CN103074419A - Biological chip based general probe method for detecting nucleic acid degradation group mRNA - Google Patents
Biological chip based general probe method for detecting nucleic acid degradation group mRNA Download PDFInfo
- Publication number
- CN103074419A CN103074419A CN2012103715740A CN201210371574A CN103074419A CN 103074419 A CN103074419 A CN 103074419A CN 2012103715740 A CN2012103715740 A CN 2012103715740A CN 201210371574 A CN201210371574 A CN 201210371574A CN 103074419 A CN103074419 A CN 103074419A
- Authority
- CN
- China
- Prior art keywords
- biochip
- general
- nucleic acid
- probe
- detection
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a biological chip based general probe method for detecting a nucleic acid degradation group mRNA. The method comprises the following steps: 1) predicting a target nucleic acid degradation group mRNA that can be degraded by a small molecular RNA through a bioinformatical method; 2) providing a detection probe, wherein part of the nucleic acid sequence of the detection probe is complementary with a general report probe, and the other part of the nucleic acid sequence is at least complementary with a nucleic acid sequence at a fracture of the target nucleic acid degradation group mRNA; 3) fixing the detection probe on a biochip substrate to form a biological chip; 4) mixing an RNA of a sample to be detected and the general report probe together with a hybridization liquid for hybridization with the biological chip; and 5) washing the biological chip after hybridization, and detecting hybridization results. The invention can detect mRNA degradation products of a small molecular RNA mediated target gene in high throughput, and verify a large amount of target genes predicted by bioinformatics, and has advantages of convenient operation, benefit for promotion, low price, and high cost performance.
Description
Technical field
The present invention is specifically related to a kind of general probe detection method for the detection of nucleolysis group, belongs to nucleic acid molecule detection technique field,
Background technology
The little RNA(small non-protein-coding of endogenous non-coding RNA, 12-24nt, be called for short " little RNA ") extensively be present in high and the unicellular lower eukaryote body in, by target gene mRNA directly being excised or suppressing its translation and transcribing and post-transcriptional level plays regulating effect to genetic expression.Known little RNA mainly is divided into two large classes: a class is Microrna (miRNA, microRNA), and a class is siRNA (siRNA, small interfering RNA).Consult Fig. 1, Mirnas of plant, siRNA and Some Animals miRNA, siRNA are mainly by carrying out fully or be close to match completely to form silencing complex RISC (RNA-induced silencing complex) with target gene mRNA, thereby degraded target gene mRNA also regulates and control its expression, and lot of experimental data shows that the target gene fracture of microRNA mediation occurs in the complementation district with mRNA, mainly occurs between the tenth, 11 of corresponding microRNA sequence 5 ' end.Conventional target gene is searched main employing bioinformatics method and is predicted and screen in full genomic level.Because Forecasting Methodology can't be distinguished the true and false of prediction target gene, all predict the outcome must be through experiment confirm, therefore still need adopt the laboratory facilities of various inside and outsides, such as Northern hybridization, improvement 5'RACE method (modified 5'-rapid amplification of cDNA ends), the target gene of prediction is verified one by one.This is much time power not only, has also affected widely the exploration efficient of target gene.
Nearly two during the last ten years, and based on systems biology (system biology) the research develop rapidly of high throughput analysis, various " group is learned (omics) " research is constantly expanded.Nowadays scientists can be promoted to the extensive and accurately efficient stage to traditional biological study from small-scale, inefficient pattern by various detection meanss.Detect for above-mentioned microRNA target gene, the detection method of a kind of degraded group order-checking (degradome sequencing) occurred in 2008, also be referred to as the terminal parallel analysis method (parallel analysis of RNA ends) of RNA.It adopts high throughput sequencing technologies, target gene mRNA shear degradation fragment to the microRNA mediation is carried out degree of depth sequencing analysis, the target gene of screening microRNA effect from the result, and in conjunction with bioinformatic analysis, determine the accurate unpaired message of degradation fragment and microRNA.The method is compared with other traditional means of experiment, and confidence level and detection flux all are improved.But the cost that nowadays checks order is higher, because different tissues small molecular rna expression is different, the degraded situation of its target gene mRNA is also different, and is then expensive as several samples is detected.In addition, the fragment that present high-flux sequence obtains is shorter, and sequence need repeatedly be spliced, and introduces easily mistake.In addition, the multiple microRNA target gene Forecasting Methodology that has developed, order-checking can not verify one by one that to predicting the outcome of these methods the omission that causes easily target gene to detect greatly reduces the cost performance that the degraded group checks order.
Conventional mrna expression spectrum chip can obtain the expression of each gene mRNA in the different tissues, therefore also can obtain the expression of the microRNA target gene of Bioinformatics Prediction, and also have some laboratories to adopt chip of expression spectrum to come the target gene of preliminary screening microRNA.But the mrna expression situation that chip of expression spectrum obtains might not be relevant with the target gene mRNA degraded of microRNA mediation, it expresses the regulation and control that also may be subject to other approach, therefore still can't distinguish the true and false by the microRNA target gene of chip of expression spectrum screening, still need to adopt the laboratory facilities of small throughput to verify, neither the high throughput identification microRNA Perfected process of target gene mRNA degraded of mediation.
Summary of the invention
The object of the invention is to for deficiency of the prior art, the general probe method of a kind of detection nucleolysis group mRNA based on biochip is provided.
For achieving the above object, the present invention has adopted following technical scheme:
The general probe method of a kind of detection nucleolysis group mRNA based on biochip comprises the steps:
1) adopts bioinformatics method, the target nucleic acid degraded group mRNA that prediction may be degraded by microRNA;
2) provide detection probes, a part of nucleotide sequence of described detection probes and general reporter probe are complementary, another part nucleotide sequence at least with the nucleic acid array complementation of described target nucleic acid degraded group mRNA breaking part part;
3) described detection probes is fixed on the biochip matrix, forms biochip;
4) RNA of sample to be detected and general reporter probe are sneaked into together in the hybridization solution and described biochip hybridization;
5) biochip after the washing hybridization detects results of hybridization.
As one of preferred scheme, described detection probes length is 18-42mer, and wherein the nucleotide sequence length with general reporter probe complementary portion is 3-12mer, with the nucleotide sequence length of the breaking part complementary portion of nucleolysis group mRNA be 15-30mer.
As one of preferred scheme, in the described detection probes with a part of nucleotide sequence next-door neighbour of general reporter probe complementation and another part nucleotide sequence of the breaking part complementation of described target nucleic acid degraded group mRNA.
Further, be designed with one group of probe cell corresponding to each target nucleic acid degraded group mRNA in the method, each group probe cell comprises a plurality of detection probes, wherein the possible broken site of corresponding each the target nucleic acid degraded group mRNA of each detection probes.
As one of preferred scheme, each group probe cell comprises 20 above detection probes.
Further, described detection probes is synthesized by original position and/or chemical bond connection mode is fixed on the biochip matrix, and described chemical bond connection mode is selected from any one in amino-aldehyde radical reaction, electrostatic adhesion and the covalent cross-linking at least.
Further, the end that is connected with biochip matrix of described detection probes (3 ' or 5 ' end) is modified with amino, sulfydryl, carboxyl or vitamin H.
Further, described general reporter probe is selected from DNA, RNA, PNA(peptide nucleic acid(PNA) at least) and LNA (locked nucleic acids) in any one.
Further, described general reporter probe is away from being useful on the tagged molecule whether general reporter probe of indication and detection probes react with detection probes complementary is terminal modified, for example, the known vitamin H of those skilled in the art, digoxin, fluorescent mark, quantum dot, gold grain, nano particle etc.
Further, described sample rna to be detected is selected from any one in total RNA sample and the little RNA sample of enrichment at least.
Compared with prior art, the invention has the advantages that: can be high-throughout the target gene mRNA degraded product of detection microRNA mediation, can to by Bioinformatics Prediction to a large amount of target genes verify, and easy and simple to handle, the non-specialised staff also can operate, be beneficial to popularization, cheap, be a kind of detection method that is used for microRNA target gene degradation fragment of high performance-price ratio.
Description of drawings
Fig. 1 is the schematic diagram of miRNA degraded target gene mRNA;
Fig. 2 is the process flow sheet of general probe method that the present invention is based on the detection nucleolysis group mRNA of biochip;
Fig. 3 is the detected result of the target gene XM_002297667 of ptr-miR159f in the embodiment of the invention 1.
Embodiment
The general probe detection method that the present invention aims to provide a kind of high-throughput, detects for microRNA target gene degradation fragment cheaply.
Further say, technical scheme of the present invention comprises: a kind of general probe detection method that the nucleolysis group detects that is used for based on base stacking hybridization is provided, its possible broken site by the nucleic acid mRNA that will be degraded by microRNA is placed on base stacking and makes use, detect the fluorescent signal of the detection probes of different broken sites, only have in the general reporter probe sequence in the detection probes and broken site next-door neighbour's situation, general reporter probe is just hybridized with this detection probes, can detect the accurate location of degraded nucleic acid broken site.
Aforesaid base stacking hybridization (base stacking hybridization, BSH), be also referred to as to close on and pile up hybridization (contiguous stacking hybridization, CSH), refer to that the duplex structure of formation is unsettled when the oligonucleotide strand of a weak point is hybridized with complementary DNA/RNA long-chain; If but have another with it adjacent oligonucleotide strand also with the DNA/RNA long-chain hybridization of complementation, so because the accumulation between these two adjacent bases of short oligonucleotide strand, the stability of this duplex structure can improve greatly.Occur redundancy, disappearance or the mispairing of base between these two adjacent short oligonucleotide strands, the base stacking effect will be hindered, and just can't form stable duplex structure.
As one of typical embodiments of the present invention, consult Fig. 2, this general probe method based on the detection nucleolysis group mRNA of biochip comprises the steps:
1) adopts bioinformatics method, the target nucleic acid degraded group mRNA that prediction may be degraded by microRNA;
2) provide detection probes, a part of nucleotide sequence of described detection probes and general reporter probe are complementary, another part nucleotide sequence at least with the nucleic acid array complementation of described target nucleic acid degraded group mRNA breaking part part;
3) described detection probes is fixed on the biochip matrix, forms biochip;
4) RNA of sample to be detected and general reporter probe are sneaked into together in the hybridization solution and described biochip hybridization;
5) biochip after the washing hybridization detects results of hybridization.
Below in conjunction with some preferred embodiments technical scheme of the present invention is further described.
Embodiment 1Utilize the candidate's target gene of ptr-miR159f in the growth of the inventive method checking willow adventive root and with target gene interactional broken site information occurs.
Further say, present embodiment relates to whether the candidate's target gene (willow genome database accession number: EF146531, XM_002297667, XM_002304786) that utilizes the inventive method identification of organism information science to predict is that the ptr-miR159f(miRNA sequence is in the indefinite development of root of willow, 5 '-3 ': consult SEQ ID NO:65) target gene, and the site of definite its effect.Concrete detection method may further comprise the steps:
1) Design ﹠ preparation of DNA detection probe: the DNA detection probe sequence of three kinds of candidate's target genes is following (5 '-3 ') respectively:
Wherein carry out amido modified with the fixing sound end (5 ' end) of biochip stromal surface, " TGCGACCT " and general reporter probe (5 '-3 ': TACGACAT, 5 ' end carries out Cy3 and modifies) reverse complemental, " AAAAAAAAAA " can make hybridization sequences and chip surface keep certain distance, reduces space steric effect.The DNA detection probe fixing with biochip matrix need be formulated in (0.1 M yellow soda ash-sodium bicarbonate buffer liquid+1.5 M trimethyl-glycines+10% DMSO) in the sampling liquid, and final concentration is 10 uM.
2) preparation of detection chip: the DNA detection probe is arrived on the aldehyde group modified slide (that is, biochip matrix) of optics according to dot pattern point system, afterwards slide is fixed 12 hours in 28 ℃ wet box.Then fully wash slide with 0.1% SDS solution, place on the shaking table 200 rpm to clean 10 minutes.Slide is immersed in the middle sealing of sodium borohydride solution (5 * SSC+10% ethanol+1.3% sodium borohydride) cleans with distilled water after 10 minutes, 2000 rpm dried slide in centrifugal 1 minute, made biochip.
3) preparation of biological sample to be detected: the blade of processing with DEPC is the adventive root tissue of 3-5 cm from the willow tissue cultured seedling cutting-out length of cultivating 1 month, places the centrifuge tube of 1.5 mL, at once puts into the liquid nitrogen quick-frozen.Adopt Total RNA Purification Kit(Norgen, Canada) extract the adventive root total tissue RNA that includes little RNA.With Nanodrop ND-1000 uv-spectrophotometric detection by quantitative total rna concentration, detect total RNA quality with the sex change agarose gel.
4) chip hybridization: the total RNA sample ligand of 2 ug that will extract is set to the hybridization buffer of 50 uL, wherein contains the general reporter probe, 3 * SSC of 10 nM and 0.2% SDS solution, and solvent is DEPC water.Afterwards hybridization solution is added on the biochip of making detection probes, the sealing hybridizing box, and in hybrid heater 42 ℃ hybridization 18 hours.
5) washing of chip: open hybridizing box, biochip is transferred on the staining rack that is positioned in advance 5 * SSC+0.1% SDS rinsing liquid (30 ℃) rinsing 6 minutes of fully vibrating.Then, staining rack is transferred to the middle rinsing of 0.2 * SSC rinsing liquid (25 ℃) 2 times, each 3 minutes together with biochip.2000 rpm dried biochip in centrifugal 1 minute afterwards.
6) chip data analysis: scan with LuxScan 10K microarray scanner (CapitoBio, China), parameter is Power=95; PMT=800, scan channel are 532 nm wavelength.The software LuxScan 3.0 that image after the scanning adopts scanner to carry carries out the extraction of chip signal data, adopts OriginPro 8.0 softwares to data analysis.The biochip data results shows, inspection probe P12-XM_67(target gene is XM_002297667) signal value (strength of signal is greater than 1000) be significantly higher than background signal (strength of signal is about 200), the signal value of all the other probes is near background signal (strength of signal is about 200).Thereby draw, accession number is that the gene of XM_002297667 is the target gene of ptr-miR159f, and the sequence in broken site downstream is: TCACTCCAATATTCAGAAACT, by relatively drawing of broken site sequence and corresponding miRNA sequence: broken site occurs in and ptr-miR159f mutually between the tenth, 11 of pairing.
7) result verification: for proof test result's accuracy, adopted the high-throughput degraded group sequence measurement that smart to cut location miRNA shearing site.In a large amount of sequencing result data, remove the joint sequence at two ends, by with genomic data relatively, obtain 7 same, and the sequence relevant with ptr-miR159f target gene XM_002297667: (sequence information is referring to SEQ ID NO:64)).By relatively drawing of broken site sequence and corresponding miRNA sequence: broken site occurs in and ptr-miR159f mutually between the tenth, 11 of pairing, and the result is consistent with said chip.
Embodiment shown in more than explanation reaches on drawing can not resolve the design philosophy surely of the present invention that is limited.Holding the identical the knowledgeable of knowing in technical field of the present invention can be with technical thought of the present invention with various form improvement change, and such improvement and change are interpreted as belonging in protection scope of the present invention.
＜110〉Suzhou Institute of Nano-tech. and Nano-bionics, Chinese Academy of Sciences
＜120〉a kind of general probe detection method that the nucleolysis group detects that is used for based on base stacking hybridization
<160> 65
<210> 1
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 1
AAAAAAAAAAATTGGACTTCAAGGAGCTCCATGCGACCT
<210> 2
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 2
AAAAAAAAAATATTGGACTTCAAGGAGCTCCTGCGACCT
<210> 3
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 3
AAAAAAAAAACTATTGGACTTCAAGGAGCTCTGCGACCT
<210> 4
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 4
AAAAAAAAAATCTATTGGACTTCAAGGAGCTTGCGACCT
<210> 5
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 5
AAAAAAAAAATTCTATTGGACTTCAAGGAGCTGCGACCT
<210> 6
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 6
AAAAAAAAAACTTCTATTGGACTTCAAGGAGTGCGACCT
<210> 7
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 7
AAAAAAAAAAGCTTCTATTGGACTTCAAGGATGCGACCT
<210> 8
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 8
AAAAAAAAAAAGCTTCTATTGGACTTCAAGGTGCGACCT
<210> 9
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 9
AAAAAAAAAAGAGCTTCTATTGGACTTCAAGTGCGACCT
<210> 10
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 10
AAAAAAAAAAGGAGCTTCTATTGGACTTCAATGCGACCT
<210> 11
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 11
AAAAAAAAAAAGGAGCTTCTATTGGACTTCATGCGACCT
<210> 12
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 12
AAAAAAAAAACAGGAGCTTCTATTGGACTTCTGCGACCT
<210> 13
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 13
AAAAAAAAAAGCAGGAGCTTCTATTGGACTTTGCGACCT
<210> 14
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 14
AAAAAAAAAAAGCAGGAGCTTCTATTGGACTTGCGACCT
<210> 15
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 15
AAAAAAAAAACAGCAGGAGCTTCTATTGGACTGCGACCT
<210> 16
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 16
AAAAAAAAAACCAGCAGGAGCTTCTATTGGATGCGACCT
<210> 17
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 17
AAAAAAAAAACCCAGCAGGAGCTTCTATTGGTGCGACCT
<210> 18
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 18
AAAAAAAAAAACCCAGCAGGAGCTTCTATTGTGCGACCT
<210> 19
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 19
AAAAAAAAAATACCCAGCAGGAGCTTCTATTTGCGACCT
<210> 20
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 20
AAAAAAAAAACTACCCAGCAGGAGCTTCTATTGCGACCT
<210> 21
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 21
AAAAAAAAAATCTACCCAGCAGGAGCTTCTATGCGACCT
<210> 22
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 22
AAAAAAAAAAATTGGAGTGAAGGGAGCTCCATGCGACCT
<210> 23
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 23
AAAAAAAAAATATTGGAGTGAAGGGAGCTCCTGCGACCT
<210> 24
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 24
AAAAAAAAAAATATTGGAGTGAAGGGAGCTCTGCGACCT
<210> 25
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 25
AAAAAAAAAAAATATTGGAGTGAAGGGAGCTTGCGACCT
<210> 26
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 26
AAAAAAAAAAGAATATTGGAGTGAAGGGAGCTGCGACCT
<210> 27
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 27
AAAAAAAAAATGAATATTGGAGTGAAGGGAGTGCGACCT
<210> 28
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 28
AAAAAAAAAACTGAATATTGGAGTGAAGGGATGCGACCT
<210> 29
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 29
AAAAAAAAAATCTGAATATTGGAGTGAAGGGTGCGACCT
<210> 30
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 30
AAAAAAAAAATTCTGAATATTGGAGTGAAGGTGCGACCT
<210> 31
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 31
AAAAAAAAAATTTCTGAATATTGGAGTGAAGTGCGACCT
<210> 32
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 32
AAAAAAAAAAGTTTCTGAATATTGGAGTGAATGCGACCT
<210> 33
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 33
AAAAAAAAAAAGTTTCTGAATATTGGAGTGATGCGACCT
<210> 34
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 34
AAAAAAAAAACAGTTTCTGAATATTGGAGTGTGCGACCT
<210> 35
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 35
AAAAAAAAAATCAGTTTCTGAATATTGGAGTTGCGACCT
<210> 36
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 36
AAAAAAAAAAATCAGTTTCTGAATATTGGAGTGCGACCT
<210> 37
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 37
AAAAAAAAAAAATCAGTTTCTGAATATTGGATGCGACCT
<210> 38
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 38
AAAAAAAAAAAAATCAGTTTCTGAATATTGGTGCGACCT
<210> 39
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 39
AAAAAAAAAATAAATCAGTTTCTGAATATTGTGCGACCT
<210> 40
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 40
AAAAAAAAAACTAAATCAGTTTCTGAATATTTGCGACCT
<210> 41
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 41
AAAAAAAAAACCTAAATCAGTTTCTGAATATTGCGACCT
<210> 42
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 42
AAAAAAAAAAACCTAAATCAGTTTCTGAATATGCGACCT
<210> 43
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 43
AAAAAAAAAAATTGGAGTGAAGGGAGCTCAATGCGACCT
<210> 44
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 44
AAAAAAAAAATATTGGAGTGAAGGGAGCTCATGCGACCT
<210> 45
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 45
AAAAAAAAAAATATTGGAGTGAAGGGAGCTCTGCGACCT
<210> 46
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 46
AAAAAAAAAACATATTGGAGTGAAGGGAGCTTGCGACCT
<210> 47
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 47
AAAAAAAAAAGCATATTGGAGTGAAGGGAGCTGCGACCT
<210> 48
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 48
AAAAAAAAAATGCATATTGGAGTGAAGGGAGTGCGACCT
<210> 49
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 49
AAAAAAAAAACTGCATATTGGAGTGAAGGGATGCGACCT
<210> 50
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 50
AAAAAAAAAATCTGCATATTGGAGTGAAGGGTGCGACCT
<210> 51
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 51
AAAAAAAAAATTCTGCATATTGGAGTGAAGGTGCGACCT
<210> 52
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 52
AAAAAAAAAATTTCTGCATATTGGAGTGAAGTGCGACCT
<210> 53
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 53
AAAAAAAAAAGTTTCTGCATATTGGAGTGAATGCGACCT
<210> 54
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 54
AAAAAAAAAAAGTTTCTGCATATTGGAGTGATGCGACCT
<210> 55
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 55
AAAAAAAAAACAGTTTCTGCATATTGGAGTGTGCGACCT
<210> 56
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 56
AAAAAAAAAATCAGTTTCTGCATATTGGAGTTGCGACCT
<210> 57
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 57
AAAAAAAAAAATCAGTTTCTGCATATTGGAGTGCGACCT
<210> 58
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 58
AAAAAAAAAAAATCAGTTTCTGCATATTGGATGCGACCT
<210> 59
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 59
AAAAAAAAAAAAATCAGTTTCTGCATATTGGTGCGACCT
<210> 60
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 60
AAAAAAAAAATAAATCAGTTTCTGCATATTGTGCGACCT
<210> 61
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 61
AAAAAAAAAACTAAATCAGTTTCTGCATATTTGCGACCT
<210> 62
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 62
AAAAAAAAAACCTAAATCAGTTTCTGCATATTGCGACCT
<210> 63
<211> 39
<212> DNA
＜213〉artificial sequence
<400> 63
AAAAAAAAAAACCTAAATCAGTTTCTGCATATGCGACCT
<210> 64
<211> 171
<212> DNA
＜213〉Arabidopis thaliana (Arabidopsis thaliana)
<400> 64
TCACTCCAATATGCAGAAACTGATTTAGGTGGCTGGGGGGCATCTTGCTCCCCATCACCTTTAATCGAGTCTGTTGATACTTTTATTCAATCTCCTCCTACTGGGACAGTCGAGTCAAATTTTCCATCGCCGCGTAATGGTGGGCTATTGGATGCTTTACTTCATGAGGCC
<210> 65
<211> 21
<212> RNA
＜213〉Arabidopis thaliana (Arabidopsis thaliana)
<400> 65
AUUGGAGUGAAGGGAGCUCGA
Claims (10)
1. the general probe method based on the detection nucleolysis group mRNA of biochip is characterized in that it comprises the steps:
1) adopts bioinformatics method, the target nucleic acid degraded group mRNA that prediction may be degraded by microRNA;
2) provide detection probes, a part of nucleotide sequence of described detection probes and general reporter probe are complementary, another part nucleotide sequence at least with the nucleic acid array complementation of described target nucleic acid degraded group mRNA breaking part;
3) described detection probes is fixed on the biochip matrix, forms biochip;
4) RNA of sample to be detected and general reporter probe are sneaked into together in the hybridization solution and described biochip hybridization;
5) biochip after the washing hybridization detects results of hybridization.
2. the general probe method of the detection nucleolysis group mRNA based on biochip according to claim 1, it is characterized in that, described detection probes length is 18-42mer, wherein the nucleotide sequence length with general reporter probe complementary portion is 3-12mer, with the nucleotide sequence length of the breaking part complementary portion of nucleolysis group mRNA be 15-30mer.
3. the general probe method of the detection nucleolysis group mRNA based on biochip according to claim 1, it is characterized in that, in the described detection probes with a part of nucleotide sequence next-door neighbour of general reporter probe complementation and another part nucleotide sequence of the breaking part complementation of described target nucleic acid degraded group mRNA.
4. the general probe method of the detection nucleolysis group mRNA based on biochip according to claim 1, it is characterized in that, be designed with one group of probe cell corresponding to each target nucleic acid degraded group mRNA in the method, each group probe cell comprises several detection probes, wherein the possible broken site of corresponding each the target nucleic acid degraded group mRNA of each detection probes.
5. the general probe method of the detection nucleolysis group mRNA based on biochip according to claim 4 is characterized in that, each group probe cell comprises 20 above detection probes.
6. the general probe method of the detection nucleolysis group mRNA based on biochip according to claim 1, it is characterized in that, described detection probes is synthesized by original position and/or chemical bond connection mode is fixed on the biochip matrix, and described chemical bond connection mode is selected from any one in amino-aldehyde radical reaction, electrostatic adhesion, the covalent cross-linking at least.
7. the general probe method of each described detection nucleolysis group mRNA based on biochip is characterized in that according to claim 1-6, and what described detection probes was connected with biochip matrix one terminal modifiedly has amino, sulfydryl, carboxyl or a vitamin H.
8. the general probe method of each described detection nucleolysis group mRNA based on biochip is characterized in that described general reporter probe is selected from any one among DNA, RNA, PNA and the LNA at least according to claim 1-2.
9. the general probe method of each described detection nucleolysis group mRNA based on biochip according to claim 1-2, it is characterized in that described general reporter probe is away from being useful on the tagged molecule whether general reporter probe of indication and detection probes react with detection probes complementary is terminal modified.
10. the general probe method of the detection nucleolysis group mRNA based on biochip according to claim 1 is characterized in that described sample rna to be detected is selected from any one in total RNA sample and the little RNA sample of enrichment at least.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012103715740A CN103074419A (en) | 2012-09-27 | 2012-09-27 | Biological chip based general probe method for detecting nucleic acid degradation group mRNA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2012103715740A CN103074419A (en) | 2012-09-27 | 2012-09-27 | Biological chip based general probe method for detecting nucleic acid degradation group mRNA |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103074419A true CN103074419A (en) | 2013-05-01 |
Family
ID=48151112
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2012103715740A Pending CN103074419A (en) | 2012-09-27 | 2012-09-27 | Biological chip based general probe method for detecting nucleic acid degradation group mRNA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103074419A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105960644A (en) * | 2013-10-22 | 2016-09-21 | 金圣千 | Marker for generating binding information on biomolecules and nucleic acids, preparation method therefor, and method and apparatus for analyzing biomolecule by using same |
| CN108384831A (en) * | 2018-02-13 | 2018-08-10 | 塔里木大学 | The detection method of oligonucleotide with 4 to 10 nucleotide monomers |
| CN111500676A (en) * | 2020-04-21 | 2020-08-07 | 桂林旅游学院 | Method for reverse transcription of oligonucleotide into cDNA and oligonucleotide detection method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101892291A (en) * | 2009-05-08 | 2010-11-24 | 中国科学院苏州纳米技术与纳米仿生研究所 | Universal tag, probe and detection method for biomolecule multi-target detection |
-
2012
- 2012-09-27 CN CN2012103715740A patent/CN103074419A/en active Pending
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101892291A (en) * | 2009-05-08 | 2010-11-24 | 中国科学院苏州纳米技术与纳米仿生研究所 | Universal tag, probe and detection method for biomolecule multi-target detection |
Non-Patent Citations (1)
| Title |
|---|
| 华友佳等: "microRNA研究进展", 《生命科学》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105960644A (en) * | 2013-10-22 | 2016-09-21 | 金圣千 | Marker for generating binding information on biomolecules and nucleic acids, preparation method therefor, and method and apparatus for analyzing biomolecule by using same |
| CN105960644B (en) * | 2013-10-22 | 2018-07-10 | 金圣千 | For generating marker of combining information of biomolecule and nucleic acid and preparation method thereof, the biomolecule analysis and device of above-mentioned marker are utilized |
| CN108384831A (en) * | 2018-02-13 | 2018-08-10 | 塔里木大学 | The detection method of oligonucleotide with 4 to 10 nucleotide monomers |
| CN108384831B (en) * | 2018-02-13 | 2020-12-22 | 塔里木大学 | Method for detecting oligonucleotide with length of 4-10 nucleotide monomers |
| CN111500676A (en) * | 2020-04-21 | 2020-08-07 | 桂林旅游学院 | Method for reverse transcription of oligonucleotide into cDNA and oligonucleotide detection method |
| CN111500676B (en) * | 2020-04-21 | 2022-09-09 | 桂林旅游学院 | Method for reverse transcription of oligonucleotide into cDNA and oligonucleotide detection method |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111808854B (en) | Balanced joint with molecular bar code and method for quickly constructing transcriptome library | |
| Brouze et al. | Measuring the tail: Methods for poly (A) tail profiling | |
| CN110643611B (en) | Aptamer, construction method thereof and application thereof in detection of grouper iridovirus | |
| CN105525012B (en) | A kind of method for identifying molecules of peanut hybridization kind | |
| CN103074419A (en) | Biological chip based general probe method for detecting nucleic acid degradation group mRNA | |
| CN106520958B (en) | Method for developing microsatellite marker locus and method for detecting length of microsatellite marker in microsatellite marker locus | |
| CN101985659A (en) | Kit for testing schizophrenia related gene and preparation method thereof | |
| CN109161609B (en) | SNP molecular marker of wheat leaf rust resistance gene Lr42, detection method and application | |
| CN108624709B (en) | Universal primer and detection method for detecting target gene expression in transgenic plant | |
| CN103074418B (en) | General detection probe chip method for detecting nucleic acid degradation group | |
| KR102380453B1 (en) | Method and device for correcting level of expression of small rna | |
| CN109097488A (en) | For synchronizing nucleic acid, method and the kit of five kinds of dog diarrhea virus of detection and identification | |
| CN108396026A (en) | The exploitation and application of the Chang Miho couchgrass indigo plant kernel Characters of decaploid special chemoattractant molecule label and fluorescence in situ hybridization probe | |
| Gamba et al. | A method to enrich and purify centromeric DNA from human cells | |
| CN112858693A (en) | Biomolecule detection method | |
| CN106520961B (en) | Corn microsatellite marker locus development method and length detection method of microsatellite markers in microsatellite marker locus | |
| CN106520955B (en) | Development method of rice microsatellite marker locus and length detection method of microsatellite marker in microsatellite marker locus | |
| CN103865986B (en) | CDKN1A detection in Gene Mutation Auele Specific Primer and liquid-phase chip | |
| CN102191329A (en) | Kit for detecting genes related to severe depressions and preparation method thereof | |
| CN106566890B (en) | Method for developing rape microsatellite marker locus and method for detecting length of microsatellite marker in microsatellite marker locus | |
| CN106520960B (en) | Sesame microsatellite marker locus development method and method for detecting length of microsatellite marker in microsatellite marker locus | |
| CN106755312B (en) | Method for developing potato microsatellite marker locus and method for detecting length of microsatellite marker in microsatellite marker locus | |
| Lyu et al. | Linearly Amplified Single-Stranded RNA-Derived Transcriptome Sequencing (LAST-seq) | |
| KR101706771B1 (en) | Method for detection of Cochlodinium polykrikoides by in situ hybridization and kit therefor | |
| CN103865987B (en) | C6ORF97 detection in Gene Mutation Auele Specific Primer and liquid-phase chip |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20130501 |