a2):
(a1) take the total RNA extracting from testing sample is template, with arbitrary described reagent or test kit in primer sets described in claim 1 or 2 or claim 3-5, carries out reverse transcription loop-mediated isothermal amplification;
(a2) according to the amplification of step (a1), determine as follows and in described testing sample, whether contain hosta virus X: if white depositions appears in described testing sample reaction solution, in described testing sample, contain or candidate is contained hosta virus X; Otherwise, described testing sample not containing or candidate do not contain hosta virus X;
(B) comprise following (b1) and step (b2):
(b1) take the total RNA extracting from testing sample is template, with reagent claimed in claim 5 or test kit, carries out reverse transcription loop-mediated isothermal amplification;
(b2) according to the amplification of step (b1), in definite described testing sample, whether contain as follows hosta virus X: if described testing sample reaction solution, for green, contains in described testing sample or candidate is contained hosta virus X; If described testing sample reaction solution is orange, in described testing sample, do not contain or candidate is not contained hosta virus X.
9. method according to claim 8, is characterized in that: described testing sample is plant sample or microbiological specimens.
10. method according to claim 8 or claim 9, is characterized in that: described reverse transcription loop-mediated isothermal amplified reaction is 63 ℃ of isothermal reactions under condition.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310072636.2A CN103131799B (en) | 2013-03-07 | 2013-03-07 | Primer group for detecting plantain lily plant virus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310072636.2A CN103131799B (en) | 2013-03-07 | 2013-03-07 | Primer group for detecting plantain lily plant virus and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103131799A CN103131799A (en) | 2013-06-05 |
| CN103131799B true CN103131799B (en) | 2014-04-16 |
Family
ID=48492247
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310072636.2A Expired - Fee Related CN103131799B (en) | 2013-03-07 | 2013-03-07 | Primer group for detecting plantain lily plant virus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103131799B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102286637B (en) * | 2011-07-21 | 2013-10-16 | 陕西省烟草研究所 | Method for detecting tobacco viruses by reverse transcriptase loop-mediated isothermal amplification (RT-LAMP) technology |
-
2013
- 2013-03-07 CN CN201310072636.2A patent/CN103131799B/en not_active Expired - Fee Related
Also Published As
| Publication number | Publication date |
|---|---|
| CN103131799A (en) | 2013-06-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110938676B (en) | Method, primer group and kit for rapidly detecting yersinia pseudotuberculosis at constant temperature | |
| CN106222263B (en) | LAMP primer composition for detecting pythium ultimum, kit and detection method thereof | |
| CN103290099B (en) | Quick molecular detection kit for colletotrichum kahawae and application thereof | |
| CN105238876B (en) | LAMP primer group and its application method for tobacco ralstonia solanacearum detection | |
| CN102618655A (en) | Loop-mediated isotherm amplification (LAMP) kit for detecting mycoplasma pneumoniae (Mp) | |
| CN102676664B (en) | Fluorescent quantitative polymerase chain reaction (PCR) primers and probes for detecting pathogenic bacteria of multiple aquatic products simultaneously and detection method | |
| CN105219874A (en) | The PSR detection method of Pseudomonas aeruginosa and primer special thereof and test kit | |
| CN103014152A (en) | LAMP (loop-mediated isothermal amplification) primer, kit and detecting method for detecting phytophthora sojae | |
| CN102634580B (en) | Primers and method for simultaneously detecting various pathogenic bacteria | |
| CN102776295A (en) | Kit and method for detecting TYLCV (tomato yellow leaf curl virus) carried by tomato seedlings | |
| Shen et al. | Development of a loop‐mediated isothermal amplification assay for rapid and sensitive detection of Sporisorium scitamineum in sugarcane | |
| Zhang et al. | Rapid visual detection of Japanese hornwort mosaic virus infecting Angelica sinensis by reverse transcription loop‐mediated isothermal amplification | |
| CN104313128A (en) | Loop-mediated isothermal amplification (LAMP)-based method and primer composition for detection of fusarium graminearum | |
| CN111073987B (en) | Rapid constant-temperature detection method, primer group and kit for yersinia enterocolitica | |
| CN103131799B (en) | Primer group for detecting plantain lily plant virus and application thereof | |
| CN111088377B (en) | Rapid constant temperature detection method for staphylococcus aureus, primer set and application | |
| CN104894125B (en) | A kind of RT LAMP kits and its primer special for detecting grape A viruses | |
| CN104711351A (en) | Specific primer combination for detecting streptococcus pyogenes based on loop-mediated isothermal amplification method and application of specific primer combination | |
| CN103952495A (en) | LAMP detection method of mandarin fish infectious spleen and kidney necrosis viruses | |
| CN104404132B (en) | A kind of SS2-LAMP detection kit of streptococcus suis 2-type and application | |
| CN103498011A (en) | Rapid test method for reverse transcription loop-mediated isothermal amplification of turnip mosaic viruses | |
| CN104328189A (en) | Primer combination for detecting Phialophora gregata by loop-mediated isotherm amplification technique and application thereof | |
| CN102140542B (en) | Kit for rapidly detecting potato viruses Y and detection method | |
| CN114107539B (en) | LAMP primer composition for detecting pythium delicicola and application thereof | |
| CN101451165A (en) | Method for detecting chrysanthemum B virus |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20140416 Termination date: 20170307 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |