CN103103264B - Application of SMOC2 gene in preparation of medicine for detecting or treating endometrial cancer and ovarian cancer - Google Patents

Application of SMOC2 gene in preparation of medicine for detecting or treating endometrial cancer and ovarian cancer Download PDF

Info

Publication number
CN103103264B
CN103103264B CN201310016312.7A CN201310016312A CN103103264B CN 103103264 B CN103103264 B CN 103103264B CN 201310016312 A CN201310016312 A CN 201310016312A CN 103103264 B CN103103264 B CN 103103264B
Authority
CN
China
Prior art keywords
smoc2
gene
endometrium
medicine
carcinoma
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CN201310016312.7A
Other languages
Chinese (zh)
Other versions
CN103103264A (en
Inventor
张蓉
张学利
杨广东
朱琳艳
陆欢
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
SHANGHAI FENGXIAN CENTRL HOSPITAL
Original Assignee
SHANGHAI FENGXIAN CENTRL HOSPITAL
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by SHANGHAI FENGXIAN CENTRL HOSPITAL filed Critical SHANGHAI FENGXIAN CENTRL HOSPITAL
Priority to CN201310016312.7A priority Critical patent/CN103103264B/en
Publication of CN103103264A publication Critical patent/CN103103264A/en
Application granted granted Critical
Publication of CN103103264B publication Critical patent/CN103103264B/en
Expired - Fee Related legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Landscapes

  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides application of SMOC2 gene (SPARC related modular calcium binding2, with the Chinese name of secreting modular calcium binding protein 2; smooth muscle related protein 2) in preparation of medicine for detecting or treating endometrial cancer and ovarian cancer. A tissue chip comprising 157 endometrial cancer tissue specimens, 30 normal proliferative phase endometrium tissue specimens and 30 normal secretory phase endometrium tissue specimens is established by utilizing a tissue microarray technology, the expression conditions of SMOC2 in the specimens are detected by utilizing the immunohistochemical technique, the positive expression rate of the SMOC2 in the normal tissue of the endometrium is far lower than the positive expression rate in the endometrial cancer, and the expression intensity is positively correlated to muscular invasion depth of the endometrial cancer and tumor grading of the endometrial cancer. Therefore, the SMOC2 gene can be used for preparing the medicine for detecting or treating endometrial cancer. The medicine is reliable in experimental result and high in repeatability and has good clinical application prospect and good application values and social benefits.

Description

SMOC2 gene detects or treats the application in carcinoma of endometrium and ovarian cancer medicine in preparation
Technical field
The present invention relates to medicine, be specifically related to biological medicament, relate in particular to SMOC2 gene and detect or treat the application in uterine endometrium cancer drug in preparation.
Background technology
Carcinoma of endometrium is one of gynaecology's three large malignant tumours, and sickness rate is in rising trend in recent years, age of onset rejuvenation (KOUJI BANNO etc.
Biomarkers?in?endometrial?cancer:Possible?clinical?applications)。The high risk factor of carcinoma of endometrium has obesity, unpregnancy and infertile, late menopause, diabetes, hypertension etc.The generation of carcinoma of endometrium and estrogenic continuous action have direct relation.Pathogenesis it be unclear that.But can be clear and definite be generation and transfer and the residing environment close relation of tumour cell of carcinoma of endometrium.Research shows, unconventionality expression in collagen protein, ln and acceptor integrin Endometrial Carcinomas thereof, and the adhesion of this unconventionality expression and tumour cell, Invasion and Metastasis, nerve and angiogenesis, immunologic derangement etc. are closely related.SMOC2(SPARC related molular calcium binding2) gene is a kind of extracellular matrix protein, belongs to one of member of acidic secretion protein family (SPARC) of being rich in halfcystine from biochemical character angle.SMOC2 gene has expression in Various Tissues, especially in embryo's generation period and During Wound Healing, has compared with high expression level.SMOC2 gene is the secretory protein that a molecular weight is approximately 50KD left and right, consists of: the signal peptide that 1) comprises 21 amino-acid residues four main structural domains; 2) Yi Ge Kazal district, Kazal type proteinase inhibitor structural domain, is considered to serpin (for example sphaeroprotein spline structure territory) conventionally, has the potential of proteinase inhibitor; 3) two TY structural domains, i.e. I type thyroglobulin tumor-necrosis factor glycoproteins; In function, can suppress cysteine protease activity, and can combine with heparin; 4) two EF-hand calcium lands, its Unknown Function.In function, SMOC2 gene plays very important effect in the maintenance of extracellular matrix assembling and tissue microenvironment stable state.SMOC2 gene has the multi-functionals such as regulating cell migration, adhesion and nerve regeneratl.In addition, SMOC2 gene can also be bred and angiogenic activity by stimulating endothelial cell, and in tumor growth and myocardial ischemia, SMOC2 can be used as the target of controlling vasculogenesis.The CCharacterization of SMOC-2 such as Vannahme, a modular extracellular calcium-binding protein.Biochem is J.2003Aug1; 373 (Pt3): 805-14.
SMOC2 gene may be mainly to realize its adjusting function on tumor microenvironment by following several modes: 1) SMOC2 gene is by regulating the Nomenclature Composition and Structure of Complexes of extracellular matrix to affect the function of various cells in microenvironment; 2) can be by the integrin receptor with cell surface or other nonconformity element acceptor interaction as secretory protein SMOC2 gene, thereby at microenvironment and iuntercellular transmission of signal; 3) SMOC2 gene can also by with cytokine (such as: TGF-β) or its acceptor interaction, thereby cause a series of intracellular signal conduction, finally affect many-sided functions such as tumor cell proliferation, migration, apoptosis.At present, the functional study of SMOC2 gene in growth and disease is also in the starting stage, in the research that adult bone tumour occurs and osseous tissue is rebuild, find recently, SMOC2 gene can with multiple somatomedin (as: PDGF and VEGF) combination, and therefore change its activity, finally affect bone tumor generation and osseous tissue and rebuild (Pazin DE etc.
Developmentalexpression?of?Smoc1?and?Smoc2suggests?potential?roles?in?fetal?gonad?and?reproductive?tract?differentiation.Dev?Dyn.
2009;238(11):2877-2890.
), thereby SMOC2 gene also can be directly and FGF and TGF-β interact and regulate its mediated cell function.(the The widely expressed extracellular matrix protein SMOC-2promotes keratinocyte attachment and migration.Exp Cell Res.2008 such as Maier S; Aug1; 314 (13): 2477-2487.) the .Secreted modular calcium-bindingprotein2haplotypes are associated with pulmonary function.2007 such as Wilk JB; 175 (6): 554-560.)
Separately there are some researches show; the aryl hydrocarbon receptor (Ahr) of activation can be incorporated on SMOC2 gene promoter; thereby in transcriptional expression level regulation and control SMOC2 genetic expression, therefore intervene SMOC2 genetic expression and can regulate microenvironment arene compound to The developmentally-regulated Smoc2gene is repressed by Aryl-hydrocarbon receptor (Ahr) signaling.Gene.2009 such as detrimentally affect ..Liu P that grow; 15:433 (1-2): 72-80.)
SMOC2 gene more and more receives investigator's concern as the regulatory factor of a kind of cell and matrix interphase interaction.But SMOC2 gene is at the middle mechanism of action of gynecological tumor microenvironment, and its special acceptor or interaction protein in microenvironment is still unknown, and especially the function of SOMC2 gene aspect gynecological tumor have not been reported.
Summary of the invention
Technical problem to be solved by this invention is to overcome above-mentioned weak point, the application of research and design SMOC2 gene-correlation pharmacy.
The invention provides the application of SMOC2 gene in pharmacy.
Gene title: SMOC2
Chinese name: secretion modularization calcium binding protein 2; Be called again: unstriated muscle associated protein 2
English name: SMOC2 (SPARC related modular calcium binding2)
Sequence: see sequence table 1(SEQ ID NO.1).
Particularly, the invention provides SMOC2 gene and detect or treat the application in uterine endometrium cancer drug in preparation.
The SMOC2 gene of indication of the present invention comprises the DNA encoding sequence that it is complete, its RNA sequence, its mutant, with and function on active fragment.Need to understand, when the identical amino acid of coding, the replacement of the Nucleotide in codon is acceptable.It is also to be understood that, by Nucleotide replace and produce conservative aminoacid replacement time, the conversion of Nucleotide is also can be received.In the situation that obtained the nucleic acid fragment of SMOC2, can design specific probe according to nucleotide sequence.Nucleotide full length sequence or its fragment can obtain by the method for pcr amplification method, recombination method or synthetic conventionally.For pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.When sequence is longer, usually need to carry out twice or pcr amplification repeatedly, and then the fragment that each time amplified is stitched together by proper order.Once obtain relevant sequence, just can obtain in large quantity relevant sequence with recombination method.This is normally cloned into carrier, then proceeds to cell, then by ordinary method separation from the host cell propagation, obtains relevant sequence.
In addition, also can synthesize relevant sequence by the method for synthetic, especially fragment length more in short-term.Conventionally, by first synthetic a plurality of small segments, and then connect and can obtain the fragment that sequence is very long.
At present, can be completely by chemosynthesis, obtain the DNA sequence dna of code book invention albumen (or its fragment, derivative).Then this DNA sequence dna can be introduced in various existing DNA moleculars as known in the art (or as carrier) and cell.
In the present invention, SMOC2 polynucleotide sequence can be inserted in recombinant expression vector.In a word, as long as can copy in host and stablize, any plasmid and carrier can be used.A key character of expression vector is conventionally to contain replication orgin, promotor, marker gene and translation controlling elements.
Method well-known to those having ordinary skill in the art can be for building containing the DNA sequence dna of SMOC2 and suitable transcribing/the translate expression vector of control signal.These methods comprise extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technology of body etc.Described DNA sequence dna can be effectively connected in the suitable promotor in expression vector, to instruct mRNA synthetic.Conversion carrier also comprises ribosome bind site and the transcription terminator that translation initiation is used.
In addition, expression vector preferably comprises one or more selected markers, to be provided for the phenotypic character of the host cell of selection conversion, as eukaryotic cell is cultivated Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of use, or for colibacillary tsiklomitsin or amicillin resistance.
Comprise above-mentioned suitable DNA sequence dna and the suitable carrier of promotor or control sequence, can be for transforming suitable host cell, with can marking protein.
Host cell can be prokaryotic cell prokaryocyte, as bacterial cell; Or the eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, the bacterial cell of streptomyces; Fungal cell is as yeast; Vegetable cell; Insect cell; Zooblast etc.
After having obtained nucleotide sequence, can design specific dna probe according to nucleotide sequence.The people such as the method for designing probe is this area routine, visible Sambrook, described in molecular cloning laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989).In detection of biological sample, whether exist the exemplary method of SMOC2 albumen or nucleic acid to comprise the biological sample that obtains test subject, make this biological sample contact the nucleic acid probe of the mark that can hybridize with SMOC2mRNA or genomic dna.Other probe for diagnostic test of the present invention is as described herein.
Nucleic acid probe contacts with the flag sequence of amplification.This probe is preferably connected to a kind of chromophoric group, but can be by radio-labeled.In another embodiment, probe is connected on a kind of binding partners, as antibody or vitamin H, or another kind of carry can the binding partners in detection architecture territory on.
In traditional method, detection can be carried out by Southern trace and with the probe hybridization of mark.The related technology of Southern trace is (referring to Sambrook etc., 1989) well-known to those skilled in the art.Conventional detection also has biochip, fluorography technology, cell streaming counting etc.
On the other hand, the present invention also comprises SMOC2DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " refers to that antibody capable is incorporated into SMOC2 gene product or fragment." preferably " refer to that those can be combined with SMOC2 gene product or fragment but nonrecognition and be incorporated into the antibody of other irrelevant antigen molecule.Antibody of the present invention can be prepared by the known various technology of those skilled in that art.
The antibody of anti-SMOC2 albumen can be used in immunohistochemistry technology, detects the SMOC2 albumen in biopsy specimen, can also be as the specific treatment agent that is used for preventing uterine endometrium metastasis of cancer and invasion and attack.
The direct mensuration of SMOC2 in blood sample or urine can be used as the auxiliary diagnosis of tumour and the observation index of prognosis, also can be used as the foundation of early diagnosis of tumor.
Antibody can pass through ELISA, Western engram analysis, or with detection moiety coupling, by methods such as chemoluminescence, isotopic tracings, detect.
The present invention also comprises test kit, to carry out any method described herein.In a unrestriced example, described test kit comprises one or more in these reagent by the vessel form with suitable.Described test kit also can comprise for the reagent of the purifying of RNA separation, amplifying cells RNA, mark etc.
Detection of the present invention or treatment carcinoma of endometrium medicine comprise medicine or the test kit by RT-PCR, PCR, immunodetection, in situ hybridization, genechip detection or treatment carcinoma of endometrium.
The described medicine by RT-PCR detection carcinoma of endometrium at least comprises the primer of a pair of specific amplification SMOC2 gene.
The described medicine by immunodetection detection carcinoma of endometrium comprises antibody, polyclonal antibody and the monoclonal antibody of being combined with SMOC2 protein-specific.
The described medicine by situ hybridization detection carcinoma of endometrium comprises the probe with SMOC2 nucleic acid array hybridizing.
Describedly with genechip detection carcinoma of endometrium medicine, comprise the probe with SMOC2 nucleic acid array hybridizing.
The described test kit for detection of carcinoma of endometrium comprises for the reagent of the purifying of RNA separation, amplifying cells RNA, mark etc.
The component of test kit can or be packed with the form of freeze-drying with the form of water medium.Container suitable in test kit at least comprises a kind of bottle, test tube, flask, PET bottle, syringe or other container conventionally, wherein can place a kind of component, and preferably, can carry out suitably decile.While existing more than a kind of component, in test kit, conventionally also by comprising second, third or other additional container, wherein place discretely additional component in test kit.Yet the component of various combination can be comprised in a bottle.Test kit of the present invention is conventionally also a kind of for holding the container of reactant by comprising, sealing is for commercial distribution.This container can comprise the plastic containers of injection molding or blowing mould, wherein can retain required bottle.
Another object of the present invention has been to provide the application of SMOC2 gene in preparation treatment uterine endometrium cancer drug.
Medicine of the present invention comprises: by RNA, disturb the protein that suppresses the double stranded RNA of SMOC2 genetic expression, tumor vaccine based on SMOC2 antigen protein or suppress SMOC2 protein-active.
Treatment uterine endometrium cancer drug of the present invention can be by oral, skin or the administration of parenteral mode.
Treatment uterine endometrium cancer drug of the present invention can be made the formulations such as oral, suction, injection or suppository by this area routine techniques.
The inventor is by following test:
A, contriver has utilized micro-array tissue technique construction and has comprised 157 cases of endometrial carcinomas, the normal proliferative phase of endometrium of 30 example, the organization chip of the normal secretory endometrium sample of 30 example, and utilize immunohistochemistry technology to detect the expression of SMOC2 in these samples, find SMOC2 in uterus in film healthy tissues positive expression rate far below positive expression rate in Endometrial Carcinomas (16.68%vs73.25%), and SMOC2 expression intensity and the carcinoma of endometrium flesh layer invasion and attack degree of depth (p < 0.0001) and carcinoma of endometrium tumor grade (p=0.0167) are proportionate.
B, according to the above-mentioned experimental result especially analysis of clinical of large sample amount, there is positive connection in biological characteristics and the endometrial carcinoma prognosis of the inventor is verified SMOC2 gene and carcinoma of endometrium.The encoding histone product S MOC2 albumen of this gene, as a kind of secretor type glycoprotein, can be detected in serum, for the early diagnosis of the diseases such as carcinoma of endometrium and prognosis judgement provide a kind of new means.Therefore, SMOC2 gene can be for the preparation of detecting or treatment uterine endometrium cancer drug.
Endometrial Carcinomas cancer of the present invention research and clinical cited field propose to utilize the detection based on SMOC2 gene and product thereof in serum/tissue to reach early diagnosis carcinoma of endometrium or the endometrial carcinoma being treated surgically is carried out to prognosis judgement first.The large sample clinical sample that experiment of the present invention is based upon on the checking of real-time quantitative PCR on gene level and protein level is verified, reliable results, and according to experimental result, no matter SMOC2 is on cell levels or protein level, significantly to distinguish tumour and non-tumour, high-risk tumour and low danger tumour, result reproducible, have and become the potential quality of good clinical exercisable biomarker and good potential applicability in clinical practice, have larger using value and social benefit.
Accompanying drawing explanation
The low differone endometrial carcinoma of Fig. 1 embodiment 1 immunohistochemical staining result (tumor tissues, strong positive)
Differone endometrial carcinoma immunohistochemical staining result (tumor tissues, the positive) in Fig. 2 embodiment 1
Fig. 3 embodiment 1 differentiated carcinoma of endometrium immunohistochemical staining result (tumor tissues, strong positive)
The low differone endometrial carcinoma of Fig. 4 embodiment 1 immunohistochemical staining result (tumor tissues, strong positive)
Fig. 5 embodiment 1 proliferative phase of endometrium immunohistochemical staining result (contrast, feminine gender)
Fig. 6 embodiment 1 is that the mrna expression water gaging of SMOC2 in 5 strain endometrial carcinomas cells is flat, and ordinate zou represents the mrna expression level of SMOC2 in clone, and X-coordinate from left to right represents Endometrial carcinoma cell line AN3CA, Ishikawa, HEC-1A, HEC-1B, KLE successively
The CCK-8 cell proliferation experiment result of endometrial carcinoma cell AN3CA after Fig. 7 SMOC2 disturbs, ● represent that SMOC2 disturbs control group, ■ represents No. 1 interference fragment of SMOC2, No. 2 interference fragments of ▲ expression SMOC2, X-coordinate represent cell generation time (my god), ordinate zou is the OD value detecting at 450nm wavelength place, and after result shows to disturb SMOC2 gene, ability of cell proliferation declines.
Fig. 8 crosses the CCK-8 cell proliferation experiment result of expressing endometrial carcinoma cell HEC-1A after SMOC2, ● represented to express the control group of SMOC2, ■ represented to express the experimental group of SMOC2 gene, X-coordinate represent cell generation time (my god), ordinate zou is the OD value detecting at 450nm wavelength place, and after result shows expression SMOC2 gene, ability of cell proliferation obviously strengthened.
Embodiment
Expression in embodiment 1, SMOC2 Endometrial Carcinomas tissue of patient
Main agents
SMOC2 polyclonal antibody (ab78069) and two anti-Anti-TNF-α rabbit iggs (ab6721) are all purchased from abcam company.
The structure of 1.1 endometrial chip arrays
1.2 immunohistochemical staining
Before 1.4 dyeing, paraffin section is placed in to 80 ℃ of baking ovens and toasts 20 minutes, then press dimethylbenzene 10min, 1/2 dimethylbenzene 10min, 100% alcohol 10min, 95% alcohol 10min, 85% alcohol 10min, 75% alcohol 10min flow process dewaxing.The section that dewaxing is complete is dyeed by following flow process: tap water rinses 5-10min, antigen retrieval 10min after naturally cooling in 37 ℃ of 0.3%H2O2 3min with 1 * PBS, clean after the sealing of 10%BSA room temperature within 1 hour, hatch again 4 ℃ of primary antibodies and spend the night, second day is washed the 3 times anti-incubated at room 1-2h1 of HRP bis-* PBS with 1 * PBS and is cleaned then flowing water flushing 15min brazilwood extract dyeing 30-45s of rear DAB color development 10s, and tap water rinses 5min.Press afterwards 75% alcohol 5min, 85% alcohol 5min, 95% alcohol 5min, 100% alcohol 5min1/2 dimethylbenzene 5min, dimethylbenzene 5min flow process is dewatered, and uses resinene mounting, Microscopic observation after dehydration.
1.4 organization chip result judgements
In micro-Microscopic observation endometrial carcinomas tissue samples, SMO2 expresses dyeing situation, and endometrial sample expression amount is significantly higher than negative control group.(see Fig. 1, positive expression amount is significantly higher than the negative control of Fig. 5 in 2,3,4)
1.5 statistical analysis
Further statistical analysis discovery endometrial is compared with negative control group and is had significant significant difference.(as following table)
Carcinoma of endometrium group and the contrast of control group SMOC2 expression
Embodiment 2
Utilize slow virus interference carrier disturb in Endometrial carcinoma cell line SMOC2 gene and carry out cell function experimental study
SMOC2 gene adopts the complete coding region (open reading frame) of people SMOC2cDNA as goal gene, complete coding region sequence is with the ORF sequence in summary of the invention (NCBI Reference Sequence:NM_022138.2) 1374bp, and the albumen of coding is asked for an interview sequence table 1(SEQ ID NO.1).
2.1 main agents
Endometrial carcinoma cell line HEC-1A, HEC-1B, RL-952, AN3CA, Ishikawa is purchased from Chinese Academy of Sciences's cell bank, and cell culture medium and foetal calf serum are all purchased from Gibco company, and SMOC2 gene RNA disturbs Lentiviral purchased from Shanghai JiMa pharmacy Technology Co., Ltd.RNA extraction agent RNAiso Plus is purchased from precious biotechnology company limited, reverse transcription test kit High Capacity cDNA Reverse Transcription Kits is purchased from Invitrogen company, and PCR kit for fluorescence quantitative Power SYBR Green PCR Master Mix is purchased from Invitrogen company.SMOC2 gene and house-keeping gene 18S primer are synthesized by Shanghai Sangon Biological Engineering Technology And Service Co., Ltd.
2.2 application real time fluorescence quantifying PCR methods detect the expression amount of SMOC2 in five strain Endometrial carcinoma cell lines
2.2.1. cell cultures: five strain endometrial carcinomas cells, are cultivated in the incubator of 5%CO2 in 37 ℃ with the foetal calf serum containing 10%, treat that cell covers with extraction cell total rna.
2.2.2. cell total rna extracting:
Homogenate is transferred in centrifuge tube to standing 5 minutes of room temperature.12,000g4 ℃ centrifugal 5 minutes.The careful supernatant liquor of drawing, moves in new centrifuge tube.The chloroform that adds 1/5 volume of RNAiso Plus, thermal agitation 15 seconds, after solution is fully emulsified, more standing 5 minutes of room temperature, 12,000g4 ℃ is centrifugal 15 minutes.Drawing supernatant liquor is transferred in another new centrifuge tube.In supernatant, add isopyknic Virahol, after the centrifuge tube that turns upside down fully mixes, at 15~30 ℃ standing 10 minutes.12,000g4 ℃ centrifugal 10 minutes.Supernatant discarded, adds 75% ethanol l ml along tube wall, the washing centrifuge tube tube wall that turns upside down, and 12,000g4 ℃ discards ethanol after centrifugal 5 minutes.Drying at room temperature precipitation 2~5 minutes, measures RNA concentration and purity with Nanodrop2000 after adding appropriate RNase-free water dissolution precipitation.
2.2.3. reverse transcription synthesizes cDNA
2.2.4Real-time?PCR
By following component preparation PCR reaction solution (reaction solution is formulated on ice and carries out).
Two-step approach is carried out PCR reaction, with 7300Real-Time PCR System,
PCR detects the primer:
F:AGTTACCCCAACGCGAAG
R:CTCTTGGTCACAGGATGACAC
Derived data, Realtime PCR result is analyzed by 2-△ △ CT method.Utilize Graphad Prism Software on Drawing to go out the chart (experimental result is as Figure 10, shown in 11) of SMOC2 expression level in 5 strain endometrial carcinomas cells.
2.3SMOC2 gene RNA disturbs the endometrial carcinomas cell strain HEC-1A of the low expression of SMOC2 over-express vector transfection SMOC2 for the endometrial carcinomas cell AN3CA of lentiviral vectors transfection SMOC2 high expression level
Utilize SMOC2 gene RNA Gan Rao ∕ to cross expression Lentiviral and three packaging plasmid (GAG, REV, VSV) while cotransfection 293T cell, in cell, carry out viral packing, packaged pseudovirion is secreted in extracellular substratum, and centrifuging obtains the infection that can be used for host cell after supernatant liquor, after goal gene enters into host cell, through reverse transcription, be incorporated into genome, thereby play the function of related gene expression.Utilize tetracycline to screen metainfective cell, cell extraction RNA after screening, reverse transcription is that cDNA utilizes fluorescence quantitative PCR detection SMOC2 Gan Rao ∕ to cross expression efficiency, found that the jamming effectiveness of two fragments wherein, more than 70%, crosses and express more than 100 times.
The 2.4 dry ∕ of disturbing carry out cell proliferation experiment (CCK8) after crossing expression SMOC2
Proliferation experiment: choose SMOC2 Gan Rao ∕ in clone and cross two fragments that expression efficiency is higher as experimental group, the cell of transfection empty carrier as a control group, carries out cell counting, by cell kind in 96 orifice plates, 2000, every hole cell, adds 100ul training liquid, respectively at 0,24, within 48,72 hours, add 10ulCCK8 solution cell culture incubator to hatch after 1 hour and detect by microplate reader, selected 450nm wavelength is measured absorbance, disposal data is depicted as broken line graph (as Fig. 7, shown in 8)
(1) SMOC2 disturbs the CCK-8 cell proliferation experiment result (as shown in Figure 7) of rear endometrial carcinoma cell AN3CA
By upper figure experimental result can find out endometrial carcinomas cell AN3CA disturb SMOC2 gene after multiplication capacity decline.
(2) cross the CCK-8 cell proliferation experiment result (as shown in Figure 8) express endometrial carcinoma cell HEC-1A after SMOC2
By upper figure experimental result can see appear express SMOC2 gene after endometrial carcinomas cell HEC-1A multiplication capacity strengthen.

Claims (12)

1.SMOC2 gene detects the application in uterine endometrium cancer drug in preparation, it is characterized in that, described SMOC2 gene order is SEQ ID NO.1.
2. application according to claim 1, is characterized in that, described detection carcinoma of endometrium medicine comprises the medicine by PCR, immunodetection, in situ hybridization, gene chip diagnosis endometrial carcinomas.
3. application according to claim 2, is characterized in that, described detection uterine endometrium cancer drug is the medicine by RT-PCR diagnosis endometrial carcinomas.
4. application according to claim 1, is characterized in that, described in be applied as the test kit of PCR, immunodetection, in situ hybridization, gene chip diagnosis endometrial carcinomas for preparation.
5. application according to claim 4, is characterized in that, described in be applied as preparation with RT-PCR, diagnosis endometrial carcinomas test kit.
6. application according to claim 2, is characterized in that, the described medicine by PCR detection carcinoma of endometrium at least comprises the primer of a pair of specific amplification SMOC2 gene.
7. application according to claim 3, is characterized in that, the described medicine by RT-PCR detection carcinoma of endometrium at least comprises the primer of a pair of specific amplification SMOC2 gene.
8. application according to claim 2, is characterized in that, the described medicine by immunodetection carcinoma of endometrium comprises antibody or the polyclonal antibody of being combined with SMOC2 protein-specific.
9. application according to claim 8, is characterized in that, the described medicine by immunodetection carcinoma of endometrium comprises the monoclonal antibody of being combined with SMOC2 protein-specific.
10. application according to claim 2, is characterized in that, the described medicine by situ hybridization detection carcinoma of endometrium comprises the probe with SMOC2 nucleic acid array hybridizing.
11. application according to claim 2, is characterized in that, the described pharmaceutical pack for detection of carcinoma of endometrium is containing the reagent of purifying or the SMOC2 gene of mark separated for RNA, amplifying cells RNA.
The application of 12.SMOC2 gene in preparation treatment uterine endometrium cancer drug, is characterized in that, described SMOC2 gene order is SEQ ID NO.1.
CN201310016312.7A 2013-01-16 2013-01-16 Application of SMOC2 gene in preparation of medicine for detecting or treating endometrial cancer and ovarian cancer Expired - Fee Related CN103103264B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201310016312.7A CN103103264B (en) 2013-01-16 2013-01-16 Application of SMOC2 gene in preparation of medicine for detecting or treating endometrial cancer and ovarian cancer

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201310016312.7A CN103103264B (en) 2013-01-16 2013-01-16 Application of SMOC2 gene in preparation of medicine for detecting or treating endometrial cancer and ovarian cancer

Publications (2)

Publication Number Publication Date
CN103103264A CN103103264A (en) 2013-05-15
CN103103264B true CN103103264B (en) 2014-09-10

Family

ID=48311454

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201310016312.7A Expired - Fee Related CN103103264B (en) 2013-01-16 2013-01-16 Application of SMOC2 gene in preparation of medicine for detecting or treating endometrial cancer and ovarian cancer

Country Status (1)

Country Link
CN (1) CN103103264B (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN106119357B (en) * 2016-06-29 2019-09-10 北京泱深生物信息技术有限公司 Application of the TNS11 in preparation diagnosis and treatment carcinoma of endometrium product
CN110387420B (en) * 2019-08-26 2020-11-13 武汉艾米森生命科技有限公司 Kit for endometrial cancer diagnosis and application
CN112578123B (en) * 2019-09-27 2022-10-25 成都中医药大学 Application of reagent for detecting content of calprotectin in preparation of uterine lesion screening kit
CN113122627B (en) * 2019-12-30 2023-08-11 广州医科大学附属第三医院(广州重症孕产妇救治中心、广州柔济医院) Application of IGFL4 gene as marker in diagnosis and treatment of ovarian cancer

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011107586A1 (en) * 2010-03-05 2011-09-09 Novartis Forschungsstiftung, Zweigniederlassung, Friedrich Miescher Institute For Biomedical Research, Smoc1, tenascin-c and brain cancers

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
Activation of SPARC expression in reactive stroma associated with human epithelial ovarian cancer;Brown TJ,et al;《Gynecol Oncol》;19991231;第75卷;25-33 *
Brown TJ,et al.Activation of SPARC expression in reactive stroma associated with human epithelial ovarian cancer.《Gynecol Oncol》.1999,第75卷25-33.
Characterization of SMOC-2, a modular extracellular calcium-binding protein;Vannahme C et al;《Biochem J》;20031231;第373卷;805-14 *
Maier S et al.The widely expressed extracellular matrix protein SMOC-2 promotes keratinocyte attachment and migration.《Exp Cell Res》.2008,第314卷(第13期),2477-87.
Rocnik EF,et al.The novel SPARC family member SMOC-2 potentiates angiogenic growth factor activity.《J Biol Chem》.2006,第281卷(第32期),22855-64.
SPARC在子宫内膜癌组织中的表达及意义;王蕾等;《现代生物医学进展》;20110331;第11卷(第5期);905-908 *
The novel SPARC family member SMOC-2 potentiates angiogenic growth factor activity;Rocnik EF,et al;《J Biol Chem》;20060811;第281卷(第32期);22855-64 *
The widely expressed extracellular matrix protein SMOC-2 promotes keratinocyte attachment and migration;Maier S et al;《Exp Cell Res》;20080831;第314卷(第13期);2477-87 *
VannahmeCetal.CharacterizationofSMOC-2 a modular extracellular calcium-binding protein.《Biochem J》.2003
王蕾等.SPARC在子宫内膜癌组织中的表达及意义.《现代生物医学进展》.2011,第11卷(第5期),905-908.

Also Published As

Publication number Publication date
CN103103264A (en) 2013-05-15

Similar Documents

Publication Publication Date Title
CN108486159B (en) CRISPR-Cas9 system for knocking out GRIN2D gene and application thereof
An et al. EGFL6 promotes breast cancer by simultaneously enhancing cancer cell metastasis and stimulating tumor angiogenesis
US9802994B2 (en) Composition for preventing or treating fracture or osteoporosis using slit-robo system
CN103103264B (en) Application of SMOC2 gene in preparation of medicine for detecting or treating endometrial cancer and ovarian cancer
KR20120051258A (en) A composition comprising gastrokine 1 for anti-cancer
Li et al. FGA controls VEGFA secretion to promote angiogenesis by activating the VEGFR2-FAK signalling pathway
CN111500587A (en) Application of PGR (platelet-rich protein) as product for treating endometriosis and PGR detection kit
Lu et al. Downregulation of PDGF-D inhibits proliferation and invasion in breast cancer MDA-MB-231 cells
CN112867495A (en) Gastric cancer therapeutic composition comprising SYT11 inhibitor as active ingredient
Lawson et al. Increased expression of interleukin-1 receptor type 1 in active endometriotic lesions
Medeiros et al. HMGA gene rearrangement is a recurrent somatic alteration in polypoid endometriosis
Hou et al. HMGB1 positive feedback loop between cancer cells and tumor-associated macrophages promotes osteosarcoma migration and invasion
CN109468380A (en) IL1R2 is in Prognosis in Breast Cancer assessment and the application in targeted therapy
CN105648076B (en) The diagnosis and treatment target of NUDT11 gene and its expression product as fibroid
Markowska et al. Leptin and leptin receptor expression in the myometrium and uterine myomas: is leptin involved in tumor development?
CN111850123A (en) PCR reagent for detecting gene expression of cell angiogenesis signal pathway and application thereof
CN113929764B (en) Breast phylliform tumor molecular marker CD146 and application thereof
Iwasaki et al. E1AF/PEA3 reduces the invasiveness of SiHa cervical cancer cells by activating serine proteinase inhibitor squamous cell carcinoma antigen
CN105400894A (en) Intervertebral disc degenerative change diagnosis and treatment marker
CN103525941A (en) Application of CTHRC1 genes in preparation of drugs for detecting/treating cervical cancer
CN103083686B (en) Application of DKK4 gene and coding protein thereof in preparation of medicament
CN109097358A (en) A kind of lncRNA is preventing or is treating the application in hypertension
CN113293208B (en) Molecular marker related to lung cancer proliferation and metastasis and application thereof
CN115381949A (en) Application of targeted inhibition of pigment epithelium derived factor in promotion of liver regeneration and improvement of liver injury
CN106540259A (en) Cytoskeleton regulates and controls the application in cancerous cell in the expression of S100A7, S100A8 and S100A9 by YAP

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
CF01 Termination of patent right due to non-payment of annual fee
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20140910

Termination date: 20180116