CN103074373A - Transgenic vector used for improving bovine lean meat percentage by specifically expressing Follistatin in muscle tissues - Google Patents
Transgenic vector used for improving bovine lean meat percentage by specifically expressing Follistatin in muscle tissues Download PDFInfo
- Publication number
- CN103074373A CN103074373A CN2011103293176A CN201110329317A CN103074373A CN 103074373 A CN103074373 A CN 103074373A CN 2011103293176 A CN2011103293176 A CN 2011103293176A CN 201110329317 A CN201110329317 A CN 201110329317A CN 103074373 A CN103074373 A CN 103074373A
- Authority
- CN
- China
- Prior art keywords
- gene
- follistatin
- dna
- bovine
- muscle
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a transgenic vector used for improving bovine lean meat percentage by specifically expressing Follistatin in muscle tissues. The transgenic vector comprises mice muscle creatine kinase (MCK) enhancer, 2.7kb bovine alpha-skeletal muscle actin gene promoter, bovine Follistatin cDNA, and bovine growth hormone gene 3' untranslated region. The vector has resistance gene-puromycin gene used in screening in mammalian cell, and resistance gene-bleomycin gene used in screening in prokaryotic cell. The transgenic vector provided by the invention can be used in somatic cell cloning, such that high-lean-meat-percentage Follistatin<mus> transgenic cow can be constructed.
Description
Technical field
The invention belongs to gene engineering technology field, be specifically related to the specific expressed Follistatin of a kind of muscle tissue to improve the transgene carrier of thin cattle meat rate.
Background technology
Beef guarantees that as one of main meat-based food of Chinese people it is the critical event that is related to people's daily life that national people have beef supply sufficient, high-quality.And along with the growth of population and the raising of living standards of the people, except the demand to beef increases, the quality of beef and the requirement of mouthfeel have also been improved.Therefore, be necessary to set up and improve the kind of Chinese ox, improve beef mouthfeel and quality, to satisfy the people's life requirement.
Follistatin is secreted into a kind of glycoprotein in the blood by muscle cell, and it can be combined with the Myostatin that suppresses muscle growth, thus the function of antagonism Myostatin, and then promote the growth of muscle.In mouse and monkey, prove by experiment, the adeno-associated virus (Adeno-associated Virus) of expressing Follistatin is expelled in the muscle, can effectively promote the growth of muscle, not only improved the weight of muscle, muscle power (Haidet A.M.et al. " Long-term enhancement of skeletal muscle mass and strength by single gene administration of myostatin inhibitors. " Proc Natl Acad Sci USA, 2008.105:4318-4322 have also been strengthened; Kota, J.et al. " Follistatin gene delivery enhances muscle growth and strength in nonhuman primates " .Sci Transl Med, 2009.1,6ra15).Based on these data, we are expected to cross in the skeletal muscle of ox and express the lean ratio that Follistatin can improve ox, and can improve the quality of muscle.
Summary of the invention
Technical problem to be solved by this invention be a kind of can be at the specific expressed Follistatin of muscle tissue to improve the transgene carrier of thin cattle meat rate.
For solving the problems of the technologies described above, the technical solution used in the present invention is as follows:
A kind of creatine kinase (muscle creatine kinase that can comprise at the specific expressed Follistatin of muscle tissue mouse with the transgene carrier that improves the thin cattle meat rate, MCK) enhanser, 2.7kb the promotor of α-skeletal actin of ox (α-skeletal actin) gene, 3 ' end untranslated region territory of the cDNA of the Follistatin of ox and bovine growth hormone gene (bGH), and with resistant gene-bleomycin (Zeocin) gene (seeing Fig. 2) that screens usefulness in resistant gene-tetracycline (Puromycin) gene that screens usefulness in the mammalian cell and the prokaryotic cell prokaryocyte.
2.7kb the promotor of α-skeletal actin (α-skeletal actin) can guarantee gene specifically expressing in skeletal muscle in downstream, and the MCK enhanser also to have a specific enhanser of muscle tissue active, can promote specifically the high expression level of downstream gene.What express in this transgene carrier is the Follistatin gene of Niu Zishen, thus from the angle of food safety, on human consumer's health without any impact.In addition, the present invention also adds the LoxP sequence at the two ends of tetracycline and bleomycin resistant gene, like this, at the Follistatin gene integration behind genomic dna, if needed, the present invention can by expressing Cre albumen, induce the restructuring of LoxP sequence, to remove resistant gene, further ensure the food safety of transgenic animal.
The complete sequence of the transgene carrier pHJ20 of the muscle tissue specifically expressing ox Follistatin that the present invention makes up is shown in SEQ ID No:1, wherein the 5-1039 base is ox Follistatin coding region, the 1059-1272 base is bGH 3 ' end untranslated region, the 1448-1481 base is LoxP, the 1837-2508 base is puromycin resistance gene, 2566-2937 base bleomycin (Zeocin) resistant gene, the 2952-2985LoxP base is 4458-4804 MCK enhanser, and the 5110-7857 base is the promotor of ox α-skeletal actin gene.
Transgene carrier of the present invention can be applicable to somatic cell clone, to make up the Follistatin of high lean ratio
MusTransgenic cattle.
Description of drawings
Fig. 1 is techniqueflow chart of the present invention.
Fig. 2 is the synoptic diagram of the pHJ20 transgene carrier that makes up of the present invention.
Embodiment
According to following embodiment, the present invention may be better understood.Yet, those skilled in the art will readily understand that the described content of embodiment only is used for explanation the present invention, and should also can not limit the present invention described in detail in claims.
Embodiment 1: insert the LoxP-Puro-Zeo-LoxP fragment, make up pZT1.
PCDNA3.1 (myc-His) a carrier (Invitrogen) is cut with the PvuII enzyme, and the enzyme system of cutting is 2 μ g plasmid DNA, 3 μ l, 10 * buffer, and 2 μ l PvuII enzymes add ddH
2O supplies volume to 30 μ l, and 37 ℃ of temperature were bathed 3 hours.Then the system of enzyme being cut by electrophoretic separation, cuts out the DNA band of 3.3kb size in 1% sepharose, reclaim the purification kit purify DNA with glue.Concrete steps are, pack in the 1.5ml centrifuge tube downcutting the target DNA band under the UV-light, and the sol solutions of the 3 times of volumes of rear adding of weighing, 55 ℃ of insulations 10 minutes are melted sepharose fully; The gel that melts changes mixed solution in the attached column over to after temperature is down to room temperature, and centrifugal 1 minute of 10,000g outwells effluent liquid; Add 650 μ l rinsing damping fluids, centrifugal 1 minute of 10,000g outwells effluent liquid; The adsorption column recentrifuge, 10,000g is centrifugal, 1 minute, outwells effluent liquid; Adsorption column is transferred in the new 1.5ml centrifuge tube, added 50 μ l ddH
2O placed 1 minute, and 10,000g collected purified product in centrifugal 1 minute.
Cut out the LoxP-Puro-Zeo-LoxP fragment from the pSNAP carrier with the EcoRV enzyme, the enzyme system of cutting is 3 μ g plasmid DNA, 3 μ l, 10 * buffer, and 2 μ l EcoRV enzymes add ddH
2O supplies volume to 30 μ l, and 37 ℃ of temperature were bathed 3 hours.Then the system of enzyme being cut by electrophoretic separation, cuts out the DNA band of 1.7kb size in 1% sepharose, reclaim the purification kit purify DNA with glue.Concrete steps are the same.
PCDNA3.1 (myc-His) a (PvuII) is connected EcoRV with LoxP-Puro-Zeo-LoxP) connect, add 2 μ l carriers in the ligation, 6 μ l Insert Fragments, 1 μ l, 10 * buffer, 1 μ l T4DNA ligase enzyme, 16 ℃ of temperature were bathed 16 hours.
Be transformed in the competent cell of E.coli connecting product.The Trans5 α competent cell of getting a pipe 50 μ l places on ice, after it melts, to wherein adding the above-mentioned connection product of 4 μ l, flicks mixing, afterwards in hatching 30 minutes on ice; 42 ℃ of thermal shocks 30 seconds, after left standstill on ice 10 minutes; Add the nonresistant LB liquid nutrient medium of 500 μ l, 37 ℃ of concussions were cultivated 1 hour; Centrifugal 5 minutes of 4,000rpm siphons away, and keeps the substratum about 100 μ l, is coated on the LB culture medium flat plate that contains ammonia benzyl and the two resistances of Bo Lai after with bacterial precipitation piping and druming evenly with pipettor.Then flat board is placed 37 ℃ of incubators to cultivate 16 hours.
Clonal growth out after, choose the mono-clonal bacterium colony and contain to 3ml in the LB nutrient solution of penbritin, 37 ℃ of concussions were cultivated 12 hours, extracted plasmid DNA, cut evaluation with the EcoRI enzyme, can obtain two DNA bands of 2.9kb and 2.0kb in the positive colony.Further determine the exactness of positive colony by order-checking, the clone who obtains is pZT1 again.
Embodiment 2: insert the promoter dna fragment of ox α-skeletal actin gene, make up pZT2.
With pZT1 PvuI and NdeI double digestion, the enzyme system of cutting is 2 μ g plasmid DNA, 3 μ l, 10 * buffer, and 1.5 μ l PvuI enzymes, 1.5 μ l NdeI enzymes add ddH
2O supplies volume to 30 μ l, and 37 ℃ of temperature were bathed 3 hours.Then the system of enzyme being cut by electrophoretic separation, cuts out the DNA band of 4.0kb size in 1% sepharose, reclaim the purification kit purify DNA with glue.Concrete steps are the same.
Obtain the promoter dna fragment of the ox α of 2.7kb-skeletal actin gene by pcr amplification, the PCR condition is as follows: 1 μ l (about 100ng) cow genome group DNA, the final concentration of primer 1 (ATG CCT CCT CAG CTCTCA AAC GG) and primer 2 (TCA CAT CTG GCT GAT TCT CTG CTT C) is 0.5 μ M, the final concentration of dNTPs is 0.2mM, 5 μ l, 10 * buffer, 1 μ l HiFi Taq enzyme, adding ddH2O supplies volume to 50 μ l.PCR circulation, 95 ℃, 2 minutes; Then be 95 ℃, 30 seconds, 55 ℃, 30 seconds, 72 ℃, 3 minutes, 35 circulations; 72 ℃, 5 minutes; 4 ℃, insulation.The PCR product is passed through electrophoretic separation in 1% sepharose, cut out the DNA band of 2.7kb size, reclaim the purification kit purify DNA with glue.Concrete steps are the same.
The promoter dna fragment of the ox α of the 2.7kb that pcr amplification is obtained-skeletal actin gene is connected on the pEASY-T3 carrier (full formula King Company) by the TA clone.1 μ l pEASY-T3 adds the promoter dna fragment of the ox α of 4 μ l 2.7kb-skeletal actin gene, and 25 ℃, 30 minutes.Then ligation is transformed in the E.coli competent cell, the cell after transforming is applied on the LB flat board that contains IPTG and X-Gal and penbritin grows.Clonal growth out after, the mono-clonal bacterium colony of choosing white contains to 3ml in the LB nutrient solution of penbritin, 37 ℃ of concussions were cultivated 12 hours, extracted plasmid DNA, cut evaluation with the EcoRI enzyme, can obtain two DNA bands of 3.0kb and 2.7kb in the positive colony.Further determine the exactness of positive colony by order-checking, the clone who obtains is pLCNK3 again.
From pLCNK3 with PvuI and NdeI double digestion to cut out the promoter DNA of ox α-skeletal actin gene, the enzyme system of cutting is 3 μ g pLCNK3DNA, 3 μ l, 10 * buffer, 1.5 μ l PvuI enzymes, 1.5 μ l NdeI enzymes add ddH
2O supplies volume to 30 μ l, and 37 ℃ of temperature were bathed 3 hours.Then the system of enzyme being cut by electrophoretic separation, cuts out the DNA band of 2.7kb size in 1% sepharose, reclaim the purification kit purify DNA with glue.Concrete steps are the same.
PZT1 (PvuI/NdeI) is connected the promoter DNA (PvuI/NdeI) of skeletal actin gene connects with ox α, ligation is the same.
Be transformed in the competent cell of E.coli connecting product.Concrete steps are the same, except only carrying out resistance screening with bleomycin.
Clonal growth out after, choose the mono-clonal bacterium colony and contain to 3ml in the LB nutrient solution of bleomycin, 37 ℃ of concussions were cultivated 12 hours, extracted plasmid DNA, cut evaluation with the EcoRI enzyme, can obtain four DNA bands of 2.8kb, 2.1kb, 1.6kb and 0.5kb in the positive colony.Further determine the exactness of positive colony by order-checking, the clone who obtains is pZT2 again.
Embodiment 3: insert MCK enhancer DNA fragment, make up pML5.
PZT2 is cut with the PvuI enzyme, and the enzyme system of cutting is 2 μ g plasmid DNA, 3 μ l, 10 * buffer, and 1.5 μ lKpnI enzymes, 1.5 μ lNdeI enzymes add ddH
2O supplies volume to 30 μ l, and 37 ℃ of temperature were bathed 3 hours.Then the system of enzyme being cut by electrophoretic separation, cuts out the DNA band of 7.0kb size in 1% sepharose, reclaim the purification kit purify DNA with glue.Concrete steps are the same.
The dephosphorylation of pZT2 carrier, 35 μ l pZT2 (PvuI), 4 μ l, 10 * buffer, 1 μ l calf intestinal alkalescence dephosphorylation enzyme (CIP), 37 ℃ of temperature were bathed 1 hour.Then reaction system is passed through electrophoretic separation in 1% sepharose, cut out the DNA band of 7.0kb size, reclaim the purification kit purify DNA with glue.Concrete steps are the same.
Obtain MCK enhancer DNA fragment by pcr amplification, the PCR condition is as follows: 1 μ l (about 10ng) template DNA pST181, primer 1 (gata
CGATCGACGGGCCAGATATACGCGTTAGAA) and primer 2 (ccgg
CGATCGGGCGGGCCATTTACCGTAAGTTAT) final concentration is 0.5 μ M, and the final concentration of dNTPs is 0.2mM, 5 μ l, 10 * buffer, and 1 μ l HiFi Taq enzyme adds ddH
2O supplies volume to 50 μ l.PCR circulates, and 95 ℃, 2 minutes; Then be 95 ℃, 30 seconds, 55 ℃, 30 seconds, 72 ℃, 30 seconds, 35 circulations; 72 ℃, 5 minutes; 4 ℃, insulation.Then the PCR product is passed through electrophoretic separation in 1% sepharose, cut out the DNA band of 500bp size, reclaim the purification kit purify DNA with glue.Concrete steps are the same.
Cut MCK enhancer DNA fragment with the PvuI enzyme, the enzyme system of cutting is 3 μ g DNA, 4 μ l, 10 * buffer, and 3 μ l PvuI enzymes add ddH
2O supplies volume to 40 μ l, and 37 ℃ of temperature were bathed 3 hours.Then the system of enzyme being cut by electrophoretic separation, cuts out the DNA band of 500bp size in 1% sepharose, reclaim the purification kit purify DNA with glue.Concrete steps are the same.
PZT2 (PvuI/CIP) is connected PvuI with MCK enhancer DNA fragment) connect, ligation is the same.
Being transformed in the competent cell of E.coli connecting product. concrete steps are the same, except only carrying out resistance screening with bleomycin.
Clonal growth out after, choose the mono-clonal bacterium colony and contain to 3ml in the LB nutrient solution of bleomycin, 37 ℃ of concussions were cultivated 12 hours, extracted plasmid DNA, cut evaluation with the PvuI enzyme, can obtain two DNA bands of 8.5kb and 0.5kb in the positive colony.Further determine the exactness of positive colony by order-checking, the clone who obtains is pML5 again.
Embodiment 4: insert ox Follistatin coding region dna fragmentation, make up pHJ20.
With pML5 NdeI and PmeI double digestion, the enzyme system of cutting is 2 μ g plasmid DNA, 3 μ l, 10 * buffer, and 1.5 μ l PmeI enzymes, 1.5 μ l NdeI enzymes add ddH
2O supplies volume to 30 μ l, and 37 ℃ of temperature were bathed 3 hours.Then the system of enzyme being cut by electrophoretic separation, cuts out the DNA band of 6.9kb size in 1% sepharose, reclaim the purification kit purify DNA with glue.Concrete steps are the same.
Synthetic (Invitrogen) obtains ox Follistatin coding region dna fragmentation by full gene, and with NdeI and PmeI double digestion, the enzyme system of cutting is 3 μ g plasmid DNA, 3 μ l, 10 * buffer, and 1.5 μ l PmeI enzymes, 1.5 μ l NdeI enzymes add ddH
2O supplies volume to 30 μ l, and 37 ℃ of temperature were bathed 3 hours.Then the system of enzyme being cut by electrophoretic separation, cuts out the DNA band of 1.0kb size in 1% sepharose, reclaim the purification kit purify DNA with glue.Concrete steps are the same.
PML5 (PmeI/NdeI) is connected PmeI/NdeI with ox Follistatin coding region dna fragmentation) connect, ligation is the same.
Be transformed in the competent cell of E.coli connecting product.Concrete steps are the same, except only carrying out resistance screening with bleomycin.
Clonal growth out after, choose the mono-clonal bacterium colony and contain to 3ml in the LB nutrient solution of bleomycin, 37 ℃ of concussions were cultivated 12 hours, extracted plasmid DNA, cut evaluation with the EcoRI enzyme, can obtain five DNA bands of 3.0kb, 2.8kb, 1.5kb, 0.3kb and 0.2kb in the positive colony.Further determine the exactness of positive colony by order-checking, the clone who obtains is pHJ20 again.
Claims (1)
1. the specific expressed Follistatin of muscle tissue is to improve the transgene carrier of thin cattle meat rate, it is characterized in that, described transgene carrier contains 3 ' end untranslated region territory of cDNA and the bovine growth hormone gene of the creatine kinase enhanser of mouse, the α of the 2.7kb ox-promotor of skeletal actin gene, the Follistatin of ox, and with the resistant gene that screens usefulness in the resistant gene that screens usefulness in the mammalian cell-tetracycline gene and the prokaryotic cell prokaryocyte-bleomycin gene.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011103293176A CN103074373A (en) | 2011-10-26 | 2011-10-26 | Transgenic vector used for improving bovine lean meat percentage by specifically expressing Follistatin in muscle tissues |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN2011103293176A CN103074373A (en) | 2011-10-26 | 2011-10-26 | Transgenic vector used for improving bovine lean meat percentage by specifically expressing Follistatin in muscle tissues |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN103074373A true CN103074373A (en) | 2013-05-01 |
Family
ID=48151068
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2011103293176A Pending CN103074373A (en) | 2011-10-26 | 2011-10-26 | Transgenic vector used for improving bovine lean meat percentage by specifically expressing Follistatin in muscle tissues |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103074373A (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115151646A (en) * | 2019-12-24 | 2022-10-04 | 阿斯克肋匹奥生物制药公司 | Regulatory nucleic acid sequences |
-
2011
- 2011-10-26 CN CN2011103293176A patent/CN103074373A/en active Pending
Non-Patent Citations (4)
| Title |
|---|
| HAKIMI P等: "Overexpression of the Cytosolic Form of Phosphoenolpyruvate Carboxykinase (GTP) in Skeletal Muscle Repatterns Energy Metabolism in the Mouse", 《THE JOURNAL OF BIOLOGICAL CHEMISTRY》 * |
| LEE,K.B.等: "GenBank Accession Number:NM_175801", 《GENBANK》 * |
| 孙小瑞 等: "猪肌肉特异表达基因CKM启动子、增强子的克隆与转录调控分析", 《第十六次全国动物遗传育种学术讨论会论文集》 * |
| 康峰等: "牛卵泡抑素基因克隆及真核表达载体构建", 《中国牛业科学》 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115151646A (en) * | 2019-12-24 | 2022-10-04 | 阿斯克肋匹奥生物制药公司 | Regulatory nucleic acid sequences |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Tora et al. | The cloned human oestrogen receptor contains a mutation which alters its hormone binding properties. | |
| Liang et al. | Human bone marrow mesenchymal stem cells expressing SDF-1 promote hematopoietic stem cell function of human mobilised peripheral blood CD34+ cells in vivo and in vitro | |
| He et al. | Polymorphisms of STAT5A gene and their association with milk production traits in Holstein cows | |
| Pochampally et al. | Correction of a mineralization defect by overexpression of a wild-type cDNA for COL1A1 in marrow stromal cells (MSCs) from a patient with osteogenesis imperfecta: a strategy for rescuing mutations that produce dominant-negative protein defects | |
| Bahar et al. | Bovine lactoferrin (LTF) gene promoter haplotypes have different basal transcriptional activities | |
| Chambers et al. | The mRNA-binding protein IGF2BP1 restores fetal hemoglobin in cultured erythroid cells from patients with β-hemoglobin disorders | |
| CN111886341A (en) | Efficient in vivo knock-in using CRISPR | |
| CN103074370A (en) | Transgenic vector used for improving pig lean meat percentage by specifically expressing Follistatin in muscle tissues | |
| Choi | Environmental stress-related gene expression and blood physiological responses in olive flounder (Paralichthys olivaceus) exposed to osmotic and thermal stress | |
| CN103074373A (en) | Transgenic vector used for improving bovine lean meat percentage by specifically expressing Follistatin in muscle tissues | |
| Schlatter et al. | Novel CNBP‐and La‐based translation control systems for mammalian cells | |
| Kidane et al. | Differential neuroendocrine expression of multiple brain-derived neurotrophic factor transcripts | |
| O'Gorman et al. | Regulation of a bovine nonclassical major histocompatibility complex class I gene promoter | |
| CN103074372A (en) | Transgenic vector improving pig lean meat percentage, intramuscular fat content, and reproductive capacity | |
| Javed et al. | Characterization of PRLR and PPARGC1A genes in buffalo (Bubalus bubalis) | |
| CN103074371A (en) | Transgenic vector improving bovine lean meat percentage, intramuscular fat content, and reproductive capacity | |
| CN102876698B (en) | The reagent suppressing Sheep Fibroblast growth factors 5 to be expressed and application thereof | |
| CN110511933B (en) | Rat long-chain non-coding lncRNA-lncMSTRG10078 and application thereof in resisting cell injury | |
| Doering et al. | Advancements in gene transfer-based therapy for hemophilia A | |
| Esbaugh et al. | Identification of two glucocorticoid response elements in the promoter region of the ubiquitous isoform of glutamine synthetase in gulf toadfish, Opsanus beta | |
| WO2020223160A1 (en) | A novel chromatin-opening element for stable long term gene expression | |
| Gao et al. | Transfection and expression of exogenous gene in laying hens oviduct in vitro and in vivo | |
| Zhou et al. | Trait‐associated sequence variation in the bovine growth hormone receptor 1A promoter does not affect promoter activity in vitro | |
| Zhang et al. | Dominant-genotype frequency analysis of economic traits related to SNP candidate markers in three yak populations | |
| CN110904046A (en) | Application of ISLR gene in preparation of medicine for treating obesity and improving insulin resistance |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C02 | Deemed withdrawal of patent application after publication (patent law 2001) | ||
| WD01 | Invention patent application deemed withdrawn after publication |
Application publication date: 20130501 |