CN103074427A - Target gene and kit for detecting Bartonella vinsonii subsp. berkhoffii - Google Patents
Target gene and kit for detecting Bartonella vinsonii subsp. berkhoffii Download PDFInfo
- Publication number
- CN103074427A CN103074427A CN201310005476XA CN201310005476A CN103074427A CN 103074427 A CN103074427 A CN 103074427A CN 201310005476X A CN201310005476X A CN 201310005476XA CN 201310005476 A CN201310005476 A CN 201310005476A CN 103074427 A CN103074427 A CN 103074427A
- Authority
- CN
- China
- Prior art keywords
- bartonella
- vincent
- subspecies
- hough
- primer
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a target gene for detecting Bartonella vinsonii subsp. berkhoffii, the nucleotide sequence of the target gene is shown in SEQ ID NO. 1, the invention provides real-time fluorescent quantitative polymerase chain reaction (PCR) primers and a probe, and the nucleotide sequences of the primers and the probe are shown in SEQ ID NO. 2, SEQ ID NO. 3 and SEQ ID NO. 4. The invention further provides a kit for detecting the Bartonella vinsonii subsp. berkhoffii. The detection method and the kit thereof, provided by the invention have the advantages of accurate detection, high sensitivity, strong specificity, simplicity, convenience and quickness, reach the lowest detection limit of 11 copies per PCR, and have excellent detection capability on clinical specimens.
Description
Technical field
The present invention relates to biology field, particularly relate to for detection of the target gene of the rich lattice Hough subspecies of Vincent Bartonella and primer and the probe that detects this gene, the invention still further relates to and utilize this primer and probe to carry out the test kit that the rich lattice Hough subspecies of Vincent Bartonella detect.
Background technology
The Vincent Bartonella is won lattice Hough subspecies (Bartonella vinsonii subsp.berkhoffii, Bvb) be a kind of gram negative bacilli that can cause the diseases such as dog endocarditis, purpura hepatitis, myocarditis and granulomatous poradenolymphitis, also can cause people's endocarditis and nervous system disorders etc.1993, this bacterium at first separated from one and suffers from endocarditic sick dog, is newfound Amphixenosis pathogenic bacteria in the Bartonella.
The rich lattice Hough subspecies (Bvb) of Vincent Bartonella have the common trait of Bartonella bacterium, the difficult cultivation, to culture condition have relatively high expectations, incubation time is long.At present, domestic and international detection method to this bacterium mainly is that separation and Culture, indirect immunofluorescence (IFA) detect serum antibody and conventional PCR detects nucleic acid molecule.Although isolation cultivation method can obtain directly to infect evidence, but because the rich lattice Hough subspecies of Vincent Bartonella are difficult to cultivate, poor growth, the again restriction because sample is drawn materials, culture success ratio is lower, is not suitable for quick diagnosis, examination and epidemiology survey.In the Serology test, usually use in the world the IFA method and detect Bartonella antibody, some is planted such as Chinese match Bartonella and trench fever Bartonella commercially available detection kit, only there is the Individual testwas chamber to carry out abroad for the rich lattice Hough subspecies of Vincent Bartonella, and use full bacterium and have cross reaction as detectable antigens, the interpretation of IFA method has certain subjectivity in addition, is not easy to promote the use of with the result compare.Although conventional PCR has avoided the defective of above-mentioned two class methods, the susceptibility of method and may existing is polluted and must not be irrespective problem.
Fluorescence quantifying PCR method is day by day popularized on the transmissible disease cause of disease detects because its highly sensitive, level of automation advantages of higher can address the above problem well, therefore is necessary to set up fluorescence quantifying PCR method and detects the rich lattice Hough subspecies of Vincent Bartonella.At present, there is not yet the report of using the rich lattice Hough subspecies of TaqMan fluorescence probe quantitative PCR method detection Vincent Bartonella both at home and abroad.
Summary of the invention
First purpose of the present invention is to be provided for detecting the target gene of the rich lattice Hough subspecies of Vincent Bartonella.
Second purpose of the present invention is to provide Auele Specific Primer and the probe for above-mentioned target gene;
The 3rd purpose of the present invention is to provide the test kit that detects the rich lattice Hough subspecies of Vincent Bartonella.
Based on above purpose, the present invention use the 3S primer (S15:5 '-GGAGGGTGTT-3 ', S18:5 '-CCACAGCAGT-3 ', S103:5 '-AGACGTCCAC-3 ') amplification Vincent Bartonella is won the Bartonella genomes such as lattice Hough subspecies, the F that finds Bvb is with on other Bartonella correspondence positions without amplified band, in NCBI comparison discovery and its similarity maximum after the order-checking is trench fever Bartonella (B.quintana, Bq) argF(78%), other also have Lindsey Graham Bartonella (B.grahamii, Bg) and Te Liboqi Bartonella (B.tribocorum, Bt) (67%).
The present invention is directed to conservative gene sequence (shown in the SEQID NO.1) design primer and the TaqMan probe of the rich lattice Hough subspecies of Vincent Bartonella, and the Auele Specific Primer and the probe that obtain compared at ncbi database, the non-specific coupling that may exist to get rid of primer-probe and other species sequences, primer, probe sequence after final acquisition is optimized.
Preferred primer sequence provided by the invention is:
Upstream primer: CACACAACCCCATATCTCATTCG,
Downstream primer: CATGCTGTATCGGCTATGGTTTT.
The probe sequence sequence is:
FAM-CACACACCAGCTTTG-MGB。
The invention provides the real-time fluorescence quantitative PCR detection method of the rich lattice Hough subspecies of a kind of Vincent Bartonella, comprise take sample total DNA as template, utilize primer provided by the invention and probe to carry out real-time fluorescence quantitative PCR, set up simultaneously without template contrast and positive control, according to the amplification curve result of determination.
The invention provides a kind of test kit for detection of the rich lattice Hough subspecies of Vincent Bartonella, it comprises above-mentionedly can amplify nucleotide sequence or the Auele Specific Primer of its specific fragment and the Taqman probe that cooperates primer to use shown in SEQ ID NO.1 specifically.
The primer sequence of test kit of the present invention is:
Upstream primer: CACACAACCCCATATCTCATTCG,
Downstream primer: CATGCTGTATCGGCTATGGTTTT.
The probe sequence sequence is:
FAM-CACACACCAGCTTTG-MGB。
Test kit provided by the invention also can further comprise dna cleavage liquid, the fluorescent quantitation reaction solution, and negative template and positive template, described negative template is distilled water, described positive template is the rich lattice Hough subspecies genomic dna of Vincent Bartonella.
Test kit of the present invention, its 20 μ L total working system is:
Its working routine is 95 ℃ of denaturation 30sec, 1 circulation; 95 ℃ of sex change 5sec, 55 ℃ of annealing 15sec, 72 ℃, 10sec, 40 circulations.
The present invention also provides the diagnostic reagent that contains above-mentioned primer and probe.
Must set up negative control and positive control when the present invention detects sample at every turn, when two kinds of contrasts were effectively amplification in detection, the sample results judging criterion was as follows:
Cq value＜35.0 o'clock sample result is positive;
The sample result of Cq value 〉=40.0 is negative;
The Cq value is between 35.0 ~ 40.0 the time, and sample needs repetition, and revision test such as Cq value still are lower than 40 and are judged to be positive amplification, surpass 40 and are judged to be negative amplification.
The present invention chooses the distinctive one section nucleotide sequence design special primer of the rich lattice Hough subspecies of Vincent Bartonella and probe, utilizes novel MGB probe technique to set up the fluorescence quantifying PCR method that detects this bacterium.
The fluorescence quantifying PCR method of the rich lattice Hough subspecies of the detection Vincent Bartonella that the present invention sets up is the detections that first fluorescent probe applied to the rich lattice Hough subspecies of Vincent Bartonella.The present invention is according to the rich one section distinctive gene order designing probe of lattice Hough subspecies of Vincent Bartonella and primer, the respectively reaction density of annealing temperature, probe and the primer of optimized expansion reaction; Analyze specificity, susceptibility and the repeatability of this method; The drawing standard curve, amplification efficiency and the stability of assessment PCR reaction.The result shows that designed TaqMan-MGB probe has kind of a horizontal specificity; Minimum detectability is 11 copies of each PCR reaction; The variation coefficient CV value of organizing between interior and group is respectively 0.12%～0.70% and 0.14%～0.55%, in allowed band; Good (the R of typical curve linear relationship
2=1), amplification efficiency high (E=104.7%).Therefore, can detect the rich lattice Hough subspecies of Vincent Bartonella according to what experimental data showed that this research sets up in the horizontal specificity of kind, highly sensitive based on the fluorescence quantifying PCR method of TaqMan-MGB probe technique and based on the detection kit of the method, for the researchs such as Rapid﹠Early diagnosis, monitoring and epidemiology survey of the caused a series of diseases of this Bartonella provide effective means.
Description of drawings
Figure 1A is the amplification curve of different primers concentration, and 1,2,3,4 represent different primers concentration among the figure, are respectively 200nmol/L, 300nmol/L, 400nmol/L, 500nmol/L.
Figure 1B is the amplification curve of different probe concentration, and 1,2,3,4,5,6 represent different probe concentration among the figure, are respectively 40nmol/L, 100nmol/L, 200nmol/L, 300nmol/L, 400nmol/L, 500nmol/L.
Fig. 2 A is the rich lattice Hough subspecies TaqMan-MGB fluorescence probe quantitative PCR specificity result of Vincent Bartonella.
Fig. 2 B is the rich lattice Hough subspecies TaqMan-MGB fluorescence probe quantitative PCR specificity result of Vincent Bartonella.
Fig. 3 is different extent of dilution standard plasmid amplification curves, and the different extent of dilution plasmids of 1,2,3,4,5 representatives are respectively 10 among the figure
4, 10
3, 10
2, 10 times of extent of dilution and negative controls.
Fig. 4 is the quantitative fluorescent PCR canonical plotting, with logarithm and the mapping of Cq value of 10 * serial dilution standard plasmid.
Fig. 5 is plasmid standard fluorescent quantitative PCR graphic representation.
Fig. 6 is for using 3S primer (S15,10-mer; S18,10-mer; S103,10-mer) amplification Bartonella the RAPD collection of illustrative plates, #M is dna molecular amount standard among the figure, # is blank.
Fig. 7 A is Q22DC upstream primer sequencer map, and terminal black background sequence is the downstream primer sequence among the figure.
Fig. 7 B is Q22DC downstream primer sequencer map, and terminal black background sequence is the upstream primer sequence among the figure.
Embodiment
Following examples further specify content of the present invention, but should not be construed as limitation of the present invention.Without departing from the spirit and substance of the case in the present invention, modification or replacement to the inventive method, step or condition are done all belong to scope of the present invention.
If do not specialize, the conventional means that used technique means is well known to those skilled in the art among the embodiment.The reagent and the instrument that use among the embodiment are as follows: Bole (BioRad) CFX96 quantitative real time PCR Instrument, table model high speed centrifuge Eppendorf centrifuge5804R, nucleic acid concentration determinator NanoDrop-1000.QIAamp DNA Mini Kit(QIAGEN), pEASY-T1 Cloning Kit, TransStart Probe qPCR SuperMix are available from the Beijing Quanshijin Biotechnology Co., Ltd; Premix Ex Taq
TM(Probe qPCR) is available from precious biotechnology (Dalian) company limited;
QPCR Master Mix is available from Promega company; Plasmid extraction kit is available from new industry Bioisystech Co., Ltd of Beijing section of holding up.
The biomaterial of selecting in the embodiment of the invention is as follows: the Bartonella genomic dna comprises: the Vincent Bartonella is won lattice Hough subspecies ATCC 51672(Bvb), Chinese match Bartonella (B.henselae, Bh) ATCC 49882, trench fever Bartonella (B.quintana, Bq) ATCC VR-358, Ke Shi Bartonella (B.clarridgeiae, Bc) ATCC 51734, gram is strangled Bartonella (B.koehlerae, Bk) ATCC 700693, bacillus sample Bartonella (B.bacilliformis, Bb) ATCC 35685, Vincent Bartonella A Lupan subspecies (B.vinsonii subsp.arupensis, Bva) ATCC 700727, Vincent Bartonella Vincent subspecies (B.vinsonii subsp vinsonii, Bvv) ATCC VR-152, Elizabethan's Bartonella (B.elizabethae, Be) ATCC 49927, Lindsey Graham Bartonella (B.grahamii, Bg) ATCC 700132, road will Bartonella (B.doshiae, Bd) ATCC700133, Te Liboqi Bartonella (B.tribocorum, Bt) CIP 105476 and Vincent Bartonella are won lattice Hough subspecies laboratory isolated strains Q52SHD, Q80SHD, Q106SHD, Q109SHD, Q132SHD, Q151SHD; Agrobacterium tumefaciens (Agrobacterium tumefaciens); People, cat, dog, mouse, tick and flea genomic dna are Inst of Infection Disease Prevention and Control, Chinese Diseases Prevention an medium biological control chamber and preserve.Other bacterial genomes DNA comprises Bacillus brucellae (Brucella species), Neisseria meningitidis (Neisseria meninyitidis), streptococcus pneumoniae (Streptococcus pneumoniae), hemophilus influenzae (Haemophilus influenzae), campylobacter jejuni (Campylobacterjejuni), helicobacter pylori (Helicobacter pylori), bacillus canalis capsulatus (Klebsiellapneumoniae), Corynebacterium diphtheriae (Salmonella typhi), Salmonella typhimurtum (Salmonellatyphimurium), shigella flexneri (Shigella flexneri), legionella pneumophilia (Legionella pneumophila), intestinal bacteria (Escherichia coli), vibrio cholerae (Vibrio cholerae), Rickettsia prowazeki (Rickettsia prowazekii), R. massillia (R.massilliae), Japan's rickettsia (R.japonica), Anaplasma phagocytophila (Anaplasma phagocytophilum), Orientia Tsutsugamushi (Orientiatsutsugamushi), yersinia pestis (Yersinia pestis EV76), mycobacterium tuberculosis (Mycobacterium tuberculosis), Acinetobacter bauamnnii (Acinetobacterbaumanii), streptococcus aureus (Staphyloccocus aureus), Leptospira (Leptospira interrogans), and Borrelia burgdoyferi (Bolrelia burgdorferi), being Inst of Infection Disease Prevention and Control, Chinese Diseases Prevention an provides.
Determining of the rich lattice Hough subspecies specific DNA sequence of embodiment 1 Vincent Bartonella
The present invention use the 3S primer (S15:5 '-GGAGGGTGTT-3 ', S18:5 '-CCACAGCAGT-3 ', S103:5 '-AGACGTCCAC-3 ') amplification Vincent Bartonella is won the Bartonella genomes such as lattice Hough subspecies, the F that finds Bvb is with on other Bartonella correspondence positions without amplified band, see Fig. 6, in NCBI comparison discovery and its similarity maximum after the order-checking is trench fever Bartonella (B.quintana, Bq) argF(78%), other also have Lindsey Graham Bartonella (B.grahamii, Bg) and Te Liboqi Bartonella (B.tribocorum, Bt) (67%).As seen the F carries gene of the Bvb of the rich lattice Hough subspecies of Vincent Bartonella has high degree of specificity, and process is to recovery and the order-checking of F with amplified production, and its nucleotide sequence is shown in SEQ ID NO.1.Can be used for distinguish the rich lattice Hough subspecies of Vincent Bartonella with other bacteriums of Bartonella.
The design of the rich lattice Hough subspecies Auele Specific Primer of embodiment 2 Vincent Bartonellas and probe
The present invention is through repeated screening and checking; obtain target gene (nucleotide sequence is shown in SEQ ID NO.1) for embodiment 1 and obtain a pair of fluorescence quantification PCR primer for detection of the rich lattice Hough subspecies of Vincent Bartonella and the TaqMan probe that is used in conjunction with primer, synthetic by (upper sea base health biotech firm) company.
The primer sequence that the present invention obtains is:
Upstream primer: CACACAACCCCATATCTCATTCG,
Downstream primer: CATGCTGTATCGGCTATGGTTTT.
The probe sequence sequence is: FAM-CACACACCAGCTTTG-MGB.
The structure of the rich lattice Hough subspecies target gene quantitative fluorescent PCR plasmid standard of embodiment 3 Vincent Bartonellas
Take the upstream and downstream primer of embodiment 2 as primer, the DNA of Bvb reference culture ATCC 51672 is template, amplifying target genes 119bp; The PCR product is cut and is connected on the pEASY-T carrier after glue reclaims purifying; Carrier imports DH5 α competent cell after will connecting, and screening positive clone with extracting plasmid after PCR, the sequence measurement checking, is measured concentration, as the standard substance of drawing the quantitative PCR typical curve.Plasmid is stored in respectively-20 ℃ and-70 ℃ with the positive bacteria that contains recon.
Measuring plasmid concentration is 47.7ng/ μ L, and the base number of pEASY-T carrier is 3928bp, and the molecular-weight average of each base is 660D/bp, and the plasmid molecule amount is (3928+119) * 660=2.67 * 10
6, according to formula copy number concentration (copy/μ L)=(quality/molecular weight) * 6.02 * 10
23Calculating copy number concentration is 1.08 * 10
10Copy/μ L.
The preparation of typical curve: by 10 * doubling dilution, make concentration reach 1.08 * 10 plasmid stoste
9～1.08 * 10
3Copy/μ L carries out quantitative PCR, does simultaneously 3 parallel sample.According to the concentration logarithmic value drawing standard curve of Cq value and standard plasmid, its coefficient R
2Be 1.000 (Y=-3.214X+41.95), amplification efficiency E presents good linear relationship (Fig. 4, Fig. 5) between 104.7%, Cq value and the concentration.
Adopt primer and the probe of embodiment 2, Vincent Bartonella in embodiment 3 is won lattice Hough subspecies genomic dna as template, with the positive contrast of plasmid standard that embodiment 3 makes, with the negative contrast of free nucleic acid distilled water, set up the fluorescence quantitative PCR detection system.
Its 20 μ L total working system is:
Its working routine is: 95 ℃ of denaturation 30sec, 1 circulation; 95 ℃ of sex change 5sec, 55 ℃ of annealing 15sec, 72 ℃, 10sec, 40 circulations.
After amplification finishes, get same analysis of threshold data behind the deduction background fluorescence signal, determine Cq (being the Ct value, the cycle threshold) value of each sample.
Must set up negative control and positive control during each detection sample, when two kinds of contrasts were effectively amplification in detection, the sample results judging criterion was as follows:
Cq value＜35.0 o'clock sample result is positive;
The sample result of Cq value 〉=40.0 is negative;
The Cq value is between 35.0 ~ 40.0 the time, and sample needs repetition, and revision test such as Cq value still are lower than 40 and are judged to be positive amplification, surpass 40 and are judged to be negative amplification.
Embodiment 5 detects the optimization of the fluorescent quantitative PCR detection method reaction conditions of the rich lattice Hough subspecies of Vincent Bartonella
1, the optimized choice of annealing temperature
Take positive control dna as template, 51 ℃ ~ 62 ℃ are carried out the gradient quantitative PCR, screen optimum annealing temperature.
When annealing temperature was 51.0 ℃, 51.7 ℃, 53.2 ℃, 55.3 ℃, 58.0 ℃, 60.2 ℃, the Cq value was respectively 19.39,19.36,19.34,19.32,19.35,19.43, and fluorescent signal is stronger when 51.7 ℃, 53.2 ℃ and 55.3 ℃.Consider and select 55.3 ℃ of Cq value minimum, the temperature when fluorescent signal is the strongest, for the handled easily annealing temperature is decided to be 55 ℃.
2, the optimized choice of probe and primer concentration
Difference immobilized primer and concentration and probe concentration, probe and primer reaction density are respectively 40nmol/L, 100nmol/L, 200nmol/L, 300nmol/L, 400nmol/L, 500nmol/L and 200nmol/L, 300nmol/L, 400nmol/L, 500nmol/L, select optimum probe and primer concentration according to the cycle threshold (Cq) of amplified reaction and the fluorescence signal intensity of amplification curve, establish 3 hole Duplicate Samples and detect.
When concentration and probe concentration was 500nmol/L, the Cq value was minimum, fluorescent signal is strong, and repeated experiments result is stable, therefore selection 500nmol/L is concentration and probe concentration (Figure 1A).
When the primer reaction density was 500nmol/L, the Cq value was minimum, fluorescent signal is strong, and repeated experiments result is stable, is primer reaction density (Figure 1B) therefore select 500nmol/L.
The evaluating characteristics of the rich lattice Hough subspecies fluorescent quantitative PCR detection method of embodiment 6 Vincent Bartonellas
1, Evaluation on specificity
Claiming again the evaluation of true negative rate in fact, namely is not the rich lattice Hough subspecies of Vincent Bartonella, and correctly is judged to the per-cent of the rich lattice Hough subspecies of non-Vincent Bartonella according to the standard of this detection method.The concentration of the non-Bartonella bacterium such as Bvb, other kinds Bartonella, Bacillus brucellae and Agrobacterium tumefaciens and dog, cat, people, mouse, tick, flea genomic dna is adjusted to about about 1-10ng/ μ L, and delivery plate 1 μ L carries out quantitative PCR detection according to the method for embodiment 4.The Vincent Bartonella that embodiment 3 makes is won the positive contrast of lattice Hough subspecies genomic dna plasmid standard, the Bvb bacterial strain amplification of as a result Bvb reference culture and laboratory separation is all positive, the nucleic acid samples of other kinds Bartonella such as Bva, Bvv and Chinese match Bartonella and the non-Bartonella bacteriums such as Bacillus brucellae, Agrobacterium tumefaciens and intestinal bacteria detects and is showed no fluorescent signal, amplification is all negative, blank NTC negative (seeing Fig. 2 A and Fig. 2 B).The specificity that the real-time fluorescence TaqMan PCR method of the rich lattice Hough subspecies of detection Vincent Bartonella of the present invention is described is 100%.
The biomaterial of selecting in the present embodiment is as follows: the Bartonella genomic dna comprises: the Vincent Bartonella is won lattice Hough subspecies ATCC 51672(Bvb), Chinese match Bartonella (B.henselae, Bh) ATCC 49882, trench fever Bartonella (B.quintana, Bq) ATCC VR-358, Ke Shi Bartonella (B.clarridgeiae, Bc) ATCC 51734, gram is strangled Bartonella (B.koehlerae, Bk) ATCC 700693, bacillus sample Bartonella (B.bacilliformis, Bb) ATCC 35685, Vincent Bartonella A Lupan subspecies (B.vinsonii subsp.arupensis, Bva) ATCC 700727, Vincent Bartonella Vincent subspecies (B.vinsonii subsp vinsonii, Bvv) ATCC VR-152, Elizabethan's Bartonella (B.elizabethae, Be) ATCC 49927, Lindsey Graham Bartonella (B.grahamii, Bg) ATCC 700132, road will Bartonella (B.doshiae, Bd) ATCC 700133, Te Liboqi Bartonella (B.tribocorum, Bt) CIP105476 and Vincent Bartonella are won lattice Hough subspecies laboratory isolated strains Q52SHD, Q80SHD, Q106SHD, Q109SHD, Q132SHD, Q151SHD; The genomic dna of people (human), cat (cat), dog (dog), mouse (rodent), tick (tick) and flea (flea) is Inst of Infection Disease Prevention and Control, Chinese Diseases Prevention an medium biological control chamber and preserves, and above bacterial strain, people, animal and medium genomic dna are applied to Fig. 2 A.Other bacterial genomes DNA comprises Bacillus brucellae (Brucella species), Agrobacterium tumefaciens (Agrobacterium tumefaciens), Neisseria meningitidis (Neisseriameninyitidis), streptococcus pneumoniae (Streptococcus pneumoniae), hemophilus influenzae (Haemophilus influenzae), campylobacter jejuni (Campylobacter jejuni), helicobacter pylori (Helicobacter pylori), bacillus canalis capsulatus (Klebsiellapneumoniae), Corynebacterium diphtheriae (Salmonella typhi), Salmonella typhimurtum (Salmonellatyphimurium), shigella flexneri (Shigella flexneri), legionella pneumophilia (Legionella pneumophila), intestinal bacteria (Escherichia coli), vibrio cholerae (Vibrio cholerae), Rickettsia prowazeki (Rickettsia prowazekii), R. massillia (R.massilliae), Japan's rickettsia (R.japonica), Anaplasma phagocytophila (Anaplasma phagocytophilum), Orientia Tsutsugamushi (Orientiatsutsugamushi), yersinia pestis (Yersinia pestis EV76), mycobacterium tuberculosis (Mycobacterium tuberculosis), Acinetobacter bauamnnii (Acinetobacterbaumanii), streptococcus aureus (Staphyloccocus aureus), Leptospira (Leptospira interrogans), and Borrelia burgdoyferi (Bolrelia burgdorferi), above strain gene group DNA is applied to Fig. 2 B.
2, sensitivity evaluation
The Bvb standard plasmid (1.08 * 10 that embodiment 3 is made
10Copy/μ L) makes 10 * doubling dilution, get respectively the standard plasmid (1.08 * 10 after 1 μ L dilutes
9～1.08 * 10
0Copy/μ L) carries out quantitative PCR for template according to the method for embodiment 4, the minimum sandards plasmid copy number that analysis can detect, the i.e. susceptibility of method.Result's demonstration, minimum detectable concentration is 1.08 * 10
1Copy/μ L, i.e. each reaction needs 11 copies, and good amplified signal all appears in above each the concentration plasmid of detection line, and blank (NTC) does not have amplified signal (Fig. 3).
3, reproducibility
In with a quantitative PCR reaction, each extent of dilution standard plasmid is done 3 repeating holes, with difference in the analysis bank; Carry out respectively independent repeated experiments 3 times with above-mentioned the same terms, analyze group difference, calculate Cq value variation coefficient CV value to verify the stability of the method.The CV value is between 0.12%～0.70% between each hole in the group, and replication CV value, illustrates that the inventive method is stable all in the reasonable scope between group between 0.14%～0.55%, and standard operation can be realized the good reproducibility (table l) of data.
Table 1 TaqMan-MGB fluorescence probe quantitative PCR detects the rich lattice Hough subspecies repeatability of Vincent Bartonella
The rich lattice Hough subspecies of Vincent Bartonella detect in the clinical application effect of embodiment 7 the inventive method and the checking dog blood sample
Use DNeasy Blood ﹠amp; Tissue Kit(QIAGEN company, the U.S.) extract 47 parts of dog blood complete genome DNAs that are collected in Dongcheng District, Beijing (DC) and Xicheng District (XC), utilize primer and the probe of embodiment 2 designs to carry out quantitative fluorescent PCR, 4 parts of blood genomic dnas produce fluorescent signal (seeing Table 2).Choose the amplified production that is numbered Q22DC and Q5XC in the positive check order (Beijing section of holding up new industry Bioisystech Co., Ltd), sequence and Vincent Bartonella be rich, and lattice Hough subspecies reference culture is consistent (sees Fig. 7 A, Fig. 7 B), confirm that the positive purpose band that detects is the rich lattice Hough subspecies of Vincent Bartonella really.
The rich lattice Hough subspecies TaqMan-MGB fluorescence probe quantitative PCR detected result of Vincent Bartonella in the table 2 dog blood
Although, above used general explanation, embodiment and test, the present invention is described in detail, on basis of the present invention, can make some modifications or improvement to it, and this will be apparent to those skilled in the art.Therefore, these modifications or improvements all belong to the scope of protection of present invention without departing from theon the basis of the spirit of the present invention.
Claims (10)
1. the target gene for detection of the rich lattice Hough subspecies (Bartonella vinsoniisubsp.berkhoffii) of Vincent Bartonella is characterized in that, its nucleotide sequence is shown in SEQ IDNO.1.
2. the Auele Specific Primer for detection of the rich lattice Hough subspecies of Vincent Bartonella is characterized in that, its amplified production is the described target gene of claim 1.
3. Auele Specific Primer as claimed in claim 2 is characterized in that, its nucleotides sequence is classified as:
Upstream primer: 5 '-CACACAACCCCATATCTCATTCG-3 ',
Downstream primer: 5 '-CATGCTGTATCGGCTATGGTTTT-3 '.
4. the fluorescent probe that is used in conjunction with claim 2 or 3 described Auele Specific Primers.
5. fluorescent probe as claimed in claim 4, its nucleotides sequence is classified as:
FAM-CACACACCAGCTTTG-MGB。
6. the test kit that contains claim 2 or 3 described primers and/or claim 4 or 5 described probes.
7. test kit as claimed in claim 6, it is characterized in that, also comprise: dna cleavage liquid, fluorescent quantitation reaction solution, negative template, positive template, described negative template is distilled water, described positive template is the rich lattice Hough subspecies genomic dna of Vincent Bartonella.
8. test kit as claimed in claim 6 is characterized in that, its 20 μ L total working system is:
9. test kit as claimed in claim 6 is characterized in that, its working routine is: 95 ℃ of denaturation 30sec, 1 circulation; 95 ℃ of sex change 5sec, 55 ℃ of annealing 15sec, 72 ℃, 10sec, 40 circulations.
10. the diagnostic reagent that contains claim 2 or 3 described primers and/or claim 4 or 5 described probes.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310005476.XA CN103074427B (en) | 2013-01-07 | 2013-01-07 | Target gene and kit for detecting Bartonella vinsonii subsp. berkhoffii |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310005476.XA CN103074427B (en) | 2013-01-07 | 2013-01-07 | Target gene and kit for detecting Bartonella vinsonii subsp. berkhoffii |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103074427A true CN103074427A (en) | 2013-05-01 |
| CN103074427B CN103074427B (en) | 2014-10-08 |
Family
ID=48151120
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310005476.XA Expired - Fee Related CN103074427B (en) | 2013-01-07 | 2013-01-07 | Target gene and kit for detecting Bartonella vinsonii subsp. berkhoffii |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103074427B (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104087661A (en) * | 2014-06-17 | 2014-10-08 | 中国疾病预防控制中心传染病预防控制所 | Method for detecting B. bacilliformis by uxing TaqMan real-time fluorescence quantification PCR |
| CN104789657A (en) * | 2015-03-23 | 2015-07-22 | 中国疾病预防控制中心传染病预防控制所 | Method for detecting bartonella elizabethae with TaqMan real-time fluorescent quantitative PCR |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102312006A (en) * | 2011-09-28 | 2012-01-11 | 中国疾病预防控制中心传染病预防控制所 | Bartonella henselae PCR identification method |
-
2013
- 2013-01-07 CN CN201310005476.XA patent/CN103074427B/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102312006A (en) * | 2011-09-28 | 2012-01-11 | 中国疾病预防控制中心传染病预防控制所 | Bartonella henselae PCR identification method |
Non-Patent Citations (2)
| Title |
|---|
| MARIA B. CADENAS ET AL: "molecular characterization of bartonella vinsonii subsp. berkhoffii genotype III", 《JOURNAL OF CLINICAL MICROBIOLOGY》 * |
| 姚美琳等: "巴尔通体荧光定量PCR检测方法的建立", 《中国热带医学》 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104087661A (en) * | 2014-06-17 | 2014-10-08 | 中国疾病预防控制中心传染病预防控制所 | Method for detecting B. bacilliformis by uxing TaqMan real-time fluorescence quantification PCR |
| CN104789657A (en) * | 2015-03-23 | 2015-07-22 | 中国疾病预防控制中心传染病预防控制所 | Method for detecting bartonella elizabethae with TaqMan real-time fluorescent quantitative PCR |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103074427B (en) | 2014-10-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Chi et al. | Molecular differentiation of Treponema pallidum subspecies in skin ulceration clinically suspected as yaws in Vanuatu using real-time multiplex PCR and serological methods | |
| CN102747144B (en) | Triplex real-time fluorescence PCR detection primers, probes, detection kit and detection method for three bacterial | |
| CN102947467A (en) | Assays and kits for serotyping pseudomonas aeruginosa and oligonucleotide sequences useful in such methods and kits | |
| CN105779625B (en) | It is a kind of to detect that Streptococcus suis is universal and streptococcus suis 2-type double fluorescent quantitative PCR primer, kit and method simultaneously | |
| CN102230013A (en) | Target sequence, primer, probe and kit for detecting Mycoplasma pneumonia | |
| CN102268478A (en) | Primers, probe, method and kit for detecting campylobacter jejuni | |
| CN109234419A (en) | Bacillus anthracis double fluorescent quantitative PCR detection kit and detection method | |
| CN102559905A (en) | Primer probes and probe for real-time fluorescent polymerase chain reaction (PCR) detection of Mycobacterium Tuberculosis and using method of primer probes | |
| CN104232783B (en) | Quick detection method for cow brucella attenuated vaccine strain A19 | |
| CN104059975A (en) | Providencia O3, O4, O8, O12, O13 and O20 specific nucleotides and application thereof | |
| CN103074427B (en) | Target gene and kit for detecting Bartonella vinsonii subsp. berkhoffii | |
| CN103993090B (en) | To Providence O31, O41, O42, the nucleotides that O43 and O50 are special and application thereof | |
| CN103060447B (en) | Triple real-time fluorescent PCR testing primers of four kinds of bacterium, probe, detection kit and detection method | |
| CN108411014A (en) | Differentiate the primer and probe and detection method of A types and the dual real-time fluorescence quantitative PCR of Type B ox pasteurella multocida | |
| CN102634605A (en) | Method for detecting egg drop syndrome viruses and kit for method | |
| CN104946769A (en) | Kit for rapid detection and genotyping of mycoplasma pneumoniae | |
| CN109735645B (en) | Real-time fluorescent PCR (polymerase chain reaction) primer, probe and kit for detecting Sporothrix globosum | |
| CN107236793A (en) | A kind of Corynebacterium sp. bacteria and kirschner corynebacteria multiple fluorescence quantitative PCR primer, probe, kit and detection method | |
| CN104087661B (en) | TaqMan real-time fluorescence quantitative PCR detects the method for bacillus sample Bartonella | |
| CN104789657A (en) | Method for detecting bartonella elizabethae with TaqMan real-time fluorescent quantitative PCR | |
| CN109337995A (en) | The PCR detection method and kit of bacillus tularense and its subspecies | |
| CN101831508A (en) | Quantitative detection method of tea-geometrid-type polyhedrosis viruses | |
| CN102134594B (en) | Primer and probe sequences and method for detecting Bacillus anthracis, Yersinia pestis and legionella pneumophilia through multiple real-time fluorescence polymerase chain reaction (PCR) | |
| CN105256041A (en) | Specific nucleotide for aeromonas hydrophila O44, O24, O25 and O28 and application thereof | |
| CN111676300A (en) | Fluorescent quantitative PCR method for detecting toxigenic chlamydia pneumoniae and corresponding kit |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20141008 Termination date: 20180107 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |