CN103071147A

CN103071147A - Continuous subcutaneous administration of interferon-alpha to hepatitis b infected patients

Info

Publication number: CN103071147A
Application number: CN2012102494365A
Authority: CN
Inventors: W.P.范安特卫普; E.A.格罗文德; R.M.谢勒; J.兰德
Original assignee: Medtronic Inc
Current assignee: Medtronic Inc
Priority date: 2011-10-26
Filing date: 2012-07-18
Publication date: 2013-05-01
Also published as: WO2013062959A3; WO2013062959A2

Abstract

Methods and systems for treating Hepatitis B infections are provided. Typically the method comprises administering interferon-a to the patient subcutaneously using a continuous infusion apparatus, wherein this therapeutic regimen is sufficient to maintain circulating levels of interferon-a in the serum of the patient above a target concentration for a certain period of time.

Description

Interferon-' alpha ' is to the patient's of hepatitis B infection continuous subcutaneous administration

The cross reference of related application

The application requires the priority of the U.S. Provisional Application series number 61/551,798 of submission on October 26th, 2011 under the 119th (e) part, its content is incorporated this paper by reference into.The application relates to U. S. application series number 12/848,856 and international application no PCT/US2010/54755, and its content is incorporated into by reference.

Technical field

The present invention relates to therapy, described therapy comprises that using interferon-' alpha ' treats pathological conditions (for example hepatitis b virus infected).Particularly, the present invention relates to method and system, its mode with body internal interference element-alpha levels of control patient is used interferon-' alpha ', so that the result of optimizing therapeutic regimen.

Background technology

It is a great public health challenge that hepatitis B virus (HBV) infects, and according to estimates, only in the U.S. 730,000 chronically infected adults is just arranged, and annual financial burden is 1,300,000,000 dollars.Present available treatment selects to comprise parenteral medicament and medicinal preparation for oral administration that described pharmacy effect is in different hosts and viral target.These comprise: the medicament of the receptor of targeting on host cell membrane such as the interferon of standard and peg-IFN (peg-interferon), and suppress nucleotide and the nucleoside analog of the dependent archaeal dna polymerase of HBV RNA.

HBV virus is propagated by following manner: blood and blood products, and intravenous drug misuser's syringe needle pollutes, spreads through sex intercourse, and the vertical transmission from infected or carrier parent to the baby.In the world, this disease is most commonly in the some areas in Southeast Asia, Africa and South America.In these areas, cause a high proportion of infected individual to become the chronic carrier of hepatitis B to the baby's at early stage age vertical transmission meeting.HBV can cause acute severe hepatitis, i.e. a kind of fast progressive, frequent cause death disease of form, and wherein a large amount of parts of liver are destroyed.As the result that chronic hepatitis B infects, the male baby who obtains hepatitis B has about 40% chance and dies from liver cirrhosis or primary hepatoma.Infected women has about 15% chance and dies from the similar death that chronic hepatitis B infects at birth.Although the patient usually can be from the acute hepatitis rehabilitation, in some patient, high-caliber virus antigen continues period or the uncertain period of prolongation in blood, cause chronic infection.Chronic infection can cause chronic persistent hepatitis.Chronic persistent hepatitis can cause fatigue, liver cirrhosis and hepatocarcinoma (a kind of primary hepatocarcinoma).The mechanism that HBV brings out cancer is unknown, although according to supposition, it may directly trigger tumor development, or indirectly triggers tumor development by chronic inflammatory disease, liver cirrhosis and the cell regeneration relevant with infection.

Because current clinical practice only causes the removing of HBV in a part of infected individual, thirst for very much new therapy.In addition, the time period that current therapeutic scheme continue to prolong, and the patient often suffers the side effect of many disadvantageous dose dependents, comprises serious influenza sample symptom, and described symptom can adversely affect patient's compliance and result.Therefore, need the method that is used for the treatment of viral infection such as hepatitis B of improvement, in particular for the exploitation of the method and system of using interferon-' alpha ', described replying with the mode of therapeutic outcome for the treatment of of using to optimize comprising this medicament carried out.

Summary of the invention

Disclosure provided herein comprises the result who obtains from clinical trial, and described clinical trial is used for the combined interferon-' alpha ' of research and ribavirin in the patient's of experience chronic hepatitis C treatment continuous subcutaneous administration.The clinical data that obtains from this test shows that the continuous subcutaneous administration of interferon-' alpha ' can be higher than the time period that critical effectiveness threshold value prolongs for the bulk concentration of keeping interferon-' alpha ', and this can promote the virus sweep among the host.

Although the infectious agent with the interferon-' alpha ' treatment in the clinical trial that is discussed below is hepatitis C virus, the method relevant with lasting interferon-' alpha ' level and data go in some other treatment background.Particularly, interferon-' alpha ' has effective antiviral activity, but can directly not act on virus or copy complex.On the contrary, interferon-' alpha ' works by the gene (ISG) of inducing IFN to stimulate, this can in cell, set up non-viral specific antiviral state (referring to, such as people such as Bekisz, Growth Factors 22,243-251 (2004) and Sen, Annu.Microbiol.55,255-281 (2001).Microarray analysis shows that hundreds of genes can be induced by disturbed element-α, and are many relevant with antiviral activity, replys but other gene participates in lipid metabolism, apoptosis, protein degradation and inflammatory cell.In addition, interferon-' alpha ' can promote memory T-cell proliferation, prevention T-apoptosis and stimulate natural killer cell activation and dendritic cell maturation.Under this background, if use (for example via the continuous infusion pump) in the mode that causes this lasting cytokine levels, it is believed that the interferon-' alpha ' that use in so outer seedbed can prevent immunodepletion, and strengthen the adaptive immune response for hepatitis B virus.

Interferon-' alpha ' has been approved for the therapeutic agent in the method that is used for the treatment of hepatitis B infection, and invention disclosed herein provides the concrete Therapeutic Method that is used for the treatment of this infection.An exemplary embodiment of the present invention is, give the method for being used interferon-' alpha ' by hepatitis b virus infected patient, described method comprises: use the continuous infusion device, use interferon-' alpha ' for described patient, wherein using is enough to keep the therapeutic scheme that the cyclical level of interferon-' alpha ' in described patients serum is higher than specific Css threshold value a period of time (for example keeping at least 1 thoughtful at least 52 weeks of concentration of at least 100 pg/ml (pg/mL)), and interferon-' alpha ' is administered to described patient.In typical embodiments of the present invention, such therapeutic scheme is enough to make the HBV level among the patient to reduce at least 100 times.

Embodiment of the present invention comprise the Extraordinary therapeutic scheme, and described therapeutic scheme is customized to viral distinctive one or more features of considering the patient and/or infecting described patient.For example, the existence of special single nucleotide polymorphism or disappearance can be for assessment of the probabilities of chronic hepatitis B (CHB) susceptibility.The result, some method embodiment of the present invention comprises the steps: to measure the polynucleotide sequence among the patient, for example, one or more single nucleotide polymorphism, such as called after rs2856718, rs7453920, rs3077, rs9277535, rs2284553, rs9808753 or rs17401966 those (for example, referring to people such as Mbarek, Hum Mol Genet.2011Oct 1; 20 (19): 3884-92; The people such as Obrien, Genes Immun.2011Sep; 12 (6): 428-33; With NCBI single nucleotide polymorphism data base (http://www.ncbi.nlm.nih.gov/projects/SNP/); Then by ad hoc approach interferon-' alpha ' is administered to by hepatitis b virus infected patient, described method comprises: use the continuous infusion device, use hypodermically interferon-' alpha ' for the patient, wherein using is enough to keep the therapeutic scheme that the cyclical level of interferon-' alpha ' in described patients serum is higher than Css (for example at least 100pg/mL), and interferon-' alpha ' is administered to described patient.

In some embodiment of the present invention, before the begin treatment scheme, check described patient, so as the genotype of identifying virus and/or one or more HBV antigen (for example HBsAg or HBeAg) and/or for the antibody of one or more HBV antigens (for example anti--HBsAg, IgM anti--existence or the state of HBc or anti--HBeAg).Embodiment of the present invention also comprise such therapeutic scheme: it is designed so that with the therapeutic combination of selecting described therapeutic combination has special properties (for example being controlled at the character of the interior bioavailability distribution of body of the therapeutic agent in the described compositions).In such embodiment of the present invention, described interferon-' alpha ' is not puted together with polyhydric alcohol.Usually, these methods comprise in addition: use the micromolecular inhibitor of virus replication, such as the nucleoside/nucleotide analog.

Another exemplary embodiment of the present invention of considering the distinctive one or more features of patient is, give the method for being used interferon-' alpha ' by hepatitis b virus infected patient, described method comprises: the interferon-' alpha ' of using test dose for described patient, the concentration of then observing the circulation interferon-' alpha ' among the patients serum who is caused by described test dose.In this embodiment, then use the concentration of the circulation interferon-' alpha ' of observing in response to test dose to design the therapeutic scheme of patient-specific, the therapeutic scheme that namely comprises the steps: use the continuous infusion device, be higher than the specific bulk concentration special time period amount of (for example being higher than at least 1 week at least 52 weeks of 100pg/mL) with the cyclical level that is enough to keep the interferon-' alpha ' among the patients serum, use hypodermically interferon-' alpha ' for the patient.In relevant embodiment of the present invention, select the therapeutic scheme of patient-specific, to keep serum interferon among the patient-α concentration value greater than inducing and/or promoting the patient to the critical concentration threshold value of replying lastingly of therapeutic scheme.

Other embodiment of the present invention comprises: the system that is used for using interferon-' alpha ' to the patient with hepatitis B infection.In such embodiment of the present invention, described system for example can comprise: the continuous infusion pump, and it has the medicament that comprises interferon-' alpha ' and holds the pond; Processor, it may be operably coupled to described continuous infusion pump, and comprising that instruction group, described instruction group cause described continuous infusion pump according to therapeutic scheme interferon-' alpha ' to be administered to described patient, described therapeutic scheme comprises: use hypodermically interferon-' alpha ' for described patient; The cyclical level that wherein said therapeutic scheme is enough to keep the interferon-' alpha ' among the patients serum is higher than at least Css of 100-700pg/mL.

In certain embodiments of the invention, be coupled to electronic system for the system that uses interferon-' alpha ', described electronic system is used for the medical data of management on electronic communication network.For example, such electronic system can comprise that at least one can connect for the e-server of communicating by letter at communication network, described at least one e-server is configured for: be received in the first physiological parameter (for example patient's virus load) of observing among the patient, based on described the first physiological parameter, set the first dosage by the interferon-' alpha ' of continuous infusion pump infusion; Receive the second physiological parameter information of patient, its indication patient replys the interferon-' alpha ' of the first dosage; Then based on described the second physiological parameter, set the second dosage by the interferon-' alpha ' of continuous infusion pump infusion.

Those skilled in the art can understand other objects, features and advantages of the present invention from following detailed description.But although should be appreciated that and indicate some embodiment of the present invention, described detailed description and specific embodiment provide as illustration rather than restriction.Can make within the scope of the invention many variations and modification, and not break away from its spirit, the present invention includes all such modifications.

Description of drawings

The analysis of the patient's that the HCV that Figure 1A and 1B provide next comfortable therapeutic scheme disclosed herein to treat with interferon-' alpha ' later on infects data.In disclosed clinical trial process, measure pharmacokinetics and pharmacodynamics parameter, comprise the average interference element-α (Figure 1A) and 1-(2-amino-4-hydroxy-6-pteridinyl)-1,2,3-propanetriol (Figure 1B) concentration (N=23) that are produced by therapeutic scheme disclosed herein.The data that provide in the figure shown in Figure 1A and the 1B show, after disclosed therapeutic scheme, are applied in response to interferon-' alpha ' and observe strong dose response among the patient.Show further that in the data shown in Figure 1A and the 1B after therapeutic scheme disclosed herein, the interferon-' alpha ' of sending higher concentration can cause correspondingly higher lasting body internal interference element-α concentration.

Fig. 2 provides the patient's who infects from a part of HCV viral attenuation analysis, and described patient confirmed it is seriously interferon-' alpha ' resistance in the past, and used subsequently therapeutic scheme disclosed herein to treat.In the graph data shown in this figure, illustrate the viral attenuation curve in 6MIU/ days treatment groups are treated unsuccessfully.In 6MIU/ days therapeutic scheme groups, there are 5 experimenters to show significant resistance.In these 5 experimenters, patient 8 shows sane replying in the 8th week, subsequently bounce-back.In the former treatment, all these 5 experimenters treated unsuccessfully in the 12nd week or the 24th week.In Fig. 3, shown in this 6MIU/ days therapeutic scheme groups, have clinically 5 experimenters of more significant HCV decay.The same with all patients in test, it is resistance seriously that the experimenter in 6MIU/ days groups was proved the conventional H CV therapy of using peg-IFN-α in the past.

Fig. 3 provides 6MIU/ days therapeutic scheme groups, steadily and surely reply the patient that a part of HCV in the group infects viral attenuation analysis, they are former, and to be proved the conventional H CV therapy of using peg-IFN-α be resistance seriously.In this treatment group, show clinically later at therapeutic scheme disclosed herein in response to the viral attenuation curve of this treatment and to reply significantly.

Fig. 4 A and 4B provide the patient's that a part of HCV in 9MIU/ days therapeutic scheme groups infects viral attenuation analysis, and they are former, and to be proved the conventional H CV therapy of using peg-IFN-α be resistance seriously.The data that provide in Fig. 4 A show, have 4 experimenters to remain the interferon-' alpha ' resistance.But the data that provide in Fig. 4 B show, 6 bit tables in 10 experimenters in 9MIU/ days therapeutic scheme groups reveal sane replying, and are resistances although find before these patients peg-IFN-α treatment.

Fig. 5 provides the patient's that a part of HCV in 12MIU/ days therapeutic scheme groups infects viral attenuation analysis, and they are former, and to be proved the conventional H CV therapy of using peg-IFN-α be resistance seriously.In this 12MIU/ days therapeutic scheme groups, there is not the experimenter who current treatment is had the interferon-' alpha ' resistance.3 patients have withdrawed from this test.9 patients show sane replying.

Fig. 6 provide with regard to 6,9 and 12MIU/ days therapeutic scheme groups with regard at the viral attenuation data at 4 time-of-weeks point place.Shown in the curve among this figure, when 4 week, there is the significant difference of the virus load relevant with the difference of dosage.

The Data Comparison that Fig. 7 provides accept 6,9 or patient's group of 12MIU/ days therapeutic schemes in the virus decay of administration.As shown in the data that show in these bar diagram, when 4 week, use the interferon-' alpha ' of various dose to observe the significant difference that virus decays.

Fig. 8 provides serum interferon in the body that is caused by therapeutic scheme disclosed herein-α concentration how to affect information at the viral attenuation data at 4 time-of-weeks point place.

Fig. 9 A has shown an exemplary general computer system 202, and it can be used for carrying out key element of the present invention.Fig. 9 B has shown an embodiment of concrete exemplary computer system embodiment, and it can be used for the treatment of infection with hepatitis C virus with embodiment of the present invention.

The specific embodiment

Unless otherwise defined, all buzzwords, labelling and other scientific terminology that uses in this article or word intention have the implication that those skilled in the art in the invention understand usually.In some cases, for clear and/or for easy reference, definition has the term of the implication of common understanding in this article, and comprises that in this article such definition not necessarily is interpreted as representing the essential difference of the implication of usually understanding with this area.In due course, usually comprise test kit that use can commercial obtain and the operation of reagent according to the scheme of manufacturer definition and/or parameter, unless otherwise noted.

Definition:

Interferon-' alpha ' by term " at least 100-700pg/mL ", should be appreciated that such as at least 100,125,150,175,200,225,250,275,300,325,350,375,400,425,450,475,500,525,550,575,600,625,650,675 or the 700pg/mL equivalence can be used for setting up any occurrence scope.

By term " at least 1 week at least 48 weeks ", be to be understood that, in some cases, described therapeutic scheme is used at least 7,14,21 or 28 days persistent period, also can select at least 5,6,7,8,9,10,12,14,16,18,20,24,28,32,36,40,44,48,52,54,58,62,66,70,72 or time period in more weeks.In some embodiment of the present invention, described therapeutic scheme is used the persistent period at least 6,8 or 10 week at least 48 weeks.In other embodiments of the present invention, described therapeutic scheme is used the persistent period at least 6 week at least 32,36,40 or 44 weeks.In other embodiments of the present invention, described therapeutic scheme used at least 6 weeks at least 52,54,58,62,66,70,72 or persistent period in more weeks.

Term administering " refer to, therapeutic agent is imported in the health that this patient who needs is arranged, with treatment disease or disease.

The patient that term " treatment " and/or " processing " expression control and nursing have condition of illness (such as viral infection or other disease), use one or more treatment chemical compounds for described condition of illness indication, its objective is symptom and the complication of struggling against or alleviating these diseases.Treatment comprises: use one or more preparations of the present invention, with the outbreak of prevention symptom or complication, alleviate symptom or complication or eliminate described disease, disease or obstacle." treatment " used herein or " therapy " expression therapeutic treatment and preventative or preventative measure.In addition, " treatment " or " processing " do not require and alleviates sign or symptom fully, do not require healing, and comprise particularly the scheme that the patient is only had border effect.

The amount of at least a sign of people's disease or obstacle or the medicament of symptom (for example cytokine such as interferon-' alpha ' or micromolecular inhibitor are such as the nucleoside/nucleotide analog) is treated in term " treatment effective dose " expression effectively.The amount of application of medicament can change based on following factor: the effectiveness of basic reason, route of administration and the bioavailability of the activity of hope, the patient's who is treated disease state, dosage form, medication, patients factors (such as patient's sex, genotype, body weight and the age), the disease that will treat or disease, medicament persistent period, preparation and the medicament in vivo of using.Will be appreciated that, the treatment effective dose is provided in wide concentration range.Such scope can be determined based on external and/or in vivo test.

Term " distribution " uses according to the implication that its this area is accepted, and represents the collection of following one or more analysis or check result: the existence of (1) different characteristic; Or (2) phenomenon of observing shows the degree of different characteristic.Exemplary distribution generally includes the result from a series of observations, the information that can provide about such as following factor is provided in described observation group: existence and/or level and/or the feature of one or more factors of infected patient (for example hepatitis B virus), and the pharmacokinetics and/or the pharmacodynamics feature that are administered to one or more therapeutic agents (for example interferon-' alpha ') of patient as the part of therapeutic scheme, and physiological status or the Functional Capability of the one or more organs among the patient or tract (for example liver), and the genotype of the one or more single nucleotide polymorphism among the patient etc.

Term " therapeutic scheme " uses according to the implication that its this area is accepted, and expression, for example, suffer the part for the treatment of plan of the individuality of pathological condition (for example chronic hepatitis B infection), it specifies following factor: such as the plan of the dosage of one or more medicaments that will be administered to the patient, such medicament, treatment and persistent period etc.

Term " pharmacokinetics " uses according to the implication that its this area is accepted, and the research of expression drug disposition effect, for example pharmaceutically-active effect and persistent period, health to they absorb, the speed of distribution, metabolism and elimination etc. (for example using the research of the interferon-' alpha ' concentration among the patients serum that it causes by therapeutic scheme).Term " pharmacodynamics " uses according to the implication that its this area is accepted, and the expression medicine is to health or in vivo or the relation between the research of the microorganism of body surface or parasitic biochemistry and physiological effect, pharmaceutically-active mechanism and drug level and the effect etc. (for example after one or more therapeutic schemes, the research of the concentration of the hepatitis B virus that exists in patient's blood plasma).

Term " successive administration " and " continuous infusion " use in this article interchangeably, and expression with the bulk concentration that for example can avoid medicament during the whole treatment phase fluctuation (mode send medicament such as interferon-' alpha '.This can be (common by the interferon-' alpha ' of constantly or repeatedly injecting substantially the same amount, use the continuous infusion pump installation) realize, for example, at least per hour, one day 24 hours, 7 days weeks, continue the period such as at least 1 week at least 48 weeks, thereby realize the stable state serum levels in during treating.Method according to this area acceptance, for example by subcutaneous or intravenous injection, can be with suitable interval (for example at least per hour), promote or accelerate the amount of deactivation in the body of hepatitis B virus with meeting, use continuous interferon-' alpha ', and lasting reasonable time section.

The device that term " continuous infusion system " expression is such: it is used within the time period that prolongs to patient's the intestines and stomach other places continuous administration fluid, or is used within the time period that prolongs to patient's the intestines and stomach other places application of fluid and need not to set up new site of administration when each application of fluid discontinuously.Described fluid contains one or more therapeutic agents usually.Described device has one or more control elements that hold pond (being used for storing it before infused fluid), pump, conduit, intubate or other pipeline (being used for will holding the pond via pump links to each other with site of administration) and be used for regulating pump usually.Described device can be configured for implanting, and usually implants hypodermically.Under these circumstances, the described pond of holding usually is applicable to percutaneous and refills.

Term used herein " patient or people with hepatitis B infection " refer to, have any patient (comprising pediatric patients) of hepatitis B, and comprise the patient of the patient of the first treatment with hepatitis B infection and the experience treatment with hepatitis B infection and have those department of pediatrics, the first patient with experiencing treatment that treat that chronic hepatitis B infects.These patients with chronic hepatitis B comprise those patients that infected by multiple HBV genotype.

Term used herein " interferon " refers to, the protein family of the species specificity of the height homology of inhibition virus replication and cell proliferation and adjusting immunne response.Usually based on their origin of cell and antigenicity, human interferon is divided into 3 classes: interferon-' alpha ' (leukocyte), interferon-beta (fibroblast), interferon-γ (T cell) and interferon-λ.Alpha-interferon naturally occurring and restructuring can be used for putting into practice the present invention (for example rhIFN-α2a or recombinant interferon-α 2b).Can be with the concentration of many quantitative interferon (such as interferon-' alpha '), for example with pg/ml (for example 100pg/mL) or iu (" IU ", referring to, such as people such as Meager, (2001) Establishment of new and replacement World Health Organisation International Biological Standards for human interferon-α and omega.Journal of immunology Methods, 257,17-33).

The term " antibody " that for example uses when mentioning " can in conjunction with the antibody of HBV " uses with implication the most widely, and contain particularly complete monoclonal antibody, polyclonal antibody, antibody (for example antibody of bispecific) and the antibody fragment of the polyspecific that formed by at least 2 complete antibodies, as long as their keep ability of immunologic opsonin ground identification target polypeptide.

Exemplary aspect of the present invention and embodiment

Present disclosure comprises the result from clinical trial, the new therapeutic scheme of described clinical experimental study, and described new therapeutic scheme comprises: in the patient of experience chronic hepatitis C treatment, the interferon-' alpha ' that continuous subcutaneous administration and ribavirin are combined.The clinical data that obtains from this test shows that the continuous subcutaneous administration of interferon-' alpha ' can be higher than the time period that critical effectiveness threshold value prolongs for the bulk concentration of keeping this therapeutic agent.This clinical data further shows, eliminates hepatitis C virus among the patient that these therapeutic schemes can the conventional antiviral therapy of former confirmation be difficult to treat.As a result, that therapeutic scheme disclosed herein has solved is long-standing, but not have the needs of solution, particularly optimize the needs of the administration of interferon-' alpha ' in the mode that overcomes the problem relevant with the conventional therapy scheme.Those skilled in the art are apparent, can make different combinations and/or modification and variation in such therapeutic scheme, and this depends on the different physiological parameter of observing in the patient.For example, make an explanation or the feature described can be used for another embodiment as the part of an embodiment, to produce other embodiment.

Although the infectious agent with the interferon-' alpha ' treatment in the clinical trial that is discussed below is hepatitis C virus, the method relevant with lasting interferon-' alpha ' level and data go in some other treatment background.Particularly, interferon-' alpha ' has effective antiviral activity, but can directly not act on virus or copy complex.On the contrary, interferon-' alpha ' works by the gene (ISG) of inducing IFN to stimulate, and this can set up non-viral specific antiviral state in the patient.For example, observing interferon-' alpha ' usually can promote memory T-cell proliferation, prevention T-apoptosis and stimulate natural killer cell activation and dendritic cell maturation.

HBsAg removes and seroconversion (by characterizing in the loss that is with or without anti--HBs antibody and forms lower serum HBsAg) be to the outstanding feature thing of the successful immunological response of HBV infection and to clinical cure near the result.The HBsAg removing is defined as, and HBsAg disappears from serum.The HBsAg seroconversion is defined as, and HBsAg disappears and anti--HBs antibody occurs.When the removing of considering to be used for the treatment of the different therapeutic agents that HBV infects and seroconversion are renderd a service, the research indication, therapy based on interferon, peg-IFN α (peg interferon a particularly, PEGIFNa), realize that HBsAg removes and seroconversion aspect obviously be better than the nucleoside/nucleotide analog (referring to, such as people such as Lau, N Engl J Med 2005,352:2682-2695; The people such as Marcellin, N EnglJ Med 2004,351:1206-1217; The people such as Marcellin, Gastroenterology 2009,136:2169-2179; The people such as Chan, Ann Intern Med 2005,142:240-250; The people such as Chan .Hepatology 2005,41:1357-1364; With the people such as Tian, Zhonghua Gan Zang Bing Za Zhi 2006,14:806-810.The nucleoside/nucleotide analog also shows other shortcoming, the course for the treatment of that comprises the development of resistance and do not have to establish.

In some research on the impact of interferon-' alpha ' in the individuality that HBV infects, notice, HBsAg clearance rate in the patient who accepts the PEG-IFNa monotherapy is significantly higher than those patients that accept conventional IFNa monotherapy, namely may be because their different pharmacokinetics and pharmacodynamics distribute the phenomenon cause (referring to, such as people BMC Infectious Diseases2011 such as Li, 11:165; The people Zhonghua Gan Zang Bing Za Zhi 2006 such as Tian, 14:806-810; The people Chinese J Exp Clin Virol 2006 such as Cui, 20:331-333; The people Journal of Medical Forum 2010 such as Li, 31:51-53; With people Clinical Medical Journal of China 2006,13 such as Guan; 959).In these researchs, use conventional (not Pegylation) IFNa the next day of per once, it reaches rapidly peak concentration in blood, and the compartment of terrain reduces.Use weekly PEG-IFNa once, its effective haemoconcentration continue a week (referring to such as people such as Lau, Liver International 2009,29:125-129).At present, about the up-to-date treatment guide prompting of the management of CHB, should use PEG-IFNa and substitute conventional IFNa, to improve antiviral response.

As disclosed herein, if regulate the administration of interferon-' alpha ' (for example not peg-IFN) in the mode (for example by the continuous infusion pump) that in the patient, produces this lasting cytokine levels, it is believed that, the interferon-' alpha ' that use in outer seedbed like this can promote it preventing immunodepletion and strengthening for the effect in the adaptive immune response of hepatitis B virus, thereby causes larger removing and seroconversion speed.

Embodiment of the present invention comprise: continuous subcutaneous administration interferon-' alpha ' is being higher than the critical lasting time period of effectiveness threshold value in the body in order to keep this therapeutic agent by the bulk concentration among the hepatitis b virus infected patient.For example, exemplary embodiment of the present invention comprises: continuous subcutaneous administration interferon-' alpha ' is higher than at least at least 1 week at least 48 weeks of 100-700pg/mL (for example 300pg/mL) in order to keep the bulk concentration of this therapeutic agent.In typical embodiments of the present invention, the embodiment of the not Pegylation of interferon-' alpha ' concentration (for example 100-700pg/mL) expression interferon-' alpha ' 2a or interferon-' alpha ' 2b (is for example produced by Schering Corporation

A).Perhaps, described interferon-' alpha ' can be by Pegylation.For the embodiment of the present invention that comprise peg-IFN-α, the method that can use this area to accept is calculated equipotent concentration, for example the specific activity by calculating following interferon and/or the ratio of molecular weight: 1) not peg-IFN-α such as

A, and 2) peg-IFN-α is such as the happy energy of wearing

Then use the association from this analysis, to measure for example debita spissitudo of peg-IFN-α.

Shown in disclosed data among below the embodiment 2 for example and as shown in the accompanying drawing 3-8, the concentration of sending according to the Intron A interferon-' alpha ' of the not Pegylation of therapeutic scheme disclosed herein, can produce lasting in vivo interferon-' alpha ' concentration, and these lasting interferon-' alpha ' bulk concentrations can be used for eliminating HCV with comparing according to conventional therapy scheme number in the cards in the infected individual of big figure more.This steadily and surely replys illustration by what for example observe among the patient of registration in this test, described patient is to conventional H CV treatment answer failed (referring to, Fig. 5 for example).Be not subjected to the constraint of specific scientific theory, surprising the replying of observing in the patient of routine treatment refractory can be derived from the interferon-' alpha ' with following effectiveness threshold value: (1) only about 50% according to the patient of conventional therapy Regimen Chemotherapy in satisfy; (2) thus when using the cyclical level of keeping the interferon-' alpha ' among the patients serum by the continuous infusion device and be higher than the lasting time period of Css (for example at least 100-700pg/mL) (for example at least 1-48 week), in the patient of big figure more, satisfy.

Because clinical trial disclosed herein comprises the patient of verified conventional H CV antiviral therapy refractory, among the embodiment 2 below disclosed the and data acknowledgement that shows in the accompanying drawings the surprising effectiveness of therapeutic scheme disclosed herein.In addition, as if the continuous subcutaneous administration of interferon-' alpha ' can promote using the number of the dose dependent side effect of observing among the patient of interferon-' alpha ' and/or the minimizing of seriousness according to the conventional therapy scheme, for example by to improve the patient mode continuous administration interferon-' alpha ' of the toleration of interferon-' alpha ' dosage (for example being compared with the conventional therapy scheme, described conventional therapy scheme comprises, for example, weekly 3 times or every day 1 this cytokine of bolus injection).The following ability of these therapeutic schemes: the effectiveness of improving the interferon-' alpha ' scheme, and make great efforts simultaneously to reduce the adverse side effect of usually relevant with using of this cytokine dose dependent, a unexpected technological merit can be provided, not yet predict this technological merit based on the content of in this technical field, instructing.In addition, as known in the art, interferon-' alpha ' can directly not act on virus or copy complex, on the contrary, induces effectively total antiviral activity.Under this background, if use (for example via the continuous infusion pump) in the mode that causes this lasting cytokine levels, it is believed that, the interferon-' alpha ' that use in outer seedbed like this can prevent immunodepletion, and strengthens for some infectious agent adaptive immune response of (comprising hepatitis B virus).

An exemplary embodiment of the present invention is, a kind of method of being used interferon-' alpha ' by hepatitis b virus infected patient of giving, described method comprises: use the continuous infusion device, use hypodermically interferon-' alpha ' for the patient, wherein use is enough to keep the cyclical level of interferon-' alpha ' in described patients serum and is higher than at least therapeutic scheme at least 1 week at least 48 weeks of Css of 100pg/mL, and interferon-' alpha ' is administered to described patient.In certain embodiments of the invention, the therapeutic scheme of use is enough to keep the cyclical level of interferon-' alpha ' in described patients serum and is higher than at least Css of 100-700pg/mL.

In some embodiment of the present invention, the therapeutic scheme of use is enough to so that the average cyclical level of interferon-' alpha ' in the patients serum is higher than at least period at least 1 week at least 48 weeks of Css of 100-700pg/mL.For example, in such embodiment, the average cyclical level of interferon-' alpha ' in the patients serum comprises: the average interference element of (or every day or per 2 months or every month) one group of interferon-' alpha ' serum-concentration value measuring-α serum-concentration value weekly during treating.In some embodiment of the present invention, the therapeutic scheme of use is enough to so that the average cyclical level of interferon-' alpha ' in the patients serum is higher than at least period at least 1 week at least 48 weeks of Css of 100-700pg/mL.For example, in such embodiment, the average cyclical level of interferon-' alpha ' in the patients serum comprises: the middle interferon-' alpha ' serum-concentration value of (or every day or per 2 months or every month) one group of interferon-' alpha ' serum-concentration value measuring weekly during treating.

As at length discussing in the part below, embodiment of the present invention comprise the Extraordinary therapeutic scheme, and described therapeutic scheme is customized to viral distinctive one or more features of considering the patient and/or infecting described patient.Embodiment of the present invention also comprise such therapeutic scheme: described therapeutic scheme is customized to and uses the therapeutic combination with certain character (for example controlling the character that the bioavailability of therapeutic agent in compositions distributes) of selecting.Such embodiment is, use the continuous infusion device, interferon-' alpha ' is administered to hypodermically patient's method, wherein said patient is accredited as the infection that is subject to hepatitis B virus, described hepatitis B virus has the specific gene type, for example genotype A, B, C, D, E, F, G or H.In some embodiment of the present invention, before the begin treatment scheme, check described patient, so as to differentiate one or more HBV antigens (for example HBsAg or HBeAg) and/or for the antibody of one or more HBV antigens (for example anti--HBsAg, IgM anti--existence or the state of HBc or anti--HBeAg).Embodiment of the present invention can further be used selected compositions in therapeutic scheme disclosed herein, for example experienced the interferon-' alpha ' of chemical modification process, described chemical modification process is used for modifying one or more bioavailability features, for example puts together with polyhydric alcohol (for example Polyethylene Glycol).Perhaps, embodiment of the present invention can be used such interferon-' alpha ': compare with the interferon material that uses in conventional H BV therapy (Zhu Ru Pai Luoxin, the happy energy etc. of wearing), it has closer imitation in vivo pharmacodynamics and the pharmacokinetic profiles of the interferon-' alpha ' (interferon-' alpha ' of for example not puting together polyhydric alcohol) of discovery.Be not subjected to the constraint of specific scientific theory or principle, it is believed that, not more natural pharmacodynamics and the pharmacokinetic profiles of peg-IFN-α, and the continuous and consistent mode used to the patient of this polypeptide of with it combination (for example can reduce or avoid weekly the mode of the serum-concentration fluctuation of 3 times or the interferon-' alpha ' that occurs in 1 drug dosage schedule every day), the useful result that the meeting promotion is observed in clinical testing data (referring to, for example embodiment 2).In certain embodiments, use therapeutic scheme, interferon-' alpha ' is administered to described patient, and the cyclical level that described therapeutic scheme is enough to keep the interferon-' alpha ' among the patients serum after measured is higher than at least 100,125,150,175,200,225,250,275,300,325,350,375,400,425,450,475,500,525,550,575,600,625,650,675 or at least 1 week at least 48 weeks of Css of 700pg/mL.

The embodiment of the distinctive one or more features of exemplary consideration patient of the present invention (for example the exogenous interferon of patient's uniqueness-α removes or the speed of metabolism) is, a kind of method of being used interferon-' alpha ' by hepatitis b virus infected patient of giving, described method comprises: the interferon-' alpha ' of using test dose for described patient, the concentration of then observing the circulation interferon-' alpha ' among the patients serum that the interferon-' alpha ' of described dosage causes.In such embodiments, the interferon-' alpha ' of described dosage (for example at first therapeutic scheme that is used for using interferon-' alpha ') can be used by in the several different methods any, and described method comprises: bolus injection, repeatedly be interrupted injection, continuous infusion etc.In this embodiment, then use the concentration of the circulation interferon-' alpha ' that is caused by test dose to design the therapeutic scheme of patient-specific, namely consider the factor of patient-specific and the therapeutic scheme that comprises the steps: use the continuous infusion device, be higher than the amount of specific bulk concentration special time period (for example at least 100pg/mL at least 1 week at least 48 weeks) with the cyclical level that is enough to keep the interferon-' alpha ' among the patients serum, use hypodermically interferon-' alpha ' for the patient.In relevant embodiment of the present invention, select the therapeutic scheme of patient-specific, with: keep serum interferon among the patient-α concentration in the value greater than Ccrit (namely with the patient therapeutic scheme being replied the concentration threshold that matches lastingly), and/or keep serum interferon among the patient-α concentration at particular value: wherein the practical effect of patient's interferon-' alpha ' is greater than the critical effectiveness of interferon-' alpha ', and/or the cyclical level of keeping the interferon-' alpha ' among the patients serum is higher than at least 100,125,150,175,200,225,250,275,300,325,350,375,400,425,450,475,500,525,550,575,600,625,650,675 or the Css of 700pg/mL.

A concrete exemplary embodiment of the present invention is, a kind of method of being used interferon-' alpha ' by hepatitis b virus infected patient of giving, described hepatitis B virus has genotype A, B, C, D, E, F, G or H, described method comprises: with the combined ground of the interferon-' alpha ' 2a/2b that uses the continuous infusion device to use hypodermically, use oral nucleoside/nucleotide inhibitor for described patient, wherein: before using interferon-' alpha ', check described patient, in order to differentiate the genotype of virus and/or one or more HBV antigen (for example HBsAg or HBeAg) and/or for the antibody of one or more HBV antigens (anti--HBsAg for example, IgM is anti--existence or the state of HBc or anti--HBeAg); Described interferon-' alpha ' is not puted together with polyhydric alcohol; The cyclical level that use is enough to keep the interferon-' alpha ' among the patients serum is higher than at least therapeutic scheme at least 1 week at least 48 weeks of Css of 100-700pg/mL, and described interferon-' alpha ' is administered to the patient; And described therapeutic scheme can make the HBV level among the patient reduce at least 2 logarithms (100 times).Certain embodiments of the present invention also comprise: observe the in-vitro multiplication that the T cellular response from described patient exposes in interferon-' alpha '.For example, as in embodiment 2, pointing out, at T=24 hour, see in the nonresponder that especially IFN-α is to the desensitization of cell aspect the T cell proliferation.So certain embodiments of the present invention can obtain with such proliferation test how the therapeutic scheme that comprises interferon-' alpha ' being made the information of replying about the patient.Many tests in response to the T cell proliferation of interferon-' alpha ' are known in the art, they can be fit to such observation (referring to, such as people such as Folgori, Gut, (2006) 55 (7): 914-916).

Embodiment of the present invention comprise: the system that is used for using interferon-' alpha ' to the patient with hepatitis B infection.In such embodiment of the present invention, described system for example can comprise: the continuous infusion pump, and it has the medicament that comprises interferon-' alpha ' and holds the pond; Processor, it may be operably coupled to described continuous infusion pump, and comprising that instruction group, described instruction group cause described continuous infusion pump according to therapeutic scheme interferon-' alpha ' to be administered to described patient, described therapeutic scheme comprises: use hypodermically interferon-' alpha ' for described patient; The cyclical level that wherein said therapeutic scheme is enough to keep the interferon-' alpha ' among the patients serum is higher than at least at least 1 week at least 48 weeks of Css of 100-700pg/mL.

A relevant embodiment of the present invention is that a kind of for using the system of interferon-' alpha ' for the patient with hepatitis B infection, described system comprises: the continuous infusion pump, and it has the medicament that comprises interferon-' alpha ' and holds the pond; Processor, it may be operably coupled to described continuous infusion pump, and comprises the instruction group, and described instruction group causes described continuous infusion pump that interferon-' alpha ' is administered to described patient.In such embodiment of the present invention, described system uses interferon-' alpha ' according to the therapeutic scheme of the patient-specific that is prepared as follows: according to first therapeutic scheme, interferon-' alpha ' is administered to described patient; Circulation interferon-' alpha ' concentration in the blood samples of patients that observation is caused by first therapeutic scheme; Then use by first therapeutic scheme circulation interferon-' alpha ' that cause, that observe concentration, with the therapeutic scheme of preparation patient-specific.Usually, in such embodiments, the therapeutic scheme of patient-specific comprises: be higher than at least amount at least 1 week at least 48 weeks of Css of 100-700pg/mL with the cyclical level that is enough to keep the interferon-' alpha ' among the patients serum, use hypodermically interferon-' alpha ' for the patient.

System implementation plan of the present invention can be designed for the situation that hepatitis B virus belongs to specific gene type (for example genotype A, B, C, D, E, F, G or H).In some system implementation plan of the present invention, using interferon-' alpha ' (interferon-' alpha ' of for example not puting together with polyhydric alcohol) before, check described patient, so as the genotype of identifying virus and/or one or more HBV antigen (for example HBsAg or HBeAg) and/or for the antibody of one or more HBV antigens (for example anti--HBsAg, IgM anti--existence or the state of HBc or anti--HBeAg).Usually, in such system, the cyclical level that described therapeutic scheme is enough to keep the interferon-' alpha ' among the patient is higher than at least 100,125,150,175,200,225,250,275,300,325,350,375,400,425,450,475,500,525,550,575,600,625,650,675 or the concentration of 700pg/mL, randomly, in such embodiments, described therapeutic scheme is used the persistent period at least 1 week at least 48 weeks.Usually, described therapeutic scheme is enough to make the HBV level among the patient to reduce at least 2 logarithms (100 times) or 3 logarithms (1000 times).

Other embodiment of the present invention comprises, be used for interferon-' alpha ' is administered to the interferon-' alpha ' (for example not peg-IFN-α 2a) of the patient's who is infected by hepatitis B virus (HBV) method, described method comprises: use continuous infusion device (for example hypodermically), interferon-' alpha ' is administered to described patient, wherein use is enough to keep the cyclical level of interferon-' alpha ' in described patients serum and is higher than at least 100pg/mL (or at least 200,300,400,500,600 or 700pg/mL) at least 4 weeks (or at least 5 of average steady state concentration, 6,7,8,12,24,36 or 48 weeks) therapeutic scheme is administered to described patient with interferon-' alpha '.Usually, in such embodiments, interferon-' alpha ' is used for, interferon-' alpha ' is administered to by in hepatitis b virus infected patient's the method in combination with antiviral nucleotide/nucleoside analog.

A relevant embodiment comprises, be used for interferon-' alpha ' is administered to the interferon-' alpha ' of the patient's who is infected by hepatitis B virus (HBV) method, described method comprises: use the interferon-' alpha ' (for example according to first therapeutic scheme for HBV) of test dose for described patient; The concentration of the circulation interferon-' alpha ' among the patients serum that observation is caused by the interferon-' alpha ' of test dose; Then the therapeutic scheme for preparing patient-specific with the circulation interferon-' alpha ' concentration of so observing, the therapeutic scheme of wherein said patient-specific comprises: use the continuous infusion device, be higher than at least amount of the Css of 100pg/mL with the cyclical level that is enough to keep the interferon-' alpha ' among the patients serum, use hypodermically interferon-' alpha ' for the patient.This purposes can comprise for example following step in addition, such as: hepatitis B virus is accredited as genotype A or genotype D virus; The in-vitro multiplication that observation exposes in interferon-' alpha ' from described patient's T cellular response; And/or use the cyclical level be enough to keep the interferon-' alpha ' among the patients serum to be higher than at least 200,300,400,500,600 or the therapeutic scheme of the patient-specific at least 4 weeks of Css of 700pg/mL, interferon-' alpha ' is administered to the patient.

Embodiment of the present invention also comprise, a kind of system for interferon being administered to the patient with hepatitis B infection, and described system comprises: the continuous infusion pump, it has the medicament that comprises interferon-' alpha ' and holds the pond; Processor, it may be operably coupled to described continuous infusion pump, and comprising that instruction group, described instruction group cause described continuous infusion pump according to therapeutic scheme interferon-' alpha ' to be administered to described patient, described therapeutic scheme comprises: use hypodermically interferon-' alpha ' for described patient; The cyclical level that wherein said therapeutic scheme is enough to keep the interferon-' alpha ' among the patients serum is higher than at least at least 4 weeks of Css of 100pg/mL.Randomly, in this system, the parameter that the processor in the described system is regulated the therapeutic scheme of patient-specific with the polynucleotide sequence information that records, wherein said parameter comprises: the persistent period that interferon-' alpha ' is used; Or interferon-' alpha ' dosage.

Another embodiment of the invention comprises: interferon-' alpha ' is used for the treatment of purposes in the compositions of hepatitis B infection in production, described compositions is used in the continuous infusion device, wherein produce described interferon-' alpha ' compositions, be higher than at least Css at least 24,48,72,96,120,144 or 168 hours (and/or at least 1 week at least 48 weeks) of 100pg/mL with the cyclical level that allows described continuous infusion device when using hypodermically, to keep the interferon-' alpha ' among the patients serum.Randomly, described interferon-' alpha ' compositions is used for patient at least 5,6,7,8,12,24,36 or 48 weeks, is higher than at least 100,200,300,400,500,600 or the average steady state concentration threshold of 700pg/mL with the cyclical level of keeping the interferon-' alpha ' among the patient.Usually, in such purposes embodiment, described interferon-' alpha ' is not puted together with polyhydric alcohol.Randomly, in such purposes embodiment, described interferon-' alpha ' is used for being accredited as the patient with the single nucleotide polymorphism relevant with chronic HBV infection (SNP), and wherein said SNP is selected from: rs2856718, rs7453920, rs3077, rs9277535, rs2284553, rs9808753 or rs17401966.In some purposes embodiment, described interferon-' alpha ' is used for by the patient of hepatitis b gene type A or genotype D viral infection.In certain embodiments, the use of interferon-' alpha ' can make the HBV level among the patient reduce at least 2 logarithms (100 times) or 3 logarithms (1000 times) after 1,2,4,810,12,14 or 16 weeks.Randomly, in embodiments of the invention, described continuous infusion device is designed for mobile purposes, for example has the size less than 15x15 centimetre (and usually less than 15x15x5 centimetre), and/or operationally being attached to the interface of the motion of convenient patient when using the continuous infusion pump, wherein said interface comprises clip, band, hasp, anchor clamps or strip of glue (adhesive strip).

As noted above, the cyclical level that embodiment of the present invention are designed to keep the interferon-' alpha ' among the patients serum is higher than target Css (for example at least 100-700pg/mL), thereby increases the effectiveness of this polypeptide.Term " stable state " is used for describing such situation in this article: wherein variable (the circulation interferon-' alpha ' concentration that is for example caused by therapeutic scheme) is kept above threshold value and/or the substantial constant of setting, although ongoing process makes great efforts to change their (for example removing in the body of liver and kidney exogenous interferon-' alpha ').Under the background of therapeutic scheme, when eliminating speed near medicine-feeding rate, usually reach stable state.Under this background, term " is higher than at least Css of 100pg/mL " and is used for comprising such situation: in the process of therapeutic scheme, described patient may show the interferon-' alpha ' level of fluctuation, but fluctuation can not drop to the average or middle interferon-' alpha ' cyclical level that is lower than target threshold value (for example at least 100pg/mL) in these bodies.A relevant embodiment of the present invention is, a kind of interferon-' alpha ' is administered to by hepatitis b virus infected patient's method, described method comprises: use the continuous infusion device, use hypodermically interferon-' alpha ' for the patient, the cyclical level that wherein said therapeutic scheme is enough to keep the interferon-' alpha ' among the patients serum is higher than target level (for example 100-700pg/mL).This embodiment of the present invention can be used for using the interferon-' alpha ' period at least 1 week at least 48 weeks.

Some embodiment of the present invention comprises: based on the Extraordinary patients factors, such as infectious parameter (for example hepatitis B virus carrying capacity) and therapeutic agent responsiveness parameter (bulk concentration of the interferon-' alpha ' that is for example caused to using of patient by interferon-' alpha '), obtain the method for the scheme responsiveness distribution of patient-specific, then the operational version responsiveness distributes the therapeutic scheme for the patient's design optimization that suffers pathological conditions (for example hepatitis B infection).In specific embodiments, such method comprises: measure pharmacokinetics (pK) and pharmacodynamics (pD) parameter (the body internal interference element that is for example caused by the given dose that is administered to this patient-α circulation composition) of patient-specific, then design new therapeutic scheme with these parameters.This common following realization: by the dosage of the therapeutic agent that regulate to use, or speed or the persistent period of using by the adjustment for the treatment of agent, so that the effectiveness of refining therapeutic scheme and/or optimizing therapeutic regimen.In certain embodiments, the invention provides a kind of computer implemented system, it is used for: (1) sends interferon-' alpha ' according to initial administration parameter (for example in the following embodiments disclosed parameter); And/or (2) based on the patient to the replying of initial administration parameter, the scheme responsiveness that makes up patient-specific distributes; And/or (3) use the therapeutic scheme (scheme that for example comprises the variation of initial administration parameter) of the optimization that designs in response to this distribution, delivering therapeutic agents.

In some embodiment of the present invention, according to one group of initial administration parameter (for example in the following embodiments those disclosed), use interferon-' alpha ' to the patient, then observe by this and organize the body-internal-circulation interferon-' alpha ' level that initial administration parameter causes.In this embodiment, then use the body-internal-circulation interferon-' alpha ' level of in single patient, observing to make up one or more other administration parameters, for example be used for those parameters at therapeutic process horizontal special time period of control agent internal recycle interferon-' alpha ' (for example being higher than the target threshold value to increase circulation interferon-' alpha ' concentration) in particular patient.Randomly, this embodiment of the present invention is used the therapeutic agent modeling parameters, such as those disclosed in international application no PCT/US2008/078843 and PCT/US2009/038617 (their content is incorporated into by reference).

An exemplary embodiment of the present invention is, a kind of method that distributes to design the therapeutic scheme (such as those disclosed in the following embodiments) of patient-specific from the scheme responsiveness of the patient-specific that obtained by hepatitis b virus infected patient of using.The embodiment of the method comprises: use at least a therapeutic agent (for example interferon-' alpha ') as test dose (randomly for described patient, dosage as the part of first therapeutic scheme), then obtain pharmacokinetics or pharmacodynamics parameter from described patient, in order to observe the patient specificity of test dose is replied.Usually, the pharmacokinetics of observation or pharmacodynamics parameter comprise: the concentration for the treatment of agent in the blood samples of patients that is caused by test dose, and/or the concentration of the hepatitis B virus that exists in the patient.In this embodiment of the present invention, the scheme responsiveness that then practitioner can use the pharmacokinetics observed in the patient in response to test dose or pharmacodynamics parameter (the body internal interference element that is for example caused by the given dose that is administered to this patient-α circulation composition) to obtain patient-specific distributes.The scheme responsiveness distribution of this patient-specific is based on the patient's of HBV infection Extraordinary physiology, and must consider multiple host factor, such as race's division, obesity, insulin resistance, hepatic fibrosis and viral factor (such as genotype and baseline virus load).Then distribute to design the therapeutic scheme (therapeutic scheme that for example comprises the steps: be higher than at least amount at least 1 week at least 48 weeks of Css of 100-700pg/mL with the cyclical level that is enough to keep the interferon-' alpha ' among the patients serum, use hypodermically interferon-' alpha ' for described patient) of patient-specific with the scheme responsiveness of this patient-specific.

In typical embodiments of the present invention, select therapeutic scheme to control serum interferon among the patient-α concentration.In exemplary embodiment of the present invention, select therapeutic scheme to keep serum interferon among the patient-α concentration value greater than the critical concentration " C relevant with therapeutic effect _Crit", namely induce and/or promote the patient to the concentration threshold of replying lastingly of therapeutic scheme.Term critical concentration " C _Crit" the following implication accepted according to its this area uses: be in and be higher than material concentration (for example concentration of the ectogenic interferon-' alpha ' of circulation) when generating function changes in cell or organ (referring to; such as people such as Nordberg; Pure Appl.Chem.; 76,1033-1082 (2004)).The technical staff know critical efficacy parameter relevant with interferon-' alpha ' in HCV infects (referring to, such as people such as Dahari, J Theor Biol247 (2): 371-81 (2007).

Disclosure provided herein provides and has been used for obtaining C _CritOther method of parameter information.For example, in certain embodiments of the invention, use a patient or one group of patient to the assessment of replying of one or more predetermined therapeutic schemes (for example in embodiment 2 disclosed 6MIU/ days, 9MIU/ days and 12MIU/ days), can obtain C _CritParameter information.As discussed in more detail below, in other embodiments of the present invention, can empirically measure C _CritParameter information, and can be such as the pharmacokinetics/pharmacodynamics of the interferon of considering to use and the factor (such as the HBV genotype of infected patient and/or patient's body weight, treatment history, health status etc.) that may affect the patient-specific of this threshold value.

In certain embodiments of the invention, the therapeutic scheme of design patient-specific, be higher than set point with the blood plasma interferon-' alpha ' level of keeping among the patient, for example be higher than at least 100,125,150,175,200,225,250,275,300,325,350,375,400,425,450,475,500,525,550,575,600,625,650,675 or the concentration of 700pg/mL.In other embodiments, the therapeutic scheme of selection patient-specific is regulated the interferon-' alpha ' concentration among the patient, thereby reduces the side effect of the dose dependent of observing in using the interferon-' alpha ' process.In some embodiment of the present invention, select the therapeutic scheme of patient-specific to keep serum interferon among the patient-α concentration at particular value: wherein the practical effect of patient's interferon-' alpha ' is greater than the critical effectiveness of interferon-' alpha '.In other embodiments, the therapeutic scheme of selection patient-specific is regulated the interferon-' alpha ' concentration among the patient, thereby in the different phase that the hepatitis B virus carrying capacity decays, uses different interferon-' alpha ' dosage regimens to the patient.

In certain embodiments of the invention, measure such as following phenomenon: level in the body of the reagent of using, the practical effect of such reagent and critical effectiveness limit, and level in the body of HBV.Randomly, 0,1,2,3,4,6 or 7 day (for example the 1st week) after the administering therapeutic scheme, and/or the 2nd, 3,4,5,6,7,8,9,10,11,12 weeks etc. until for example arbitrary day of the 48th week, carry out such mensuration.Some embodiment of method and system of the present invention comprises: continuing to use interferon-' alpha ' above in the therapeutic scheme in 48 weeks, for example, use therein described therapeutic scheme 50, the scheme in 54,58,62,66,70 or 72 weeks.In an exemplary embodiment, after therapeutic scheme begins, can make the patient return safety and effect evaluation: before the 4th week, to estimate weekly, and during 48 week treatments, estimated in per 28 days afterwards, before the 72nd week, follow up a case by regular visits to weekly or per month.Randomly, between the 0th day and the 7th day, more preferably the 0th day near the 2nd day, measure practical effect and critical effectiveness limit.Perhaps, can during whole treatment, carry out discontinuously this mensuration, for example the Extraordinary patient of different therapeutic schemes be replied with consideration.Those of ordinary skills can undoubtedly recognize, different pharmacokineticss, pharmacodynamics and dynamics of virus model (such as herein described those) can be used for realizing this purpose.

In some embodiment of the present invention, before the begin treatment scheme, and/or the one or more times in administering therapeutic scheme process, and/or after finishing therapeutic scheme, check the parameter relevant with the HBV infection and/or the parameter relevant with the therapeutic scheme that is used for the treatment of the HBV infection.Such parameter comprises: for example, and baseline virus load and other parameter relevant with hepatitis B infection (for example, hepatic fibrosis or liver cirrhosis), and/or such as the existence of the blood serum designated objects such as alanine aminotransferase (ALT).Such parameter comprises in addition: the biochemical marker of inducing in response to interferon-' alpha ' (interferon-' alpha ' of for example using according to therapeutic scheme), such as 1-(2-amino-4-hydroxy-6-pteridinyl)-1,2,3-propanetriol and 2 ', 5 '-oligoadenylate synthetase (OAS) etc.

Of the present invention comprise observing infect relevant one or more parameters with HBV and/or the exemplary of relevant parameter comprises with being used for the treatment of therapeutic scheme that HBV infects: be used for interferon-' alpha ' is administered to by hepatitis b virus infected patient's method and/or system, it is enough to make the 1-(2-amino-4-hydroxy-6-pteridinyl)-1,2,3-propanetriol level than the front level increase at least 10,20,30,40 or 50% for the treatment of.In some embodiment of the present invention, described therapeutic scheme is enough to make 1-(2-amino-4-hydroxy-6-pteridinyl)-1,2,3-propanetriol level increase at least 1,2,3 or 4ng/mL (referring to, Fig. 1 for example).In other embodiments, be used for to give the method and/or the system that are used interferon-' alpha ' by hepatitis b virus infected patient, using is enough to make 2 ', 5 ' oligoadenylate synthetase level than treatment before level increase at least 2,4,6,8 or 10 times therapeutic scheme.In some embodiment of the present invention, described therapeutic scheme is enough to make 2 ', 5 ' oligoadenylate synthetase level increase at least 25,50,75 or 100pg/dL.The method of in the measurement of 1-(2-amino-4-hydroxy-6-pteridinyl)-1,2,3-propanetriol, using and material, referring to such as people such as Fernandez, J Clin Gastroenterol.200030 (2): 181-6.The 1-(2-amino-4-hydroxy-6-pteridinyl)-1,2,3-propanetriol test that can commercial obtain comprises: those that are provided by the Quest laboratories Teterboro (test number 97402P) of New Jersey, with HENNING test (BRAHMS Diagnostica GmbH, D-12064, Berlin, Germany).2 ', the method for using in the measurement of 5 ' oligoadenylate synthetase and material, referring to such as people such as Podevin, J Hepatol.1997 (2): 265-71.The method of using in the measurement of beta-2-microglobulin and material are referring to for example Malaquarnera Eur J Gastroenterol Hepatol.2000Aug; 12 (8): 937-9.

The second index of another running check of the effectiveness of therapeutic scheme is the variation of serum alanine aminotransferase (ALT) level.Generally speaking, less than about 80, less than about 60, less than about 50 or about 40 ius/the ALT level that rises serum is considered to normal.Under this background, in some embodiment of the present invention, therapeutic scheme disclosed herein can make the ALT level be reduced to less than about 200IU/L, less than about 150IU/L, less than about 125IU/L, less than about 100IU/L, less than about 90IU/L, less than about 80IU/L, less than about 60IU/L or less than about 40IU/L.Certain embodiments of the present invention comprise: be used for interferon-' alpha ' is administered to by hepatitis b virus infected patient's method and/or system, level reduced at least 2,3,4 or 5 times before it was enough to make alanine aminotransferase (ALT) level than treatment.In some embodiment of the present invention, described therapeutic scheme is enough to make the reduction at least 25,50,75 of alanine aminotransferase level or 100IU/L.The method of in the measurement of alanine aminotransferase (and/or aspartate transaminase), using and material, referring to such as people such as Sterling, Dig Dis Sci.2008May; 53 (5): 1375-82, electronics was open in 2007.

As noted above, embodiment of the present invention can check: for example, 1-(2-amino-4-hydroxy-6-pteridinyl)-1,2,3-propanetriol among the patient and/or 2 ', the level of 5 ' oligoadenylate synthetase and/or ALT and disclosed herein and/or other mark known in the art, for example, with the process of state before the treatment that checks the patient and/or assessment therapeutic scheme and/or the therapeutic scheme of design patient-specific.Embodiment of the present invention also can check the combination of these parameters and/or other parameter, described other parameter for example: the beta-2-microglobulin level in patient's blood plasma; The genotype of hepatitis B virus or hypotype; Patient's former therapeutic treatment history; And/or existence or the degree of the side effect that is caused by first therapeutic scheme; And/or the existence of the blood serum designated object relevant with hepatic fibrosis.The blood serum designated object of hepatic fibrosis is in addition including, but not limited to 7S domain, C-end precollagen I peptide and the laminin，LN of: hyaluronate, N-end precollagen III peptide, IV Collagen Type VI.Other biochemical marker of hepatic fibrosis comprises: α-2-macroglobulin, haptoglobin, gamma Globulin, ApoA and GGTP.

Such as the disclosure institute illustration of the following examples, in embodiments of the invention, also can observe existence or degree such as following factor: depression, neutrophil cell reduce disease, thrombocytopenia and one or more general influenza sample symptoms, and they can be caused by using of interferon-' alpha '.The method of using in the measurement of depression and material are (for example Beck Depression Inventory) well-known in the art, and referring to such as people such as Golub, J Urban Health.2004Jun; 81 (2): 278-90.It is well-known in the art reducing the method and the material that use in the measurement of disease and thrombocytopenia at neutrophil cell, and referring to such as people such as Koskinas, Med Virol.2009 March, 24; 81 (5): the people such as 848-852 and Nudo, Can J Gastroenterol.2006 JIUYUE; 20 (9): 589-92.

As noted above, by with use conventional therapy scheme number in the cards to compare in the infected individual of big figure more to eliminate HCV, embodiment of the present invention can provide technological merit in the art.Other technological merit of embodiment of the present invention comprises, for example, and the reducing or eliminating of the harmful side effect that can be caused by the interferon-' alpha ' of using according to the conventional therapy scheme.For example, in typical embodiments of the present invention, the continuous infusion of interferon-' alpha ' allows this cytokine to reach in vivo high circulation composition, reduce or eliminate concurrently simultaneously disadvantageous immunology and/or hematology reaction, described reaction for example can occur in when injecting when using this cytokine (for example, weekly injecting of the 3 inferior interferon-' alpha 's of using).Under this background, embodiment of the present invention comprise: use the continuous infusion device, use the interferon-' alpha ' of doses to the patient, reduce disease and/or the generation of thrombocytopenia and/or bringing out of autoimmune disease in order to reduce or eliminate neutrophil cell, described disease is used this cytokine (for example conventional H BV therapy) time and is observed injecting.Exemplary embodiment of the present invention comprises: use the continuous infusion device, use the interferon-' alpha ' of doses to the patient, thereby make bringing out and injecting the therapeutic scheme of using this cytokine and compare and reduce or eliminate at least 10,20,30,40 or 50% of the generation of disadvantageous immunology and/or hematology reaction (reducing disease and/or thrombocytopenia such as neutrophil cell) and/or autoimmune disease (for example thyroiditis).

In case select and administering therapeutic scheme (for example disclosed among below the embodiment 1 or 2), then the practitioner can obtain the scheme responsiveness distribution of the patient-specific that caused by using of this therapeutic scheme.Then can distribute to design with the scheme responsiveness of patient-specific the therapeutic scheme of other patient-specific.For example, certain embodiments of the present invention comprise: obtain pharmacokinetics or pharmacodynamics parameter from the patient, thereby observe the patient specificity of first therapeutic scheme discussed above is replied, wherein said pharmacokinetics or pharmacodynamics parameter comprise following at least one: the concentration of the interferon-' alpha ' of using in patient's blood plasma; Or the concentration of hepatitis B virus in patient's blood plasma; The scheme responsiveness of using the pharmacokinetics observed in the patient in response to the therapeutic scheme of first patient-specific or pharmacodynamics parameter to obtain second patient-specific distributes; Distribute to design the therapeutic scheme of second patient-specific such as (or the 3rd or the 4th) with scheme responsiveness with described second patient-specific.Many aspects of such Extraordinary therapeutic scheme have been discussed among the embodiment 3 below.

As discussed in more detail below, use computer system to carry out embodiment of the present invention.Usually, described computer operationally is attached to infusion pump, and described infusion pump is delivered to the patient according to the instruction that described computer provides with interferon-' alpha '.Randomly, described system comprises: controller, the mathematical model sequencing that described controller is replied with the virus among the patient who represents the scheme of receiving treatment, and program changes into the medicine-feeding rate that comes the adjustment for the treatment of agent based on the measurement result of this model and clinical parameter (bulk concentration of the therapeutic agent of for example using or virus load).In certain embodiments of the invention, dosage, the interferon-' alpha ' of regulating the interferon-' alpha ' that is administered to the patient with director demon used persistent period that distribution, interferon-' alpha ' use etc.

Such embodiment of the present invention is, a kind of method of using interferon-' alpha ' for the patient who suffers hepatitis B infection, and described method comprises: according to first therapeutic scheme, interferon-' alpha ' is administered to described patient; Obtain pharmacokinetics or pharmacodynamics parameter from described patient, to observe the patient specificity of first therapeutic scheme is replied, wherein said parameter comprises: the interferon-' alpha ' concentration in the blood samples of patients that is caused by first therapeutic scheme; Or the concentration of the hepatitis B virus that in the patient, exists.Then the therapeutic scheme of using the pharmacokinetics in the patient, so observed in response to first therapeutic scheme or pharmacodynamics parameter to design patient-specific, such therapeutic scheme can for example be programmed in the controller, and described controller operationally is attached to the continuous infusion pump.Then continuous infusion pump with this program can use interferon-' alpha ' to the patient for programming according to controller, for example, and one or more aspects (such as delivery time, medicine-feeding rate etc.) that described programming Control administration distributes.

As discussed in more detail below, embodiment of the present invention comprise system, and such as comprising those of computer processor etc., described processor etc. are attached to the medicament infusion pump, and are fit to send interferon-' alpha ' according to particular treatment.Usually, these systems comprise one or more controlling organizations, and described controlling organization is designed to regulate sending of interferon-' alpha ', for example allow to distribute to send it those according to predetermined infusion.For example, in some embodiment of the present invention, processor is programmed for the control therapeutic scheme, described therapeutic scheme comprises the infusion distribution that is designed to consider following factor: one or more features of patient (for example body weight), and/or one or more features of the hepatitis virus of infected patient (for example genotype), and/or be administered to one or more features (for example existence of polyalkylene glycol moiety or disappearance) of patient's therapeutic agent.Randomly, such distribution is selected from a plurality of predetermined infusion distribution of storing in computer system.

In an exemplary embodiment of the present invention, the system that comprises one or more computer processors is attached to the medicament infusion pump, so that the administering therapeutic scheme, described therapeutic scheme basis is administered to total interferon-' alpha ' of every kilogram of patient and/or total interferon-' alpha ' of every day designs.In a relevant embodiment of the present invention, systemic application is designed to consider the therapeutic scheme (for example to increase or to reduce dosage or the persistent period of the interferon-' alpha ' of using according to patient's current body weight) of patient's body weight and/or Body Mass Index (BMI).For example, be designed to consider the therapeutic scheme of weight in patients, can consider to select the dosage based on body weight of interferon-' alpha ' (for example Intron A) of the continuous administration of 80kIU/kg/ days or 120kIU/kg/ days or 160kIU/kg/ days.

In another embodiment of the invention, systemic application is designed to consider past of observing and/or when the therapeutic scheme of Proviral burden (for example to increase or to reduce dosage or the persistent period according to patient's the interferon-' alpha ' of using when Proviral burden) in the patient.In another embodiment of the invention, systemic application is designed to consider the concrete genotypic therapeutic scheme (for example to increase or to reduce dosage or the persistent period of the interferon-' alpha ' of using according to patient's HBV genotype) of the hepatitis virus of infected patient.In another embodiment of the invention, systemic application be designed to consider such as alanine aminotransferase, 1-(2-amino-4-hydroxy-6-pteridinyl)-1,2,3-propanetriol, 2 ', 5 '-existence and/or in the past or the therapeutic scheme of present level (for example to increase or reduce dosage or the persistent period of the interferon-' alpha ' according to patient's past and/or current blood serum designated object level used) of the blood serum designated objects such as oligoadenylate synthetase in the patient.In some embodiment, described therapeutic scheme can be based on single factors, for example, and patient's body weight only.In other embodiments, described therapeutic scheme is based on a plurality of factors.

In the embodiment that some computer of the present invention is carried out, with director demon, so that the continuous infusion pump is used interferon-' alpha ' in the following manner: keep serum interferon among the patient-α concentration value greater than C _Crit(namely with the patient therapeutic scheme being replied the concentration threshold that matches lastingly); Keep serum interferon among the patient-α concentration at particular value: wherein the practical effect of patient's interferon-' alpha ' is greater than the critical effectiveness of interferon-' alpha '; Regulate the interferon-' alpha ' concentration among the patient, thereby in the different phase that the hepatitis B virus carrying capacity decays, use different interferon-' alpha ' dosage regimens to the patient.Regulate the interferon-' alpha ' concentration among the patient, thus the difference between the critical effectiveness of the practical effect of the interferon-' alpha ' among the increase patient and interferon-' alpha '; Or the interferon-' alpha ' concentration among the adjusting patient, thereby reduce the adverse side effect of during interferon-' alpha ' is used, observing.In the embodiment that another computer of the present invention is carried out, described controller operationally is attached to the continuous infusion pump, and sequencing, so that described pump uses interferon-' alpha ' in the following manner the patient infected by HBV according to therapeutic scheme: keep serum interferon among the patient-α concentration value less than EC ₅₀(effectiveness that is interferon-' alpha ' be it peaked 50% the time concentration).In the embodiment that an exemplary computer of the present invention is carried out, described controller operationally is attached to the continuous infusion pump, and sequencing, so that described pump is used the selected time period of the interferon-' alpha ' of given dose (for example at least 1 week at least 48 weeks), be higher than set point (for example 100-700pg/mL) special time period to keep blood plasma interferon-' alpha ' concentration; Described therapeutic scheme comprises in addition: use the nucleoside analog that disturbs hepatitis B replication (for example nucleoside analog, such as lamivudine, adefovir dipivoxil, Entecavir, Sebivo or tenofovir two pyrrole furan esters).

In certain embodiments of the invention, be attached to electronic system for the system that uses interferon-' alpha ', described electronic system is used for the medical data of management on electronic communication network.For example, such electronic system can comprise that at least one can connect for the e-server of communicating by letter at communication network, described at least one e-server is configured for: be received in the first physiological parameter (for example serum-concentration of patient's virus load or patient's interferon-' alpha ') of observing among the patient, based on described the first physiological parameter, set the test dose (for example being designed to the liver of test patient and the dosage how kidney removes exogenous interferon-α rapidly) by the interferon-' alpha ' of continuous infusion pump infusion; Receive the second physiological parameter information of patient, its indication patient replys the interferon-' alpha ' of test dose; Then based on described the second physiological parameter, set the second dosage by the interferon-' alpha ' of continuous infusion pump infusion.The example electronic system that is fit to use with embodiment of the present invention, be used for the medical data of management on electronic communication network, referring to for example US publication 20090246171, its content is incorporated into by reference.

Another embodiment of the invention is the program code storage device, and it comprises: computer-readable medium; Be stored in the computer-readable program code on the computer-readable medium, described computer-readable program code has instruction, described instruction when being performed, can cause the controller that operationally is attached to the medicament infusion pump according to the therapeutic scheme of the patient-specific that is prepared as follows to being used interferon-' alpha ' by hepatitis b virus infected patient: according to first therapeutic scheme, interferon-' alpha ' is administered to described patient; Obtain pharmacokinetics or pharmacodynamics parameter from described patient, thereby observing the patient replys the specificity of first therapeutic scheme, wherein said pharmacokinetics or pharmacodynamics parameter comprise following at least one: the interferon-' alpha ' concentration in the blood samples of patients that is caused by first therapeutic scheme, or the concentration of the hepatitis B virus that exists in the patient; Pharmacokinetics or pharmacodynamics parameter that use is observed in the patient in response to first therapeutic scheme, the scheme responsiveness that obtains patient-specific distributes; Then use the scheme responsiveness of described patient-specific to distribute, the therapeutic scheme of preparation patient-specific.

Method of the present invention can realize at the multiple individuality that is infected by HBV, infects those individualities that carried out treatment or had specific HBV bacterial strain because of HBV before comprising.For example, some embodiment of the present invention comprises the steps: by the patient being accredited as the former patient who crossed with the interferon-' alpha ' course of therapy, select described patient to treat, wherein observe former interferon-' alpha ' and be used for the treatment of that to infect one or more relevant symptoms with HBV be invalid the course for the treatment of.Other embodiment of the present invention comprises the steps: that the patient who is for example infected by genotype A, B, C, D, E, F, G or H selects described patient to treat by the patient being accredited as by the patient of specific HBV genotype infection.

The below at length discusses other exemplary method and the material that can be used for putting into practice embodiment of the present invention.

Be used for observing in embodiments of the invention illustrative methods and the material of HBV

Hepatitis B virus (being abbreviated as HBV) is a kind of Hepadnavirus, and it also is the part of Hepadna Virus coe virus.There are 8 known genotype (being labeled as A to H) and these genotypic many hypotypes.Different genotype may make treatment in a different manner and replying (referring to, Palumbo E (2007) for example. " Hepatitis B genotypes and response to antiviral therapy:a review " .Am J Ther 14 (3): 306-9; With Mahtab MA, Rahman S, Khan M, Karim F (in October, 2008). " Hepatitis B virus genotypes:an overview " .Hbpd Int 7 (5): 457-64.PMID 18842489).

The HBV genotype has different polynucleotide sequences, and has different geographical distributions.The A type is popular in Europe, Africa and Southeast Asia (comprising Philippine).B and C type are popular in the Asia; The D type is common in mediterranean region, the Middle East and India; The E type is confined to the Sahara desert with SA; F (or H) type is limited to the central and south america.Found the G type in France and Germany.Genotype A, D and F are popular in Brazil, and all genotype are present in the U.S., and its frequency depends on that the race divides.

The people who infected by chronic hepatitis B may show one or more following sign or symptom, can check described sign or symptom (usually checking in addition other factors), in order to obtain the distribution of patient-specific: the serum alanine aminotransferase (ALT) that (a) raises, (b) positive of anti--HBV antibody check, (c) existence of the HBV that verifies of the positive by HBV-RNA, (d) Clinical symptoms of chronic hepatopathy, (e) hepatocellular damage.Such standard not only can be used for diagnosis of hepatitis b, and can be used for evaluate patient replying Drug therapy.

As discussed in more detail below, certain embodiments of the present invention comprise the steps: to monitor the HBV virus load among the experimenter, and based on the result who observes, the adjustment for the treatment of scheme.Similarly, in certain embodiments of the invention, whether ad hoc approach or method step (for example specified scheme) resist HBV is effectively infected and can measure by many factors, usually by measuring virus load.Perhaps, in some cases, can measure with HBV and infect other relevant parameter, including, but not limited to hepatic fibrosis.

By multiple operation known in the art, for example, by measuring titre or the level of the virus in the serum, can measure virus load.These methods are including, but not limited to: quantitative polyase chain reaction (PCR) and/or branched DNA (bDNA) experiment.Many such tests can commercial obtain, and comprise quantitative reverse transcriptional PCR (RT-PCR).

In certain embodiments of the invention, individual administering therapeutic agent to the HBV infection, such as interferon-' alpha ' and/or micromolecular inhibitor, such as nucleoside analog such as lamivudine, adefovir dipivoxil, Entecavir, Sebivo or tenofovir two pyrrole furan esters, then replying such medicament observed in the variation of the level (being detectable in vivo) by monitoring HBV-RNA or HBV-DNA.Under this background, it is relevant with the reduction of the level of detectable HBV-DNA in the blood of infected individual that suitable treatment is replied.Ideally, therapeutic scheme can reduce this numerical value, so that no longer there is any detectable HBV-DNA.

Although virus titer is the most important index of the effectiveness of dosage regimen, also can measure other parameter as the less important index of effectiveness.Minor parameter comprises: the alleviating of hepatic fibrosis; Reduction with the serum levels of specific protein.By analyzing the liver biopsy sample, measure hepatic fibrosis and alleviate.The analysis of liver biopsy comprises 2 important component of assessment: by the gangrenous inflammation of " grade " (as measuring of seriousness and ongoing disease activity) assessment, by fibrosis and the infringement of reinventing essence or blood vessel of " stage " (as reflection of prolonged sickness progress) assessment.Referring to, for example, Brunt (2000) Hepatol.31:241-246; And METAVIR (1994) Hepatology20:15-20, its content is incorporated into by reference.Based on the analysis of liver biopsy, specify scoring.Have many standardized marking systems, they can provide the qualitative assessment of Fibrotic degree and seriousness.These comprise METAVIR, Knodell, Scheuer, Ludwig and Ishak marking system.Another kind of substituting, but the method for indirectly measuring virus load is that surveyingpin is to the level of the serum antibody of HBV.Surveyingpin is the standard method of this area to the method for the serum antibody of HBV, and comprise enzyme immunoassay (EIA) and recombinant immune trace mensuration, they the two all comprise: contact one or more HBV antigen by making blood serum sample, detection is for the antibody of HBV, and the second antibody of use enzyme labelling (for example, goat Anti-Human IgG), detect any antibody of being combined with HBV antigen.Referring to, for example, the people such as Weiss (1995) Mayo Clin.Proc.70:296-297; And Gretch (1997) Hepatology 26:43S-47S, its content is incorporated into by reference.

The exemplary therapeutic agent that is used for embodiment of the present invention

Embodiment of the present invention can be used multiple therapeutic agent known in the art, to make up the distribution of patient-specific, then use based on the scheme through optimizing of these distributions and come delivering therapeutic agents.The typical embodiments of method disclosed herein comprises: use interferon-' alpha ' (being also referred to as " interferon-' alpha ' ") for the individuality that is infected by HBV.This embodiment of the present invention can optimize use nucleoside/nucleotide analog well-known in the art (such as lamivudine, adefovir dipivoxil, Entecavir, Sebivo or tenofovir two pyrrole furan esters) and interferon-' alpha ' is treated the scheme that HBV infects.Term used herein " interferon-' alpha ' (Alpha-IFN) " refers to, suppresses virus replication and cell proliferation and regulates the cytokine polypeptide of the height homology of immunne response.As known in the art, interferon-' alpha ' comprises human interferon-alpha 2a and 2b (jointly being called in this article " interferon-' alpha ' 2a/2b "), they are in conjunction with the identical specific cells surface receptor complex almost identical interferon-alpha polypeptides of (being called IFN-α receptor (IFNAR)), and their difference only is single basic amino acid (lysine is with respect to arginine).Because their extreme similarity, medical science practitioner can use and treat HBV with the combined interferon-' alpha ' 2a of nucleoside analog (such as lamivudine, adefovir dipivoxil, Entecavir, Sebivo or tenofovir two pyrrole furan esters) or interferon-' alpha ' 2b and infect.Under this background, the technical staff has instructed, for example, use the contrast of the HBV therapeutic scheme of interferon-' alpha ' 2a or interferon-' alpha ' 2b to show, the effectiveness of these 2 kinds of almost identical polypeptide and safety do not have significant difference (referring to, such as people such as Laguno, Hepatology 200949 (1): 22-31; The people such as Scott, Drugs2008 68 (6): 791-801; The people such as Yenice, Turk J Gastroenterol 2,006 17 (2): 94-98; With the people such as Kim, Korean J Hepatol 2,008 14 (4): 493-502, its content is incorporated into by reference).

Interferon-' alpha ' comprises, but be not limited to: Interferon Alfa-2b is such as can be from Schering Corporation, Kenilworth, N.J. the Intron A interferon that obtains, Interferon Alfa-2a is such as can be from Hoffmann-La Roche, Nutley, N.J. the Recomvinated Interferon α-2a interferon that obtains, recombinant interferon-α 2c is such as can be from Boehringer Ingelheim Pharmaceutical, Inc., Ridgefield, Conn. Berofor α 2 interferon that obtain, interferon alfa-n1 (the purification admixture of natural interferon-alpha) is such as the Sumiferon that can obtain from the Sumitomo of Japan, the Wellferon interferon alfa-n1 (INS) that maybe can obtain from the Glaxo-Welicome Ltd. of London, or the consensus sequence interferon-alpha is such as at U.S. Patent number 4,897,471 and 4,695, those that describe in 623, and can be from Amgen, Inc., Newbury Park, Calif. the concrete product that obtains, or the Alferon N (mixture of natural interferon-alpha, by Interferon Sciences preparation, and can be from Purdue Frederick Co., Norwalk under the Alferon trade mark, Conn. obtain), the recombinantinterferonα that obtains that maybe can maybe can obtain from the Green Cross of Korea S from German Frauenhoffer Institute.It is typical being used for the treatment of the Intederon Alpha-2a of HBV or the use of α 2b.The production method of interferon is referring to for example U.S. Patent number 4,530,901 and 5,741,485.

Include, but are not limited at disturbance element available on the market: interferon-alpha ((IFN-α): Recomvinated Interferon α-2a

-A,

-A; Consensus sequence IFN: Infergen Deng)); And interferon-β ((IFN-β s):

And Berlex)).Peg-IFN-α-2b went through January calendar year 2001, and peg-IFN-α-2a went through in October, 2002.The example of the peg-IFN that can commercial obtain is including, but not limited to Pai Luoxin

The happy energy of wearing ^TmAnd Reiferon

As known in the art, can not show identical activity such as the different goods of the treatment molecules such as interferon, so actively therefore announced by the manufacturer.For example, for Infergen, the activity of announcement is 1x10 ⁹U/mg or 1MIU/ug.For peg-IFN α 2b (the happy energy of wearing), the activity of announcement (package insert) is 0.7x10 ⁸U/mg or 70,000U/ug.For peg-IFN α 2a (Pai Luoxin), the Notes of Key Data of announcement, the product of Pegylation have the product of Pegylation not activity 7%.In typical embodiment, use not peg-IFN-α that biopotency is arranged (IFN-α-2a or IFN-α-2b) or IFN-con.

Many interferon-alpha are approved for treatment hepatitis.Intron A (interferon-' alpha ' 2b, Schering Plough) is applicable to the kinds cancer therapy, comprises many haematological malignancieses and hepatitis B.Do not mention in the Intron A package insert and treating unsuccessfully that still, the label of Intron A treatment is only applicable to originally patient.Recomvinated Interferon α-2a (interferon-' alpha ' 2a, Roche) is the another kind of interferon-' alpha ' that is approved for hepatitis.Infergen (IFN-con-α, Valeant) is labeled and only is used for hepatitis.Wearing happy can (with 12kD PEG (Polyethylene Glycol) peg-IFN-α 2b, Schering Plough) be the first peg-IFN-α that puts on market.The Pegylation of interferon-' alpha ' can produce biological activity with reduction, but the molecule of the body-internal-circulation half-life that greatly increases.The pendant pleasure can be labeled for take body weight as the basis the administration of weekly single injection.The pendant pleasure can only be labeled for patient originally.The half-life of the happy energy of pendant is about 48 hours, so when bolus injection finished in the 7th day later on, the blood plasma level of interferon-' alpha ' was zero basically.Pai Luoxin (with 40kD PEG peg-IFN-α 2a, Roche) is the second peg-IFN-α that is approved for clinical practice.Happy energy is different from wearing, and for all patients, Pai Luoxin sends with identical dosage usually.As the happy energy of wearing, Pai Luoxin is only applicable to originally patient of interferon-' alpha '.Because the more macromolecule of the PEG that is connected with interferon-' alpha ', the pharmacokinetics of Pai Luoxin significantly are different from the happy energy of wearing.The circulating half-life of Pai Luoxin is about 3 weeks, and it may have significant safety and involves in the situation of over administration, but does not allow significantly reduced trough level in the blood plasma.

As noted above, some embodiment of method disclosed herein comprise interferon (such as with the interferon-' alpha ' of puting together such as polyhydric alcohol such as Polyethylene Glycol) use.By making interferon-ALPHA and multiple water miscible polymer coupling, can prepare such interferon-' alpha ' conjugate.The non-limiting tabulation of such polymer comprises: the polyhydric alcohol of polyethylene and polyalkylene oxide homopolymer such as polypropylene glycol, polyoxyethylene, their copolymer and their block copolymer.As a replacement scheme based on the polymer of polyalkylene oxide, can use effective nonantigenic material, such as glucosan, polyvinylpyrrolidone, polyacrylamide, polyvinyl alcohol, based on polymer of carbohydrate etc.Such interferon-ALPHA-polymer conjugate is referring to U.S. Patent number 4,766,106, U.S. Patent number 4,917,888, European Patent Application No. 0 236 987, European Patent Application No. 0,510 356,0 593 868 and 0 809 996 (peg-IFN α-2a) and international publication number WO 95/13090.It is typical that polyethylene-ethylene glycol-the Interferon Alpha-2b conjugate is PEG ₁₂₀₀₀-interferon alpha 2 b.Phrase used herein " interferon-ALPHA that 12,000 molecular weight polyisoprene ethylene glycol are puted together " and " PEG ₁₂₀₀₀-IFN α " refer to, such as the conjugate according to the preparation of the method for international application no WO 95/13090, and its contain Intederon Alpha-2a or-2b amino with the Polyethylene Glycol with 12000 mean molecule quantities between carbamate be connected.

In certain embodiments of the invention, the interferon-' alpha ' of using in one or more successive phases of therapeutic scheme is not puted together with polyhydric alcohol.In some embodiment of the present invention, the interferon-' alpha ' of so using comprises 2 kinds of interferon-' alpha ' materials: the first interferon-' alpha ' material of puting together with polyhydric alcohol; With the second interferon-' alpha ' material that does not have to put together with polyhydric alcohol.Randomly, in one or more different successive phases of the present invention, use different interferon-' alpha ' materials.

For the number of times that pump is heavily filled out during treating is minimized, the time period that the supply of the interferon-' alpha ' in the pump can continue to prolong.Fix because the amount of the interferon-' alpha ' that can load is held pool volume by medicine, in order to increase the amount of the time that the interferon-' alpha ' supply can continue, can increase tiring and the concentration of interferon-' alpha ' of interferon.Therefore, in some embodiment, described interferon-' alpha ' can comprise very effective interferon.Term " very effective " refers to such interferon-' alpha ': it can show favourable feature, such as antiviral activity and the ratio of antiproliferative activity or the T that increases of antiviral activity, antiproliferative activity, the effectiveness of removing hepatitis virus from cell, increase _hThe ratio of 1 differentiation activity and antiproliferative activity.Because these features, still less the interferon-' alpha ' of volume can cause identical therapeutic effect to the patient, thereby very effective interferon-' alpha ' preparation can be used at lower flow velocity.Perhaps, the interferon-' alpha ' of highly soluble can be for the preparation of the preparation of the interferon concentration with increase, and described preparation also can be used at lower flow velocity.Term " highly soluble " refers to, has at 5mg/mL at least to the interferon-' alpha ' of the dissolubility between the 10mg/mL at least.In typical embodiment, interferon-' alpha ' concentration can be that 10MIU/mL, 20MIU/mL, 30MIU/mL, 40MIU/mL, 50MIU/mL, 60MIU/mL, 70MIU/mL, 80MIU/mL, 90MIU/mL, 100MIU/mL, 125MIU/mL, 150MIU/mL, 175MIU/mL, 200MIU/mL and 225MIU/mL arrive at least 1500MIU/mL at least.Usually, interferon-' alpha ' concentration is 25MIU/mL at least.

When putting into practice method of the present invention, reagent is (such as interferon-' alpha ' and/or nucleoside analog, such as lamivudine, adefovir dipivoxil, Entecavir, Sebivo or tenofovir two pyrrole furan esters) therapeutic scheme (for example therapeutic agent, dosage, administration stage, drug dosage schedule, route of administration, like that) comprise that this area is generally used for using with ad hoc fashion those schemes of these reagent, described mode causes the improvement of infecting one or more relevant physiological conditions with chronic hepatitis B usually.Under this background, the technical staff will appreciate that, multiple therapeutic scheme known in the art can be used for and/or be fit to method of the present invention (for example U.S. Patent application 2006/0088502 and 2006/0024271 and U.S. Patent number 6,849,254 in describe those).

According to numerous clinical factors of observing in particular individual (the known factor that can change during treating), medical personnel can control and/or revise the interferon-' alpha ' dosage regimen.Particularly, the technical staff will appreciate that with regard to HBV infected, a single predetermined scheme was not suitable for all patients, and best effective scheme is normally considered later individually those schemes of design of the different factors of observing in particular individual.For example, medical personnel can select concrete interferon-' alpha ' dosage regimen based on following factor: the genotype of the HBV of the infected patient of observing or hypotype, and/or the amount of the HBV-DNA of every ml serum among the patient who records by quantifying PCR method.As known similarly in the art, according to patient's body weight and age, whether observe the patient and have other relevant pathological conditions (infect such as liver cirrhosis, hepatocarcinoma, HIV etc.), can select or control dosage regimen.According to numerous clinical factors of for example in particular individual, observing and/or these patients' individual demand, can use interferon-' alpha ' by number of ways (for example hypodermically, intramuscular ground or intravenous ground).

It is not restrictive being used for the interferon-' alpha ' of administering therapeutic effective dose and the following description of the different exemplary arrangement of the therapeutic alliance of nucleoside analog (such as lamivudine, adefovir dipivoxil, Entecavir, Sebivo or tenofovir two pyrrole furan esters), opposite only as being used for and/or representative instance suitable the inventive method, dosage regimen known in the art and providing.In typical embodiments of the present invention, the interferon-' alpha ' of using is selected from following one or more: the interferon-ALPHA product of Intederon Alpha-2a, Interferon Alpha-2b, IFN-con, purification (the interferon-' alpha ' product of the purification of for example producing by recombinant technique) and/or peg-IFN-α.As known in the art, interferon-' alpha ' dosage can characterize with the polypeptide of iu (IU) or milligram, randomly at the another kind of every kg of patient body weight and/or patient's size tolerance (m for example ²) the background of amount of reagent under.Randomly, described interferon-' alpha ' can be selected from: the interferon-' alpha ' product of IFN-con, Intederon Alpha-2a, Interferon Alpha-2b or purification, and the amount of the interferon-' alpha ' of using can be from least 100 ten thousand at least 2,000 ten thousand IU/ days by continuous infusion.

In certain embodiments of the invention, in the different phase of the virus period that can in the HBV treatment, observe, use interferon-' alpha ' with different dosage.For example, in such embodiment of the present invention, in the terminal stage of first and/or second stage and/or shoulder and/or virus decay of virus decay, use the interferon-' alpha ' of various dose, and can comprise, for example, every day is at 6-20MIU (for example at least 6,6.5,7,7.5,8,8.5,9,9.5,10,10.5,11,11.5,12,12.5,13,13.5,14,14.5,15,15.5,16,16.5,17,17.5,18,18.5,19,19.5 first special time period of the first dosage or 20MIU) (for example 2 weeks), follow another time period (for example 6 weeks) by second various dose of every day between 6-20MIU, follow another time period (for example 16 weeks are to 24 weeks) by three dosage of every day between 6-20MIU.Such dosage can use infusion delivery apparatus (for example medicament infusion pump), and described device program changes into the interferon-' alpha ' of sending various dose in the different phase of therapeutic scheme.

Because interferon-' alpha ' may be exposed to the time period of high temperature and/or mechanical stress prolongation, may wish to prepare the stability that strengthens interferon-' alpha ' and the interferon-' alpha ' compositions that prevents its degraded.In one embodiment, by the Laemmli buffer system Laemmli that mixes, can be in aqueous medium stabilised interferon-α.For example, U.S. Patent number 6,734,162 disclose can be for the preparation of method and the material of this compositions.Also can use other different method with using known in the art.

Because interferon may cause disadvantageous side effect, in some embodiment, can send them with ad hoc fashion, described mode can provide the level of medicine in hepatic tissue and the level in non-hepatic tissue of reduction of increase.In one embodiment, this can followingly realize: by modified interferon-α chemically so that its inactivation, until the enzyme action of liver specificity falls described modification.An example of this technology is called HepDirect, by Metabasis Therapeutics, and Inc, La Jolla, CA provides.In another embodiment, can send to the site-specific of target cell to strengthen it by modified interferon.The chemical compound that is applicable to modified interferon in this way is including, but not limited to (lactosaminated) albumin of lactose amination (Stefano, J.Pharmacol.Exp.Ther., in May, 2002; 301:638-642) or the PLL of galactosylation (Gal-PLL) (people such as Zhu, Bioconjugate Chem., 19 (1), 290-298,2008).In other embodiments, by drug delivery device, can or directly be delivered to liver with interferon-' alpha ' intraperitoneal ground, in a little upstream of liver blood vessel bed, such as sending in Hepatic artery.

Use multiple diverse ways known in the art and that use, can measure the interferon-' alpha ' concentration of vivo sample (such as blood, serum, blood plasma, tissue etc.).A suitable example is based on test and ORIGEN analyser (the IGEN International of electrochemiluminescence, Inc.Gaithersburg, MD), it is disclosed in such as people such as Obenauer-Kutner, Journal of immunology Methods, the 206th volume, 1-2 phase, on August 7th, 1997, the 25-33 page or leaf.Other method of using in the art is included in such as those disclosed in the following document: the people such as Niewold, Genes Immun.2007; 8:492-502; The people such as Pirisi, Digestive Diseases and Sciences, 42 (4): 767-7771 (1997); The people such as Christeff, European Journal of Clinical Investigation.32 (1): 43-50, in January, 2002; The people such as Sibbitt, Arthritis﹠amp; Rheumatism, the 28th volume, the 6th phase, 624-629 page or leaf, 2005; With the people such as Lam, Digestive Diseases and Sciences, 42 (1): 178-85 (1997).In addition, be used for providing the ELISA test kit of quantitative assay of the interferon-' alpha ' concentration (for example 100-700pg/mL) of serum to obtain from supplier's commerce, comprising for example can be from Bender

HumanIFN-α's platinum ELISA CE that (for example production number BMS216CE) obtains and the people IFN α colorimetric measurement ELISA test kit (blood serum sample) that can obtain from Thermo Scientific Life Science Research Products (for example production number 411101).Skilled person in the art will appreciate that specific activity about interferon-' alpha ' (for example, for

A, 2.6x108IU/mg) information, can easily allow to characterize interferon-' alpha ' in the mode of pik and IU.

In some embodiment of the present invention, interferon-' alpha ' can jointly be administered to the patient with other antiviral agent (such as lamivudine, adefovir dipivoxil, Entecavir, Sebivo or tenofovir two pyrrole furan esters).For the patient of ongoing for suffering (chronic) virus infection, therapeutic alliance is desirable especially.Suitable antiviral agent comprises, for example HBV polymerase or protease inhibitor.These antiviral agent are usually Orally administered.

The embodiment of method disclosed herein comprises, uses lamivudine (CAS 134678-17-4).Lamivudine (2 ', 3 '-dideoxy-3 '-the sulfo-cytidine, so-called 3TC) be the cytidine analog that suppresses the reverse transcriptase of hepatitis.It is sold by GlaxoSmithKline under trade (brand) name Zeffix, Heptovir, Epivir and Epivir-HBV.Lamivudine can improve the seroconversion of the hepatitis B of e-antigen positive, and the histology who also improves liver by stages.The life-time service of lamivudine can cause the appearance of hepatitis B virus (YMDD) mutant of resistance.

The embodiment of method disclosed herein comprises, uses adefovir dipivoxil (CAS 106941-25-7).Adefovir dipivoxil (be called in the past two-POM PMEA, and had trade name Preveon and Hepsera) is a kind of Orally administered nucleotide analog reverse transcriptase inhibitors (ntRTI).Adefovirdipivoxil works by the blocking-up reverse transcriptase, described reverse transcriptase be for hepatitis B virus (HBV) in vivo breeding and the enzyme of overstating and wanting.It is approved for treatment adult's chronic hepatitis B, and described adult has the evidence of the lasting rising of the evidence of active virus replication and serum aminotransferase (mainly being ALT) or the upper active disease of histology.The principal benefits that adefovirdipivoxil surpasses lamivudine (being approved for the first NRTI for the treatment of hepatitis B) is, virus needs the longer time period could form resistance to it far away.

The embodiment of method disclosed herein comprises, uses Entecavir (CAS 142217-69-4).Entecavir is a kind of oral antiviral agents that is used for the treatment of hepatitis B infection.It is in trade name Baraclude (BMS) and the lower sale of Entavir (Cipla).Entecavir is reverse transcription, the dna replication dna in a kind of HBV of inhibition virus replication and the guanine analog of transcribing.The embodiment of method disclosed herein comprises, uses Sebivo (CAS 3424-98-4).Sebivo is a kind of synthetic thymidine nucleoside analog that is used for the treatment of hepatitis B infection.It is sold by Novartis under trade name Sebivo (Europe) and Tyzeka (U.S.).The embodiment of method disclosed herein comprises, uses tenofovir two pyrrole furan esters (CAS 147127-20-6).Tenofovir disoproxil fumarate (TDF or PMPA) is sold by Gilead Sciences under trade name Viread, is acyclic nucleoside phosphonate two ester analogs of adenylic acid.

The method of preparing medicinal interferon of the present invention, nucleoside analog and other therapeutic agent compositions is well known by persons skilled in the art.Referring to, for example, Remington:The Science and Practice of Pharmacy, the 19th edition, Gennaro (volume) 1995, Mack Publishing Company, Easton, PA.Usually, the therapeutic agent and the pharmaceutically acceptable carrier that use in the method for the invention are combined.Term " pharmaceutically acceptable carrier " uses according to the implication that its this area is accepted, intention comprise with medicinal compatible arbitrarily with all solvent, disperse medium, coating materials, antibacterial agent and antifungal, isotonic agent and absorption delay agent etc.This medium of pharmaceutically active substances and the use of reagent are well-known in the art.Except reaching the degree with the inconsistent any conventional medium of reactive compound or reagent, such medium can be used for compositions of the present invention.The reactive compound of complementarity also can mix in the compositions.It is compatible with its expection route of administration that pharmaceutical composition of the present invention is mixed with.

The cytokine of the hope with adequate purity is mixed mutually with pharmaceutically acceptable carrier, excipient or the stabilizing agent chosen wantonly, can prepare cytokine (such as interferon-' alpha ') therapeutic combination (referring to, for example Remington: The Science and Practice of PharmacyLippincott Williams﹠amp; Wilkins; The 21st edition (2005), and Ansel ' s Pharmaceutical Dosage Forms and Drug Delivery Systems Lippincott Williams﹠amp; Wilkins; The 8th edition (2004)).For example, the pharmaceutical composition that can be fit to the following substances preparation peg-IFN α of parenteral: suitable buffer, for example Tris-HCl, acetate or phosphate are such as sodium hydrogen phosphate/phosphate sodium dihydrogen buffer solution, with pharmaceutically acceptable excipient (for example, sucrose), carrier (for example albumin human), toxic agents (for example NaCl), antiseptic (for example thimerosal, cresol or benzyl alcohol) and the surfactant (for example tween or polysorbate) in sterile water for injection.Acceptable carrier, excipient or stabilizing agent are nontoxic to receptor in dosage and the concentration used usually, and comprise: buffer agent, such as Tris, HEPES, PIPES, phosphate, citrate and other organic acid; Antioxidant comprises ascorbic acid and methionine; Antiseptic is (such as the octadecyl dimethyl benzyl ammonium chloride; Chloor-hexaviet; Benzalkonium chloride, benzethonium chloride; Phenol, butanols or benzyl alcohol; Alkyl paraben is such as methyl parahydroxybenzoate or propyl p-hydroxybenzoate; Catechol; Resorcinol; Hexalin; The 3-amylalcohol; And metacresol); Low-molecular-weight (less than about 10 residues) polypeptide; Albumen is such as serum albumin, gelatin or immunoglobulin; Hydrophilic polymer is such as polyvinylpyrrolidone; Aminoacid is such as glycine, glutamine, agedoite, histidine, arginine or lysine; Monosaccharide, disaccharides and other carbohydrate comprise glucose, mannose or dextrin; Saccharide such as sucrose, mannitol, trehalose or sorbitol; The counter ion counterionsl gegenions of salify are such as sodium; And/or nonionic surfactant is such as TWEEN ^TM, PLURONICS ^TMOr Polyethylene Glycol (PEG).

The solution or the suspension that are used for administer cytokines can comprise following component; Aseptic diluent is such as water for injection, saline solution; Fixed oil, Polyethylene Glycol, glycerol, propylene glycol or other synthetic solvent; Antibacterial agent is such as benzyl alcohol or methyl parahydroxybenzoate; Antioxidant is such as ascorbic acid or sodium sulfite; Chelating agen is such as EDTA; Buffer agent such as acetate, citrate or phosphate; With the reagent that is used for regulating Zhang Du, such as sodium chloride or glucose.

The suitable carrier of the interferon formulation of liquid form is including, but not limited to the solution of water, saline solution, buffering, blood, glucose, concentrated blood plasma, blood concentrated or fractionated, glycerol or their combination in any.Acceptable excipient or the stabilizing agent that can add in the interferon-' alpha ' preparation are nontoxic in dosage and the concentration used to receptor, and comprise buffer agent and antiseptic that this area is commonly used.The preparation of this paper also can comprise other the essential bioactive molecule of specific adaptations disease that will treat.Those of ordinary skills can select each other bioactive molecule that can not adversely affect, that have complementary activity, and its amount is effective for the expection purpose.In different embodiments, described preparation can also comprise bioactivator, comprising: neurotransmitter and receptor modulators, antiinflammatory, antiviral agent, antitumor agent, antioxidant, anti-apoptotic agent, Fructus Alpiniae Oxyphyllae agent and growth stimulator, blood flow regulation agent and their combination in any.

In addition, interferon-' alpha ' can mix in the sustained-release composition, and described compositions is designed to continuous administration interferon-' alpha ' within a period of time.For example, interferon can be captured in the microsphere that is prepared as follows: for example, pass through condensation technique, or by interfacial polymerization, for example, hydroxy methocel or gelatin-microcapsule and poly-(methyl methacrylate) microcapsule, they are respectively in colloidal state drug delivery system (for example, liposome, albumin microsphere, microemulsion, nano-particle and Nano capsule) or in coarse emulsion.Such technology referring to, for example, Remington ' s Pharmaceutical Sciences, Lippincott Williams﹠amp; Wilkins; The 21st edition (on May 1st, 2005).Perhaps, interferon can be mixed in the semi permeability substrate of biodegradable solid polymer.Described substrate can be the form of the object of shaping, for example, and film, rod or ball.The material that is applicable to sustained release substrate comprises, but be not limited to: poly-('alpha '-hydroxy acids), gather (lactide-copolymerization-Acetic acid, hydroxy-, bimol. cyclic ester) (PLGA), polylactide (PLA), polyglycolide (PG), Polyethylene Glycol (PEG) conjugate of poly-(alpha-hydroxy acid), poe, polyaspirin, polyphosphazene, collagen, starch, chitosan, gelatin, alginate, glucosan, vinyl pyrrolidone, polyvinyl alcohol (PVA), PVA-g-PLGA, PEGT-PBT copolymer (polyactive), methacrylate, NIPA, PEO-PPO-PEO (pluoronics), the PEO-PPO-PAA copolymer, PLGA-PEO-PLGA or their combination.Polymer such as ethylene vinyl acetate and lactic acid-hydroxyacetic acid can make molecule discharge above 100 days.Method for the preparation of sustained-release composition is well-known, referring to for example U.S. Patent number 6,479,065.

Measure pharmacokinetics and the pharmacodynamics parameter of patient-specific:

In certain embodiments of the invention, obtaining the scheme responsiveness with one or more algorithms distributes, the latter can be used for for example designing and/or revise the therapeutic scheme used to the patient (referring to, international application no PCT/US2009/038617 for example, its content is incorporated into by reference).Usually, measure the parameter of patient-specific with a kind of algorithm, such as exist (for example in the patients serum) of bulk concentration, baseline virus load, hepatic fibrosis or the liver cirrhosis of the therapeutic agent of using to the patient or the mark relevant with pathological conditions (such as alanine aminotransferase (ALT) or aspartate transaminase (AST)).Described algorithm can be further used for the therapeutic scheme (interferon-' alpha ' dosage for example, this dosage for example can avoid as calculated may be relevant with the interferon-' alpha ' treatment serious side effects) of design optimization.In embodiments of the invention, interferon-' alpha ' serum-concentration that then can test patient or virus load or arbitrarily other relevant parameters known to persons of ordinary skill in the art are repeatedly.(with as herein described) known in the art by making pharmacokinetics and pharmacodynamic model and this data fitting can obtain pharmacokinetics and the pharmacodynamics parameter of a plurality of patient-specifics.In addition, in embodiments of the invention, can adopt multiple statistical technique known in the art and that use, for example, linearity or nonlinear regression.In some embodiment, the solution of described model or their analysis or numerical value form can combination with one another or replacement, and this is that these those skilled in the art carry out usually.

In certain embodiments of the invention, first therapeutic scheme can comprise: the interferon-' alpha ' of using doses to the patient, in order to obtain the information about the speed of patient's metabolism interferon-' alpha ', for example, to determine in serum, to produce at least required dosage of interferon-' alpha ' in this patient of intermediate concentration of 100-700pg/mL.In other embodiments of the present invention, first therapeutic scheme can comprise the interferon-' alpha ' of doses, described interferon-' alpha ' is independent, perhaps combined with the upper effective nucleoside/nucleotide analog (such as lamivudine, adefovir dipivoxil, Entecavir, Sebivo or tenofovir two pyrrole furan esters) for the treatment of, described nucleoside/nucleotide analog can be avoided the adverse side effect of essence as calculated, and can be determined from experience, population data, journal article etc. by those of ordinary skills.As limiting examples, conventional interferon-' alpha ' can be used with following medicine-feeding rate by the continuous infusion device: or greatly about 6,6.5,7,7.5,8,8.5,9,9.5,10,10.5,11,11.5,12,12.5,13,13.5,14,14.5,15,15.5,16,16.5,17,17.5,18,18.5,19,19.5 or 2,000 ten thousand or the speed in more multinational border unit (MIU)/sky.Randomly, then can observe the circulation interferon-' alpha ' level that is produced by this first therapeutic scheme, and, if necessary, then can revise this scheme, for example, be higher than target threshold value, for example 100-700pg/mL to keep the cyclical level of interferon-' alpha ' in this patient.Those skilled in the art can easily adapt the existing scheme relevant from different interferon (such as peg-IFN-α 2a not, peg-IFN-α 2b etc. not), to use with the continuous infusion device.

In certain embodiments of the invention, can advantageously change the dosage of one or more therapeutic agents, in order to obtain the better estimation of pK and pD parameter, and determine whether these parameters change.In some such embodiments, can use interferon-' alpha ' by surpassing a kind of method (that is, bolus injection and continuous infusion).In other embodiments, can adopt different route of administration, for example, subcutaneous injecting and intravenous push.In other embodiments, can change the amount of interferon-' alpha ', for example, use interferon-' alpha ' at different medicine-feeding rates or different concentration.Random time during treating, such as a few hours after the begin treatment, a couple of days, several weeks or even several months, can change dosage.

In typical embodiments of the present invention, effectiveness is defined as, and medicine produces the therapeutic effect of hope or the ability of clinical effectiveness.Can be in the mode of total effectiveness (ε), the mode of producing (ε p) with the blocking virus particle, or to alleviate the mode of new infection (η), the effectiveness of description disturbance element-α treatment.Render a service and also can indicate lasting virological response, EVR, quick virus to learn the speed of replying, like that.

Term " practical effect " refers to, the effectiveness that realizes by use interferon dosage to the patient.From clinical effectiveness (such as interferon serum-concentration or virus load data), can calculate practical effect.Term " critical effectiveness " refers to the marginal value renderd a service, so that for the effectiveness that is higher than described marginal value, finally in a large amount of patients removes this virus, and for the effectiveness that is lower than described marginal value, is not removing this virus in a large amount of patients.Under this background, skilled person in the art will appreciate that observing different patients can differently make identical HBV therapeutic scheme and replying, single scheme can not produce identical result in all patients.Term " effectiveness of hope " refers to, can produce the effectiveness value of the clinical effectiveness of wishing according to estimation, the clinical effectiveness of described hope comprises, example following value as desired: the rate of change of virus load, or the variation tendency of virus load, the number of infected target cell, the number of infected target cell is not like that.The effectiveness of hope is set usually, so that the maximization of the difference between practical effect and the critical effectiveness makes the side effect to the patient minimize simultaneously.

By changing the medicine-feeding rate of interferon-' alpha ', can change the effectiveness of interferon.The term of predicting in this article " medicine-feeding rate " depends on the amount of the interferon-' alpha ' of sending in time, and can optimize by the medicine-feeding rate of change interferon or the concentration of interferon.In addition, term used herein " medicine-feeding rate " also can depend on the amount of interferon-' alpha ', and can change by changing more effective interferon-' alpha ' preparation.Medicine-feeding rate can change over another rapidly or little by little from a constant rate of speed, or according to SIN function roughly.

Although skilled person in the art will appreciate that and about a few hours or a couple of days, to measure some pK or pD parameter, measure the data that other parameter may gather within the longer time period (such as several weeks or several months).In addition, the structure of many pK and pD parameter and model and complexity can change during treating.Therefore, can in therapeutic process, gather the blood sample that is used for measuring pK and pD parameter.More specifically, can be in 0 at least 48 weeks after the begin treatment, collected specimens.Usually, can gather more continually blood sample near the peak, more low frequency ground gathers near afterbody.In addition, the persistent period of sampling also can be depended on type and individual the replying treatment of the interferon-' alpha ' of use.In a specific embodiment, can be 0,2,4,6,8,10,12,16,20,24,36,38,40,42,44,46,48,52,56,60,72,96,120,144 and 168 hour of the 1st week, then in the 2nd, 4,8,16,24,36 and 48 weeks, gather the sample that is used for mensuration.In another embodiment, weekly until the 48th the week or the 72nd week, collected specimens.According to identical or different plans, can obtain the data of concentration and virus load.It is also understood that more continually collected specimens, in order to provide enough feedbacks to controller, these samples also can be used for measuring or optimizing pK and pD parameter.

One with ordinary skill in the art would appreciate that in the different embodiment of the present invention, medicine-feeding rate can be rely on each other or independently.If rely on, the administration of phase I can be arranged to fall at least 5-95% or at least 20% to 80% or at least in the 20-50% or at least 25% of the medicine-feeding rate (producing the more medicine-feeding rate of efficient) of second stage.Second stage can continue within the remaining time for the treatment of, perhaps, and can be succeeded by one or more extra stages.Effectiveness in additional stage can be higher or lower than the effectiveness in second stage.But, in typical embodiment, to compare with the practical effect in the phase I for the treatment of, the second stage for the treatment of always provides higher levels of practical effect.

Exemplary computer system embodiment of the present invention

For example, use in many computer systems known in the art, can carry out working of an invention scheme disclosed herein (for example those relevant with medication infusion pump).Fig. 9 A has explained an exemplary general computer system 202, and it can be used for carrying out key element of the present invention, comprises subscriber computer 102, server 112,122 and 142 and data base 114,124 and 144.Computer 202 generally includes general service hardware processor 204A and/or specific use hardware processor 204B (perhaps, jointly being called hereinafter processor 204) and memorizer 206, such as random access memory (RAM).Computer 202 can link to each other with other device, and described device comprises that I/O (I/O) device is such as keyboard 214, mouse apparatus 216 and printer 228.

In one embodiment, computer 202 following operations: general service processor 204A carries out the instruction that the computer program 210 under the control of operating system 208 is determined.Computer program 210 and/or operating system 208 can be stored in the memorizer 206, and can with user 132 and/or other device interface, to accept input and order, and based on such input and order and the instruction determined by computer program 210 and operating system 208, provide output and result.Output/result can be illustrated on the display 222, or offers other device for showing or further processing or action.In one embodiment, display 222 comprises liquid crystal display (LCD), and described LCD has a plurality of independent addressable liquid crystal.Each liquid crystal response of display 222 becomes opaque or translucent state in the data that produce from processor 204 or information (from the instruction of computer program 210 and/or operating system 208 application to input and order), to be formed on the part of the image on the display.By graphic user interface (GUI) module 218A, can provide image.Although GUI module 218A is depicted as independent module, the instruction of carrying out the GUI function can stop or be distributed in operating system 208, the computer program 210, or carries out with specific use memorizer and processor.

In special purpose processors 204B, the some or all of operations of can 110 instructions of executive basis computer program being finished by computer 202.In this embodiment, by being stored in the firmware instructions in read only memory (ROM), programmable read only memory (PROM) or flash memory (in special purpose processors 204B) or the memorizer 206, can carry out 210 instructions of some or all of computer programs.Special purpose processors 204B also can carry out hardwired by circuit design, to carry out some or all of operations, to realize the present invention.In addition, special purpose processors 204B can be hybrid processor (hybrid processor), it comprises for the special circuit of carrying out function subset, and is used for carrying out more other circuit of general utility functions (such as computer program instructions being made response).In one embodiment, described special purpose processors is special IC (ASIC).

Computer 202 also can be carried out compiler 212, and described compiler 212 allows to be compiled into the readable code of processor 204 with the application program 210 that programming language (such as COBOL, C++, FORTRAN or other Languages) is write.After the end, application program or computer program 210 access and the data of operation from I/O device memorizer 206 that receive and that be stored in computer 202, relation and the logic that is produced by compiler 212 used in described storage.Computer 202 also randomly comprises external communication device, such as modem, satellite link, network interface card or be used for receiving from the input of other computer and other device of output is provided to other computer.

In one embodiment, the instruction of executive operating system 208, computer program 210 and compiler 212 (for example visibly is embodied in computer-readable medium, data storage device 220) in, described medium comprises one or more fixing or data storage devices movably, such as zip driver, floppy disk 224, hard drives, CD-ROM drive, belt drive etc.In addition, operating system 208 and computer program 210 comprise computer program instructions, described instruction is when by computer 202 access, when reading and carrying out, can cause computer 202 to carry out to realize and/or use the present invention or with necessary step in the instruction repertorie loaded into memory, thereby set up the specific use data structure, cause computer to move as the computer of the special programming of carrying out method step as herein described.Computer program 210 and/or operational order also can visibly be embodied in memorizer 206 and/or the data communication equipment 230, thereby produce according to computer program of the present invention or goods.Like this, term used herein " goods ", " program storage device " and " computer program " intention comprise from any computer readable device or the addressable computer program of medium.

Certainly, those of skill in the art will recognize that the combination in any of said modules or different assemblies, ancillary equipment and other device of arbitrary number can use with computer 202.Although mention in this article term " subscriber computer ", be to be understood that, subscriber computer 102 can comprise mancarried device, such as medication infusion pump, analyte sensing device, mobile phone, notebook computer, pocket calculator or have any other device of suitable processing, communication and input/output capabilities.

Fig. 9 B has shown the concrete exemplary embodiment system 10 that is used for carrying out method disclosed herein.Can be with medicine-feeding rate Q (t) 12, use interferon-' alpha ' from infusion device 11 (including, but not limited to pump, hold pond, infusion bag etc.).Once you begin treatment by test or 16 couples of patients' of sensor blood sampling, can be measured interferon-' alpha ' serum-concentration 14 (being expressed as C (t)), and communicate by letter with controller 18, shown in concentration feedback circuit 20.Except loop 20 or alternative loop 20, system 10 can also comprise virus load feedback circuit 22.According to loop 22, by test or 26 couples of patients' of sensor blood sampling, can measure patient's virus load 24 (being expressed as V (t)), and can communicate by letter with controller 18.Based on C (t), V (t) or the two, controller 18 can calculate medicine-feeding rate 12, if necessary, then can regulate it, and this is realized by controller with carrying, or is manually realized by the individuality of administering therapeutic.In addition, can measure pK parameter 13 and the pD parameter 15 of patient-specific from these data.Although controller 18 can be conventional process controller such as the PID controller, also can use adaptive model forecasting process controller or model with reference to Self Adaptive Control.Generally speaking, can programme to model predictive controller with the mathematical model of " process ", with prediction " process " that the input of proposing changes be replied.Then these predictions are used for calculating suitable control action.In response to control action, use the continuously Renewal model prediction of information that records from " process ", so that the feedback mechanism of controller to be provided.In addition, optimized mathematical model continuously is with the performance of coupling " process ".

In the system shown in Fig. 9 B, can be with the pK of patient-specific or pD parameter, colony or subgroup meansigma methods or their combination and pharmacokinetics and pharmacodynamic model to controller 18 programmings, realize the required medicine-feeding rate of clinical effectiveness of wishing to calculate.During treating, controller is processed the data that receive from feedback circuit continuously, based on the patient treatment replied to optimize medicine-feeding rate.In some embodiment, controller 18 also can be handled pharmacokinetics and pharmacodynamics parameter and based on the mathematical model of concentration and virus load data, to adopt or to customize the model of individual patient and particular disorder.

In Fig. 9 B, controller 18 can use pharmacokinetics or pharmacodynamics parameter, colony or subgroup meansigma methods or their combination and pharmacokinetics, pharmacodynamics or the dynamics of virus model of patient-specific, to calculate the medicine-feeding rate of the effectiveness of wishing based on C (t), V (t) or the two.In Fig. 9 B, pK represents the physics pharmacokinetics system of actual patient.On the other hand, parameter p K ' 19 expressions are by pharmacokinetic model and the parameter value of controller for description pK, and it can be drawn from actual patient, colony or subgroup meansigma methods.PD, C, V and Q use similar note.

In the embodiment of the system 10 that only has loop 22, suppose that given patient has one group of individual pharmacokinetics parameter (being expressed as pK), thereby practical effect can be expressed as the function of concentration, described concentration is the function of medicine-feeding rate Q (t).Controller 18 can calculate with pharmacokinetics and pharmacodynamic model the medicine-feeding rate of the effectiveness that is fit to hope based on concentration or other physiological characteristic data.Such model is known, and is disclosed in, for example, and Bonate, P.L. (2006) .Pharmacokinetic-Pharmacodynamic Modeling and Simulation.New York, Springer Science﹠amp; Business Media; Andrew H Talal, Deng people (2006). " Pharmacodynamics of PEG-IFN α Differentiate HIV/HCV Coinfected Sustained Virological Responders from Nonresponders. " Hepatology 43 (5): 943-953 ' Gabrielsson, J. and D.Weiner (2000) .Pharmacokinetic and Pharmacodynamic Data Analysis:Concepts and Applications.Stockholm, Swedish Pharmaceutical Press.

Be used for using the system such as reagent such as interferon:

In therapeutic scheme as herein described, can be with basically continuous mode administering therapeutic agent (for example interferon-' alpha ').The term of predicting in this article " basically continuous mode " refers to that in the administration stage, medicine-feeding rate is always greater than zero.This term comprises such embodiment: wherein with steady rate (for example continuous infusion device) drug administration.In some embodiment, at whole treatment stage, only use interferon-' alpha ' in basically continuous mode.In other embodiments, these interferon-' alpha ' methods of application can be combined in the same phase for the treatment of, or change in the different phase for the treatment of.

In certain embodiments of the invention, with " basically continuous mode " administering therapeutic agent.Usually, by continuous infusion pump (for example being generally used for the pump to the diabetics administration of insulin), with basically continuous mode administering therapeutic agent.The pump of adequate types is including, but not limited to osmotic pumps, amboceptor pump (interbody pump), infusion pump, implantable pump, peristaltic pump, other medicinal pump, the site of delivery place by conduit being inserted in expection or near the system that uses, described conduit may be operably coupled to drug delivery pump.Should be appreciated that such pump can suitably implant in vivo (for example abdominal part of patients with implantation (peritoneum) chamber) or be worn on external (for example clipping on the belt loop).Typical method of the present invention adopts the programmable pump that is used for methods described herein.

When selecting suitable pump, need to consider many features.These features including, but not limited to: biocompatibility (medicine/device and device/environmental interface), reliability, durability, environmental stability, accuracy, send scalability, flow and to send (continuously or stream of pulses), portability, reusability, back-pressure scope and power consumption.Although biocompatibility is an important Consideration always, the importance of other Consideration changes with the device purposes.Those of ordinary skills can select to be applicable to the pump of methods described herein.

Multiple external formula or implanted pump can be used for using interferon.An example of external pump is Medtronic

Pump, an example of suitable implantable pump is Medtronic

Pump, the two is by Medtronic, Minneapolis, Minnesota produces.In these pumps, therapeutic agent is pumped into the drug delivery device from pump chamber, described drug delivery device is with the therapeutic agent target position that leads.Come the delivery rate of the therapeutic agent of self-pumping, usually controlled according to the instruction that receives from programmer by processor.This allows this pump to be used in time of appointment or the therapeutic agent of similar or different amounts is sent at the interval of the setting between sending continuously, thereby the control rate of release is corresponding with the targeting rate of release of hope.Usually, the pump program is changed into the interferon-' alpha ' of sending successive doses, with the fluctuation that prevents interferon-' alpha ' serum levels concentration or minimize it at least.

Can be hypodermically, intramuscular ground, the intestines and stomach other places, intraperitoneal ground, transdermal ground or systematically send interferon-' alpha '.In specific embodiments, can send interferon-' alpha ' hypodermically or for the whole body infusion.Drug delivery device can be connected to pump, and below skin, be communicated to the site of delivery of the expection of health.Suitable drug delivery device including, but not limited to: at U.S. Patent number 6,551, those disclosed device in 290 and 7,153,292.

Multiple continuous infusion device known in the art can be used for sending one or more antiviral agent to the patient who is infected by HBV.For example, can use by the continuous interferon-' alpha ' of following realization: use to be used for the infusion pump that carries out subcutaneous or intravenous injection with appropriate intervals (for example at least per hour), convenient or promote the amount of the therapeutic effect of wishing to continue the reasonable time section with meeting.Usually, the continuous infusion device that uses in the method for the invention has the highly feature of serious hope, and described feature for example is present in the pump by Medtronic company production and selling.In exemplary embodiment of the present invention, by infusion pump (such as Medtronic MiniMed 508 type infusion pumps), administer cytokines.508 types are the main selection of insulin pump therapy at present, and have safety, reliability and long history easily.Usually, described pump comprises little, handheld remote programmer, it can make diabetics sequencing cytokine send, and need not near pump itself.

Perhaps, continuous administration can be realized by for example another kind of device known in the art: such as, pulsation type electron injector driver (Provider Model PA 3000, Pancretec Inc., San Diego Calif.), portable syringe pump is such as Graseby MS 16A type (Graseby Medical Ltd., Watford, Herts England), or the constant infusion pump is such as Disetronic Model Panomat C-S osmotic pumps, also can use such as the pump that can obtain from Alza.Because the use of continuous subcutaneous injection allows the patient to move, usually surpass continuous intravenous injection ground and select it to use.

The infusion pump that is used for embodiment of the present invention can be become compact (for example less than 15x15 centimetre) and water proof type with Design of Monitor, thereby may be fit to be carried by the user, for example, by means of belt clip.As a result, can be accurately in the mode of automatization with important drug delivery to the user, can not produce significantly restriction to user's mobility or life style.Compact and the portable character of pump and/or monitor can provide multiformity highly when operative installations.As a result, the ideal alignment of pump can vary widely, and this depends on user's size, activity, physical handicap and/or individual preference.In a specific embodiment, described pump comprises the interface of the portability (for example connecting by convenient and mobile subscriber) of convenient pump.Typical interface comprises clip, band, anchor clamps or band.

The several formulations that customizes in order to use with the continuous infusion pump is known in the art.For example, predict and use such preparation, the optimization dosage injection of its analog constant is such as, but not limited to, fugitive interferon-' alpha ' and the long-acting interferon-α-polymer conjugate and different extended release preparations of not puting together form.Typical route of administration comprises parenteral, for example, and intravenous, intradermal, intramuscular and subcutaneous administration.The solution or the suspension that are used for parenteral, intradermal or subcutaneous administration can comprise following component: sterile diluent, such as water for injection, saline solution; Fixed oil, Polyethylene Glycol, glycerol, propylene glycol or other synthetic solvent; Antibacterial agent is such as benzyl alcohol or methyl parahydroxybenzoate; Antioxidant is such as ascorbic acid or sodium sulfite; Chelating agen is such as EDTA; Buffer agent, such as acetate, citrate or phosphate, and for the reagent of regulating Zhang Du, such as sodium chloride or glucose.Dosage regimen can change.Such scheme can change with the seriousness of disease and the result of hope.

After using interferon-' alpha ' and/or nucleoside analog (such as lamivudine, adefovir dipivoxil, Entecavir, Sebivo or tenofovir two pyrrole furan esters) or other therapeutic agent for the people who is infected by HBV, can be to be familiar with the well-known various ways of skilled practitioner of the sign that HBV infects, the HBV of monitoring load in described individuality.In the situation that chronic hepatitis infects, the medicine for the treatment of effective dose can reduce the number of the virion that can detect in described individuality, and/or alleviates to a certain extent one or more sign or the symptoms relevant with described obstacle.For example, as top disclosed in detail, in order to follow the tracks of among the experimenter hepatitis duplicating process in response to Drug therapy, can measure hepadna or RNA in the blood serum sample, for example, by the PCR operation, such as wherein 2 groups of PCR operations that are derived from the primer of hepatitis gene group of nested polymerase chain reaction test use.The people such as Farci, the people such as 1991, New Eng.J.Med.325:98-104.Ulrich, 1990, J.Clin.Invest., 86:1609-1614.Then can use the histological examination of liver biopsy sample, as the second standard of estimating.Referring to, for example, the people such as Knodell, 1981, Hepatology 1:431-435, their histology's activity index (hepatic portal inflammation, piecemeal necrosis or bridging necrosis, lobule damage and fibrosis) can provide the methods of marking of disease activity.

In another embodiment of the invention, a kind of goods (for example test kit) are provided, it contains and can be used for treating the material that above-mentioned HBV infects.Described goods can comprise container and labelling.Suitable container comprises, for example, and continuous infusion pump, the set of infusion pipeline, conduit, bottle, phial, syringe and test tube.Described container can be made by multiple material (such as glass or plastics).Described container can hold the compositions (for example cytokine or other therapeutic combination) that can effectively treat disease (for example chronic hepatitis infection), and can have aseptic access mouth (for example described container can be intravenous solution bag or phial, and it has can be by the stopper of subcutaneous injection needle-penetration).On container or follow the labelling indication of container, described compositions is used for the treatment of selected disease.Described goods can comprise second container in addition, and described container is equipped with pharmaceutically acceptable buffer, such as phosphate buffered saline (PBS), Ringer's mixture and glucose solution.It can comprise other material of seeing hope from commercial and User Perspective in addition, comprises other buffer agent, diluent, filter, syringe needle, syringe and the package insert with operation instruction.

Useful pharmaceutical composition can be included in container, packing or the allotter with using description in the method for the invention.Described result can be disease sign, symptom or reason minimizing and/or alleviate or the change of any other hope of biosystem.For example, in another embodiment of the invention, provide test kit, described test kit contains the material that can be used for treating with interferon pathological conditions.Described goods comprise the markd container of tool.Suitable container comprises, for example, and bottle, phial and test tube.Described container can be made by multiple material (such as glass or plastics).Described container holds compositions, and described compositions has the activating agent that can effectively treat pathological conditions (infecting such as HBV).Activating agent in compositions is interferon-' alpha ' and/or nucleoside analog normally, such as lamivudine, adefovir dipivoxil, Entecavir, Sebivo or tenofovir two pyrrole furan esters.Labelling indication on container, described compositions can be used for treating pathological conditions with interferon-' alpha ' and/or nucleoside analog (such as lamivudine, adefovir dipivoxil, Entecavir, Sebivo or tenofovir two pyrrole furan esters).

Skilled person in the art will appreciate that there are multiple conversion in disclosed method, material, system, test kit etc.For example, can change dosage or the persistent period for the treatment of, this depends on the aspect that HBV infects, such as amount and/or the multi-drug resistance level of the virion of the elimination of observing in the patient.

Run through the application, mention different journal articles, patent, patent application and other publication etc., with illustration that state of the art is provided (for example U.S. Patent number (referring to, for example U.S. Patent number 6,172,046,6,461,605,6,387,365 and 6,524,570, Application No.: 20060257365,20070202078,20050112093,20050031586,20030004119 and 20030055013, and Dahari, H., A.Lo waits people (2007). and " Modeling hepatitis Cvirus dynamics:liver regeneration and critical drug efficacy. " J Theor Biol247 (2): 371-81.Dahari, H., R.M.Ribeiro waits people (2007). " Triphasic decline of hepatitis C virus RNA during antiviral therapy. " Hepatology46 (1): 16-21; With people such as Dahari, Curr Hepat Rep.2008; 7 (3): 97-105.).

Scope of the present invention is not subjected to the restriction of embodiment disclosed herein, and described embodiment intention is as the independent illustration of single aspect of the present invention, and any embodiment that is equal in function all within the scope of the invention.In addition, even described the invention of this paper with reference to specific embodiment and embodiment, should be appreciated that these embodiment and embodiment only are the examples of principle of the present invention and application.Therefore, should be appreciated that and to make numerous modifications to exemplary embodiment, can design other and arrange, and not break away from the spirit and scope of the present invention that defined by following claims.The publication of describing the aspect of this technology comprises: for example, and Application No. 2005/0063949 and 2007/0077225; U.S. Patent number 6,172,046,6,245,740,5,824,784,5,372,808,5,980,884; Disclosed International Patent Application WO 96/21468, WO 96/11953; The people such as Torre (2001) J.Med.Virol.64:455-459; The people such as Bekkering (2001) J.Hepatol.34:435-440; The people such as Zeuzem (2001) Gastroenterol.120:1438-1447; Zeuzem (1999) J.Hepatol.31:61-64; Keeffe and Hollinger (1997) Hepatol.26:101S-107S; Wills (1990) Clin.Pharmacokinet.19:390-399; The people such as Heathcote (2000) New Engl.J.Med.343:1673-1680; Husa and Husova (2001) Bratisl.Lek.Listy 102:248-252; The people such as Glue (2000) Clin.Pharmacol.68:556-567; The people such as Bailon (2001) Bioconj.Chem.12:195-202; With people (2001) Science 282:103 such as Neumann; Zalipsky (1995) Adv.Drug Delivery ReviewsS.16,157-182; The people such as Mann (2001) Lancet 358:958-965; The people such as Zeuzem (2000) New Engl.J.Med.343:1666-1672; U.S. Patent number 5,985,265,5,908,121,6,177,074,5,985,263,5,711,944,5,382,657 and 5,908,121; The people such as Osborn (2002) J.Pharmacol.Exp.Therap.303:540-548; The people such as Sheppard (2003) Nat.Immunol.4:63-68; The people such as Chang (1999) Nat.Biotechnol.17:793-797; Adolf (1995) Multiple Sclerosis 1 supplementary issue 1:S44-S47.Except as herein described those, those skilled in the art can understand the different modifications of model of the present invention and method from aforementioned description and instruction, and intention falls within the scope of the present invention similarly.Such modification or other embodiment be can put into practice, and true scope of the present invention and spirit do not broken away from.But the present invention is only by the circumscription of appended claims.All numerals (such as the persistent period for the treatment of, the concentration for the treatment of chemical compound etc.) of the value of enumerating in description and subsidiary claims, expression can characterize with numeral can be modified by term " about ".

Embodiment

Embodiment 1: the general treatment scheme of giving patient's continuous administration interferon-' alpha '

Multiple this area therapeutic scheme that accept, that be used for the treatment of HBV can be suitable in embodiment of the present invention.For example, exemplary therapeutic scheme can comprise: mobile infusion pump (for example

The little infusion pump of 508 types) thus being used for the continuous administration interferon-' alpha ' keeps the purposes that the cyclical level of the interferon-' alpha ' of using is higher than specific threshold, for example be enough to keep the cyclical level of interferon-' alpha ' in described patients serum and be higher than at least 100,200,300,400,500,600 or the therapeutic scheme of the Css of 700pg/mL.Such scheme can comprise, for example, uses 6,9 or the IFN-α of 12MIU (Intron A for example

)/sky continued at least 1 week at least 48 weeks, for example as discussing in detail among the embodiment 2 below.Another exemplary scheme comprises: continuous administration IFN-α 80 continued at least 1 week at least 48 weeks in 000IU/kg/ days.Another exemplary scheme comprises: continuous administration IFN-α 120 continued at least 1 week at least 48 weeks in 000IU/kg/ days.Another exemplary scheme comprises: continuous administration IFN-α 160 continued at least 1 week at least 48 weeks in 000IU/kg/ days.Another exemplary scheme comprises: use weekly continuously hypodermically happy can the continuing at least 1 week to arrive at least 48 weeks by 1.5 μ g/kg of wearing.Usually, in such scheme, the patient also receives oral nucleoside analog, such as lamivudine, adefovir dipivoxil, Entecavir, Sebivo or tenofovir two pyrrole furan esters.

Finished the patient after first therapeutic scheme of very first time section (such as 1,2,3,4,5,6 or 7 day, 1,2,3 or 4 weeks etc.), can analyze, to observe for example serum interferon-alpha levels and safety/tolerance data and outcome measure, such as exemplary measuring disclosed herein.Such as what discuss among the embodiment 3 below, then can design based on this analysis result the therapeutic scheme of patient-specific.For example, suppose that described analysis shows that the cyclical level of interferon-' alpha ' is in the target scope, the patient can continue the treatment of appointment in the remaining time of the course for the treatment of.Perhaps, can use the therapeutic scheme of patient-specific to the patient, described therapeutic scheme is designed to for example compare increase serum interferon-alpha levels with first therapeutic scheme that is administered to described patient.

Embodiment of the present invention comprise system in addition, and such as comprising those of computer processor etc., described processor etc. are attached to the medicament infusion pump, and are fit to send interferon-' alpha ' according to particular treatment.In some embodiment of the present invention, described system comprises one or more controlling organizations, and described controlling organization is designed to regulate sending of interferon-' alpha ', for example allows to distribute to send it those according to predetermined infusion.For example, in some embodiment of the present invention, processor control therapeutic scheme, described therapeutic scheme comprises the infusion distribution that is designed to consider following factor: one or more features of patient (for example body weight), and/or one or more features of the hepatitis virus of infected patient (for example genotype), and/or be administered to one or more features (for example it and polyalkylene glycol moiety puts together) of patient's therapeutic agent.Randomly, such distribution is selected from a plurality of predetermined infusions distributions.In certain embodiments of the invention, described system can operationally be attached to input, described input provides the information (for example being attached to the input of sensor) about the exogenous IFN-α concentration among the patients serum, then regulate the dosage of the interferon-' alpha ' that is administered to the patient with described processor, thereby regulate serum-concentration in the body that obtains up or down (thereby for example falling in the predetermined target level scope).

Embodiment 2: give the subcutaneous company of patient that can not make to the conventional therapy scheme HCV infection of replying The clinical research of continuous infusion interferon-' alpha '

Background and principle

The treatment of chronic hepatitis C has shown inhomogeneous success, and current clinical practice has only been eliminated HCV in about 50% infected individual.As a result, exist one group of remaining factor such as virogene type, they can for example be reduced in the response rate in the genotype 1.Use Polyethylene Glycol interferon-' alpha ' and ribavirin to HCV genotype 1 patient's optimal treatment, caused between 41-60% virological response (SVR) rate that continues (referring to, such as people Lancet2001 such as Manns; 358:958-965; The people N Engl J Med 2002 such as Fried; 347:975-982; The people Ann Intern Med 2004 such as Hadziyannis; 140:346-355; With people C.JHepatol 2005 such as Zeuzem; 43:250-257).These results' improvement and former nonresponder's again treatment is considered to the ultimate challenge of this area.

By keeping constant blood levels, the Pegylation of interferon (IFN) α has improved the pharmacokinetic profiles of conventional interferon-' alpha '.This has realized weekly 1 time IFN-α administration, and produces higher response rate.But, verified and since the IFN-α volume of distribution that causes of Pegylation be subject to remarkable restriction (referring to, such as people Semin Liver Dis 2003 such as Zeuzem; 23 supplementary issue 1:23-8), namely a reduction biological activity also reduces the factor that treatment is renderd a service potentially.As disclosed herein, the continuous administration by puting together the IFN-α that carries out chemical modification with polyhydric alcohol not, full effect IFN-α albumen that can be by lasting and constant level is provided (having the albumen with the pharmacokinetic profiles of endogenous interferon equivalence) overcomes these problems.

In chronic hcv patients, studied continuous IFN-α infusion aspect.For example, the people such as Carreno in 28 days patient of 12 continuous subcutaneous IFN-α 2a of usefulness (9MIU) treatment, observe Serum ALT remarkable reduction (referring to, such as people J Med Virol1992 such as Carreno; 37:215-219).Do not observe the irreversible side effect that needs dosage to revise.In the research from people such as Schenker, among the patient with the IFN-α 2b course of therapy of standard before 7, with 60, the speed of 000IU/h (1,000 ten thousand IU/ week), by continuous h inf use IFN-α 2b continue 3 months period (referring to, such as people J Interferon Cytokine Res1997 such as Schenker; 17:665-670).At the infusion site place, continuous infusion is well tolerated.In addition, compared with former intermittent administration, the type of systemic side effects is similarly, but intensity is lower.

With regard to h inf, Medtronic Inc. have a kind of pump delivery system (

The little infusion pump of 508 types), this system the every day in 10 chronic hcv nonresponders 9 μ gIFN α con-1 continuous administration in show good safety and toleration characteristic (referring to, such as people Hepatology 2003 such as Tong; 38:304A).Preliminary data from the people's such as Tong research shows, compares with other therapeutic alliance, and at similar time point place, HCV RNA significantly reduces.In addition, the IFN-α of high dose and PEG-IFN-α produced among the former nonresponder result that improves (referring to, such as people J Viral Hepat 2003 such as Vrolijk; 10:205-209; The people Hepatology 200542:657A such as Marcellin; With people J Hepatol2006 such as Cornberg; 44:291-301).Although in these researchs, see more continually side effect, do not think that toleration significantly is lower than standard care.

Nearest test confirms, when realizing SVR, best RBV dosage (approximately 15mg/kg/ days) important as the IFN-α dosage of the best (referring to, such as people J Hepatol2004 such as Reddy; 40:149; With people Hepatology 2005 such as Shiffman; 42:217A).Observe in nearest research significantly that higher SVR leads, the RBV administration that described investigation and comparison is fixing and based on the administration of body weight (referring to, such as people Hepatology 2005 such as Jacobson; 42:77A).Nonresponder's moderate proportions is associated with relatively poor patient's compliance, may be subjected to the impact of following factor: neuropsychiatric ill effect, the doctor who regulates or stop medicament based on cytopenia.Reduce if prevented the dosage that is caused by adverse events or laboratory abnormalities, SVR leads may be higher.

This embodiment provides the data from clinical trial, and described clinical trial design becomes to check that the continuous administration of IFN-α is on the patient's of verified (PEG-) IFN-α/RBV therapeutic alliance refractory impact.For the patients with chronic hepatitis C of former (PEG-) IFN-α/RBV therapeutic alliance refractory, we have studied and 15mg/kg/ days RBV

Combined high dose IFN-α 2b (Intron

) continuous 48 weeks of subcutaneous administration and best side effect control, in order to keep IFN-α 2b and 48 weeks of RBV of the highest possibility dosage.As discussed below, we observe with weekly 3 times or every day 1 subcutaneous injection IFN-α 2b compare, continuous subcutaneous pump is sent the toleration of the raising of IFN-α 2b, and because antiviral activity and the biological value of the increase that the lasting and higher level of full effect interferon-alpha proteins causes.

The aspect of this clinical experimental study is disclosed below.

The purpose of research

This research use continuous infusion device (such as

The little infusion pump devices of 508 types) studies therapeutic scheme, described therapeutic scheme can be optimized dosage, safety and the toleration of high dose IFN-α 2b/ ribavirin therapeutic alliance in HCV (for example genotype 1) patient of continuous subcutaneous administration, described patient such as to former (peg) interferon/ribavirin therapeutic alliance unresponsive those.

Primary and foremost purpose:

● study safety and the toleration (patient's of serious adverse events, class 4 NCI toxicity, completed treatment percentage ratio or dosage are regulated reason) of the high dose IFN-α 2b of continuous h inf.

Secondary objective:

● whether research can cause ETR and SVR from oral ribavirin every day IFN-α 2b combined, 48 all continuous h inf different (height) dosage in HCV genotype 1 patient, described patient is to former (peg) interferon/ribavirin therapeutic alliance nonreply.

● the decay of research virus load.

● the research immunne response.

The design of research

Patient's number

30 patients, 10 patients of each treatment group

Design (test type)

Monocentric, randomized, as to have 3 groups dosage is found research.

Research medicament, dosage and the persistent period

Use

Device, totally 30 patient's randomization ground IFN-α by continuous h inf

acceptance

6,9 or 12MIU 2b/ days totally 48 weeks.All windings are subjected to the oral ribavirin of 2 following dosage every day :≤65kg:1000mg/ days,＞65-80kg:1200mg/ days,＞80-100kg:1400mg/ days and＞100kg:1600mg/ days.When 72 week, follow up a case by regular visits to.As a result, administering therapeutic treatment phase in totally 48 weeks.Follow up a case by regular visits to after the treatment and continued for 24 weeks.

Outcome measurement

Main result:

● safety and the toleration of the IFN-α 2b of the continuous h inf of high dose.

Less important result:

● (treat end, ETR) with rear 24 weeks for the treatment of end (lasting virological response, the HCV RNA feminine gender that SVR) records by qualitative test in the 48th week.

● be expressed as 2 ' 5 '-oligoadenylate synthetase (2 ' 5 '-OAS) and β ₂The IFN-α 2b biological activity of-microglobulin activity.

● the pharmacokinetics that records by IFN-α 2b level.

● the virus decay during treating.

● the standardization of Serum ALT when treatment finishes and when following up a case by regular visits to end.

● immunological response (dentritic cell (DC) and adjusting T-cell (T before treatment, after the process neutralization _Regs) frequency in peripheral blood, the function of DC and the specific T-cell response of HCV).

● use SF-36 and SCL-90 questionnaire that quality of life and psychopathology are carried out the psychology assessment.

Patient's selection

Patient's registration

Registered totally 30 qualified patients with chronic

hepatitis C genotype

1 or 4 in this research, they are to the nonreply of conventional H CV antiviral therapy.

Choice criteria:

●

hepatitis C genotype

1 or 4, to (peg) interferon-' alpha '/ribavirin therapy nonreply.

● in the past, (peg) interferon-' alpha ' or conventional interferon-' alpha '+ribavirin therapeutic alliance carried out at least 12 weeks, and HCV RNA reduces less than 2-log when the 12nd week, and HCV RNA is positive when the 24th week, breaks through during treating or recurs after treatment.

● terminal of (peg) interferon/ribavirin therapy of at least 12 all between and start of high dose IFN-α/ribavirin therapy.

● indicate lastingly antiviral therapy, such as the Serum ALT or the lasting or progressive Fibrotic Histological Evidence that continue to raise.

● 18-60 year.

Culling level:

● from before treatment finish after, the sign of gradual hepatopathy surpasses the received standard of HCV antiviral therapy usually:

◆ serum bilirubin＞35 μ mol/l, albumin＜36g/l, prothrombin time＞4 second, or platelet＜100,000/mm ³

◆ Decompensated liver cirrhosis (being defined as in the jaundice that has in the presence of liver cirrhosis, ascites, gastrorrhagia, esophageal varicosis or the encephalopathy).

● liver imaging (US, CT or MRI), evidence (the liver imaging should be carried out in 3 months before screening) or alpha-fetoprotein＞20ng/mL with hepatocarcinoma

● hepatopathy reason other acquisition or heredity, it can explain that hepatopathy is active.

● hepatitis B virus or human immunodeficiency virus's (HIV) common infection.

● may disturb other significant medical conditions of this research: the significant dysfunction of cardiovascular, lung or kidney, malignant tumor in former 5 years except rodent ulcer, immunodeficiency syndrome (for example the HIV positive, steroid therapy, the organ transplantation except cornea and hair grafting).

● serious epileptic seizures or current anticonvulsant use.

● the medicament of prescribing is controlled the history of thyroid disease relatively poorly.

● the contraindication of IFN-α and/or ribavirin:

◆ serious psychological problem such as major psychosis, suicidal idea, attempted suicide, and/or shows depression in the treatment of former (peg) interferon-' alpha '.Serious depression comprises following: (a) because the experimenter that depression has been in hospital, (b) because depression has been accepted the experimenter of electroconvulsive therapy, or (c) its depression has caused the experimenter of the remarkable destruction of long-term work absence and/or daily life function.Experimenter with mild depression history may be considered and enter this scheme, condition is, assessment is supported before the treatment of described experimenter's the mental status: this experimenter is stable clinically, and has the ongoing evaluation to patient's the mental status during studying.

◆ the resurrection of immunology obstacle during the former treatment.

◆ the vision symptom relevant with retinal abnormalities.

◆ gestation, breast feeding or unsuitable contraception.

◆ thalassemia, spherocytosis.

● substance abuse, such as ethanol (〉=80gm/ days) and intravenous drug.If the experimenter has the substance abuse history, in order to consider to be included in the scheme, described experimenter must give up the material at least 2 years that uses abuse.

● in any other disease that research worker can make the patient be not suitable for registering, maybe may disturb the patient to participate in and finish any other disease of research.

Research medicament, supply and patient's treatment

Medicament and dosage regimen

Use

Device, by continuous h inf, all patients accept IFN-α 2b.With patient's randomization one of to following dosage:

1) 12MIU IFN-α is 2b/ days.

2) 9MIU IFN-α is 2b/ days.

3) 6MIU IFN-α is 2b/ days.

Ribavirin obtains with the 200mg tablet, and based on body weight administration (approximately 15mg/kg/ days, see table 1).

Table 1: ribavirin administration

Adverse events

Interferon Alpha-2b

The ill effect that runs at most generally includes: headache, tired, generate heat/shiver and myalgia.These seriousness is normally light, and observes tachyphylaxis in therapeutic process.Important side effect comprises neuropsychiatric symptom, such as drowsiness, depression and emotional lability.Based on the WHO/NCI standard, the seriousness of most of significant changes of hematology's value (Hb, WBC, neutrophil cell and platelet) is slight or medium (grade 1 or 2).

Other side effect comprises bringing out of anorexia, the erythema at the place, injection site, diarrhoea and autoimmune disease (particularly thyroiditis).

Ribavirin

The side effect of frequent report is: feel sick, anorexia, dyspepsia, dizziness, rash, pruritus, macule, cough, nasal congestion, dyspnea.In the former research, the most seriousness in these events is slight to medium.The main toxicity of ribavirin is hemolytic anemia, and this observes in the patient of PEG-IFN-α/ribavirin therapy of about 13%.Reported the fatal and nonfatal myocardial infarction in the patient with anemia that ribavirin causes.

Dosage is regulated or is interrupted

Usually reduce to realize the control of common adverse events by dosage; But, in development, the gestation of life-threatening adverse events, cardiopathic discriminating or heart dysfunction or do not meet in the situation of requirement of birth control practice, must for good and all interrupt IFN-α 2b and RBV therapy.

The medicament of coexistence

In therapeutic process, can use acetaminophen the side effect of IFN-α 2b is minimized.Total daily dose of acetaminophen should be no more than 4 grams.In the situation of anemia, can use erythropoietin, and allow blood transfusion.If depression or depressed symptom occur, allow to use optionally serotonin reuptake inhibitor (SSRI).Except the medicine or therapy in culling level, mentioned, in research process, allow the medicament of coexistence, as long as this is expected not impact of result of study.The use of the medicament of coexistence must be recorded in CRF (statement type, dosage and persistent period).If possible, the medicament of existing coexistence should not change in research process.

Patient's management and assessment

The screening assessment

Before the treatment beginning, in 28 days, screen (the 0th day).

Following operation (also referring to the summary that provides in Figure 10) is provided:

● written Informed Consent Form.

● the criterion of acceptability inspection.

● physical examination, blood pressure and pulse.

● the medicament of medical history, coexistence.

● general features: initial, date of birth (dd/mm/yyyy), age (year), sex, body weight (kg), highly (cm), blood pressure (mmHg), heart rate and ethnic background.

● in the women of 18-50 between year pregnancy tests.

● laboratory hematology: Hb, platelet, leukocyte, absolute neutrophil cell counting, prothrombin time

● laboratory chemistry: AST, ALT, total bilirubin, GGT, alkali phosphatase, albumin, kreatinin, TSH, LDH, Na, K, carbamide, amylase, CPK, glucose, alpha-fetoprotein, IgG, ANA, ASMA.

● zoo virus is learned: anti-HIV, HBsAg, HCV RNA, HCV genotype anti--HBs, anti--HBc, that record by qualitative test.

● the urinalysis that records by dipstick.

● the blood plasma that is used in the future reference is stored (6mL).

Baseline estimate (the 0th day)

● body weight.

● laboratory hematology: Hb, platelet, leukocyte, absolute neutrophil cell counting, prothrombin time.

● laboratory chemistry: AST, ALT, total bilirubin, GGT, alkali phosphatase, albumin, kreatinin, TSH.

● virusology: the HCV RNA that records by quantitative test.

● gather 100mL blood (heparin sodium), for separating of DC and T _Regs

● 2 ' 5 '-OAS and β ₂-microglobulin level.

● adverse events.

● the medicament of coexistence.

● the serum that is used in the future reference is stored (6mL).

● quality of life and the assessment of psychopathological psychology.

Treatment stage

● physical examination, blood pressure and pulse (in the 16th, 32,48 weeks).

● body weight (each medical).

● the laboratory hematology:

◆ each medical: Hb, platelet, leukocyte, absolute neutrophil cell counting.

◆ in the 12nd, 24,36,48 weeks: also measure prothrombin time.

● the laboratory chemistry:

◆ each medical: AST, ALT.

◆ in the 12nd, 24,36,48 weeks: also measure total bilirubin, GGT, alkali phosphatase, albumin, kreatinin, TSH.

● virusology: HCV RNA:

◆ in the 1st, 2,3,4,8,12,24,36,48 weeks: quantitative test.

◆ in the 48th week: qualitative test (if quantitative test is negative).

● 2 ' 5 '-OAS and β ₂-microglobulin level (each medical).

● gather 100mL blood (heparin sodium) for separating of DC and T _Regs(in the 12nd, 24,36,48 weeks).

● IFN-α 2b level (each medical).

● medicine accountability (each medical).

● adverse events (each medical).

● the medicament of coexistence (each medical).

● the serum that is used in the future reference is stored (6mL) (each medical).

● quality of life and psychopathological psychology assessment (in the 4th, 12,24,36,48 weeks).

Follow-up period

● physical examination, blood pressure and pulse (in the 72nd week).

● body weight (each medical).

● the laboratory hematology:

◆ each medical: Hb, platelet, leukocyte, absolute neutrophil cell counting.

◆ in the 72nd week: also measure prothrombin time.

● the laboratory chemistry:

◆ each medical: AST, ALT.

◆ in the 72nd week: also measure total bilirubin, GGT, alkali phosphatase, albumin, kreatinin, TSH.

● virusology: HCV RNA:

◆ in the 52nd, 60,72 weeks: quantitative test.

◆ in the 72nd week: qualitative test (if quantitative test is negative).

● 2 ' 5 '-OAS and β ₂-microglobulin level (each medical).

● gather 100mL blood (heparin sodium) for separating of DC and T _Regs(in the 72nd week).

● adverse events (each medical).

● the medicament of coexistence (each medical).

● quality of life and psychopathological psychology assessment (in the 52nd, 72 weeks).

Statistics

Use X 2 test, can contrast EVR in 3 dosages of continuous subcutaneous IFN-α 2b treatment and the percentage ratio of SVR.

Use the nonlinear regression that adopts the repeated measure analytical technology, can analyze in time the decay of logarithm virus and pharmacokinetics.

Use the linear regression that adopts repeated measure to analyze, can analyze ALT, biological activity, immunological response and appraisal of life quality.

Assess safety and tolerance data with descriptive statistics.Use X 2 test, percentage ratio and the dosage that can contrast adverse events (AE), serious adverse events (SAE) between all groups reduce.

1. the preliminary analysis of clinical testing data

A. background:

Compare with the IFN-α of standard, the Pegylation of known IFN-α can improve the PK with higher SVR and distribute.But volume of distribution and biological activity significantly reduce.Under this background, confirm from the preliminary clinical data of clinical trial, not only can stop the crest relevant with adverse events to the continuous exposure of therapeutic IFN-alpha level, and can stop with inferior therapeutic drug levels and virus and break through relevant trough.

B. method:

Combined with the RBV (1000-1600mg/ days) based on body weight, use the infusion device (Medtronic MiniMed 508) that is used for infusion of insulin, by continuous subcutaneous administration, 30 HCV genotype 1 (n=24) and 4 (n=6) patient accept 6,9 or 12MIU IFN α-2b (n=10/ group) every day.Then assess safety, toleration, dynamics of virus and pharmacokinetics.Has the previous history that treatment unresponsiveness (n=20), recurrence (n=7) or virus is broken through (n=3) during the former PegIFN-α of the patient who in this research, comprises/RBV treatment.N=13 position patient has liver cirrhosis when the treatment beginning.Permission records the HCVRNA feminine gender in the 24th when week by TaqMan HCV check, and (patient of LLD＜15IU/mL) finishes the treatment of 48 weeks.

C. PRELIMINARY RESULTS:

In the 4th when week, use respectively 6,9 and 12MIU IFN-α/sky, observe 1.19 (95%C10.55-1.83), 1.21 (95%CI 0.38-2.04) and 2.67 (95%CI 2.38-2.97) log ₁₀The average HCV RNA decay of IU/mL (12MIU with respect to 9MIU/6MIU, p＜0.0001).IFN-alpha levels dose dependent ground increases, and reaches peak level between 48 hours and the 1st week, succeeded by steady-state level.Between 48 and 96 hours, the 1-(2-amino-4-hydroxy-6-pteridinyl)-1,2,3-propanetriol level similarly increases in 3 groups, has higher a little steady-state level in the 12MIU group.6,9 and 12MIU IFN-α/sky, the HCV RNA that was implemented in for the 24th week in 2 (20%), 5 (50%) and 5 (50%) patients is negative respectively.The AE major part is slight to medium, normally IFN-α-relevant.6 SAE of 5 patient experiences, comprise: at the community acquired pneumonia in the 10th week, diarrhoea, dehydration and heating in the 12nd week, upper respiratory tract infection in the 6th week, injection site reaction in the 18th week, the epilepsy (all 12MIU) that brings out in the hyperglycemia in the 21st week subsequently, and at the injection site reaction (9MIU) in the 12nd week.SAE can cause 3 patients' treatment time-out and 3 patients' permanent interruption; 4 in them have liver cirrhosis.Do not observe with patient's pump and handle relevant problem.

D. preliminary analysis:

9 and 12MIU/ days dosage, the continuous subcutaneous administration of IFN-α in the patient who is difficult to treat shows the high the 24th all response rates.Compare with lower dosage, every day, 12MIU IFN-α showed obvious stronger HCV RNA decline when the 4th week.Found that good safety and toleration distribute.Be appreciated that the relevant adverse events of typical interferon in the maximum dose level group in 12MIU IFN-α/sky and in liver cirrhosis patient, seem more remarkable.

2. the sign of the aspect of preliminary clinical testing data

Some important parameters when present disclosure has been established by continuous h inf with interferon-' alpha ' treatment hepatitis.

The SCIN-C test that (Erasmus Medical Center) carries out in the Erasmus medical center in the Rotterdam, NED city is 3 groups (therapeutic scheme) research, has 10 experimenters in each group/scheme.Interferon-' alpha ' dosage in the test is to use 6MIU, 9MIU and 12MIU by pump every day, uses concomitantly the oral ribavirin based on body weight.Patient under study for action is former treatment loser, and all is genotype 1 or 4.Treatment in the past and the specific data of some experimenter are shown in following table 2.

Table 2-SCIN-C number of subjects certificate

Based on the data from this table, we have following summary statistics:

Genotype 124/30 (80%), the 12nd all interferon-' alpha ' nonresponder the 10/30 (33%), the 24th all HCV positives 12/30 (40%), recurrence/bounce-back 8/30 (26.7%).Verified in clinical practice, be difficult to most again treat the 12nd all nonresponders, and recidivist and bounce-back person's treatment difficulty is minimum.

In research process, the blood levels of measurements interference element-α, the patient's who is produced by the therapeutic scheme that uses in this test pharmacokinetics and pharmacodynamics information (such as average interference element-α and neopterin concentrations) for example are presented among Fig. 1.Be presented at the data acknowledgement among Fig. 1, have the strong dose response to the interferon-' alpha ' of using according to disclosed therapeutic scheme.The data that are presented among Fig. 1 further confirm, send the interferon-' alpha ' of higher concentration according to the therapeutic scheme that uses in this test, can cause the interferon-' alpha ' of the correspondingly higher concentration that continues in vivo.

Fig. 2 has shown the viral attenuation curve in the patient of interferon-' alpha ' resistance seriously (so and these patients be difficult to treatment).As shown in Figure 2, in 6MIU/ days treatment groups, there are 5 experimenters to show significant resistance.In these 5 experimenters, only patient 8 shows sane replying in the 8th week, subsequently bounce-back.In the former treatment, all these 5 experimenters treated unsuccessfully in the 12nd week or the 24th week.5 experimenters with more sane HCV decay in Fig. 3, have been shown.

The data that Fig. 3 provides show steadily and surely replying in the 6MIU treatment group.In the lowest dose level treatment group,

recording patient

2 and 3 by the quantitative RNA test in the 24th when week is that virus is negative, but is measured as the positive by the qualitative high sensitivity test when the 24th week, and withdraws from research.Other experimenter proceeds research.

In 9MIU/ days groups, there is the experimenter of 4 interferon-' alpha ' resistances.This data show is in Fig. 4 A.More interested is that 6 bit tables in 10 experimenters of 9MIU/ days groups reveal steadily and surely replys.Data show is in Fig. 4 B.In these experimenters of 9MIU/ days groups, be the interferon-' alpha ' resistance in the former PEG treatment all.

In 12MIU/ days treatment groups, there is not the experimenter of interferon-' alpha ' resistance.3 experimenters withdraw from, but 9 have shown quite sane replying up to now, as shown in Figure 5.The dynamics of virus summary data is shown in following table 3-5.

Show 3-6MIU/ days treatment groups

Show 4-9MIU/ days treatment groups

Show 5-12MIU/ days treatment groups

3. the discussion of data:

EVR (EVR) is defined as, and in the patient with low initial virus load, virus load is reduced by at least 2log or virus feminine gender before the 12nd week.The EVR also clinical success with final is relevant consumingly, but does not resemble the RVR strong.In SCIN-C test, 4 (50%) among 8 patients with the viral data that record realized EVR at 6MIU/ days in the treatment group, and 3 (50%) among 6 patients with the viral data that record realized EVR at 9MIU/ days in the treatment group.In maximum dose level group (12MIU/ days), all 6 experimenters' (100%) that arrived for 12 weeks show EVR.

Virus negative (VN) is the continuous demands of SCIN-C scheme when the 24th week.Not that the negative patient of virus is interrupted in this research when the 24th week.In 6MIU/ days treatment groups, 1 (12.5%) among 8 experimenters with 24 weekly datas is that virus is negative, and 2 experimenters still are in the treatment.At the middle dosage of 9MIU/ml, 2 (25%) among 8 experimenters with 24 all measurement results are that virus is negative, and 3 experimenters are still in treatment.In 12MIU/ days treatment groups, 2 experimenters have reached VN when the 24th week, and 2 experimenters are virus-positives when the 24th week, and 3 experimenters are retained in the treatment.

Viral attenuation data when 4 time-of-week point as shown in Figure 6.Shown in the curve among this figure, when 4 week, between dosage, there is significant difference.This is more clearly shown by Fig. 7, the figure illustrates the virus decay (all patients) that realizes by administration.

Data provided herein show, with oral ribavirin based on weight, using insulin pump is safe and effective by h inf continuous administration interferon-' alpha ', and confirm first, by the blood levels of control interferon-' alpha ', we can obtain the dynamics of virus of dose dependent.Although this data acknowledgement the effectiveness of disclosed method in the patient of experience chronic hepatitis C treatment, it will be understood by those skilled in the art that, these methods can be used for originally patient for the treatment of hepatitis c, also consider the importance of for example carrying out the scheme of observing, with produce higher treatment success rate (rather than, for example, adopt the conventional therapy scheme of observing, to have higher mortality).

II. the additional analysis of clinical testing data

As noted above, for clinical trial, with 1: 1: 1 ratio randomization, use insulin pump to accept 6,9 or 12MIU IFN α-2b (Medtronic MiniMed 508) totally 48 weeks every day by continuous subcutaneous administration 30 HCV genotype 1 (n=24) and 4 (n=6) patients.All patients in test accept the ribavirin (1000-1600mg) based on body weight.Having analyzed the blood serum designated object (1-(2-amino-4-hydroxy-6-pteridinyl)-1,2,3-propanetriol, 2,5-oligoadenylate synthetase OAS], B2M) of HCVRNA level, serum I FN-alpha levels, immune activation, external T cell proliferation and IFN-γ generates.T=0,4,8,12,24,48,72,96 hours, the 1st, 2,3,4 and 24 weeks after treatment, collect blood sample.Use clinical trial, assessment safety and toleration, and study former dynamics of virus (nonreply: n=20 for the treatment of among the failed patient; Recurrence: n=7; Or virus breaks through: n=3).6,9 and 12MIU group in, liver cirrhosis is present in respectively among 3,3 and 7 patients.

Virological response is shown in following table 6.In the 4th week, 6,9 and 12MIU IFN-α/sky, observe 1.19 (95%C10.55-1.83), 1.21 (95%CI 0.38-2.04) and 2.67 (95%CI2.38-2.97) log respectively ₁₀The average HCV RNA decay of IU/ml (12MIU with respect to 9MIU/6MIU, p＜0.0001).Among the nonresponder before 20, record by the PCR during the treatment, 9 become HCV RNA feminine gender, and 3 reach SVR (accept 12MIU/ days for 2, accept 9MIU/ days for 1).

Based on the HCV RNA load in the 4th when week, we identify n=13 respondent (＞2log declines), n=10 centre respondent's (1-2log decline) and n=5 nonresponder's (＜1log decline).In the respondent, observe the decay of typical two-phase virus.Have during in the 4th week all patients (n=5) of the virological response that realize to continue after 48 weeks for the treatment of＞the HCV RNA of 2log descends.IFN-alpha levels dose dependent ground increases, and reaches peak level between 48 hours and the 1st week, succeeded by stable state.The respondent realizes the IFN-alpha levels (in 4th week, average 304.0 with respect to 160.2pg/ml) higher than the nonresponder.Between 48 and 96 hours, in all patients, 1-(2-amino-4-hydroxy-6-pteridinyl)-1,2,3-propanetriol similarly increases, and has higher steady-state level in accepting 12MIU/ days patient.In all patients, B2M increases mediumly; In the respondent, observe higher baseline values (average 16.9 with respect to 13.4ug/ml).2,5-OAS level reached peak value between 24 and 96 hours, slow-decay does not have difference in respondent and nonresponder subsequently.When carrying out In vitro culture with IFN-α in Most patients, baseline T cell proliferation reduces consumingly, and this prompting is to the responsiveness of IFN-α, no matter therapeutic outcome.But, at T=24 hour, in the nonresponder, observe IFN-α about the desensitization of T cell proliferation to cell especially.When external use IFN-α cultivates, baseline IFN-y production is the variable between the patient.When external use IFN-α cultivates, T=0 and T=24 hour, in limited nonresponder's group, observe the unresponsiveness that IFN-γ produces.

AE in most of the cases is slightly to moderate, and is the typical case of IFN-α treatment, but development stimulates and/or abscess 5 patients at the place, injection site.Reported 6 kinds of serious adverse events (SAE) in 5 experimenters, this causes the lasting interruption in 3 experimenters.All SAE are consistent with high dose IFN-α treatment.In the interruption that is caused by SAE, 2 experimenters accept 12MIU/ days, and 1 patient accepts 9MIU/ days dosage.

Clinical testing data shows that former PegIFN-α/RBV treats among the failed patient, and the continuous IFN-α treatment of high dose can be induced the strong HCV RNA decay when the 4th week.Serum interferon-alpha levels can be predicted and reply, but other immune activation mark can not.As a result, test shows, in the colony that this is difficult to treat, uses the continuous pump treatment, can send safely the dosage of IFN-α.The typical relevant AE of IFN-α shows dose dependent.In deliberately treatment was analyzed, it was 20% (6/30) that SVR leads.In meeting program analysis, it is 25% (6/24) that SVR leads, and wherein 4 in 6 of high dose group reach SVR.By the successful management of side effect, sending continuously of IFN-α can show significant clinical benefit.Interesting ground, before the treatment beginning and soon afterwards, external T cell and IFN-γ propagation can identify unlikely makes the patient who replys.

Table 6: virological response: (by

Ampliprep/ HCV checks undetectable HCV RNA, LLD＜15IU/mL).

As for example in this embodiment and in the accompanying drawings disclosed data confirm, send interferon-' alpha ' concentration according to therapeutic scheme disclosed herein and can produce in vivo the interferon-' alpha ' concentration that continues, and these body internal interference element that continues-α concentration can be used for eliminating HCV with comparing according to conventional therapy scheme number in the cards in the infected individual of big figure more.Particularly, accept every day by continuous subcutaneous administration 6,9 or 12MIU IFN α-2b continue in the patient, to have realized SVR in each group in 48 weeks.Be not subjected to the constraint of specific scientific theory, surprising the replying of observing in the patient of routine treatment refractory may be derived from the interferon-' alpha ' with following effectiveness threshold value: (1) only about 50% according to the patient of conventional therapy Regimen Chemotherapy in satisfy (may be partly because the speed of different ectogenic interferon-' alpha ' metabolism in the Different Individual/removing); (2) thus when using the cyclical level of keeping the interferon-' alpha ' among the patients serum by the continuous infusion device and be higher than the lasting time period of Css (for example at least 100-700pg/mL) (for example at least 1-48 week), in the patient of big figure more, satisfy.

As disclosed herein, the patient who accepts lasting 48 weeks of 12MIU IFN α-2b by continuous subcutaneous administration every day organizes the optimum (for example SVR) that shows in response to this therapeutic scheme, next is patient's group of accepting 9MIU IFN-α, then is patient's group of accepting 6MIU IFN-α.These results confirm, the dosage of the IFN-α that uses to the patient is relevant with result (for example SVR), this observed result is further consistent with following observed result: in clinical trial, the respondent realizes the IFN-alpha levels (in 4th week, be respectively average 304.0 with respect to 160.2pg/ml) higher than the nonresponder.Simultaneously, from the Notes of Key Data of clinical trial, use in this way interferon-' alpha ' and can reduce the dependent adverse side effect of dosage, when described adverse side effect usually occurs in and uses the interferon-' alpha ' of these dosage according to the conventional therapy scheme.Be not subjected to the constraint of specific scientific theory, it is believed that, the dosage of the interferon-' alpha ' of using in this way can not produce the adverse side effect with the interferon-' alpha ' dosage same degree of using according to the HCV therapy based on IFN-α of routine, because the continuous administration of this treatment molecule can be avoided the continuous fluctuation of the serum levels of very high interferon-' alpha ' serum-concentration and this treatment molecule, described continuous fluctuation can occur in the conventional H CV therapy, and contingent untoward reaction and/or general uncomfortable seriousness when being considered to promote to use such therapy (for example inject weekly interferon, inject every day such as interferon-' alpha ' etc.).

Data from clinical trial show, by use ribavirin with the 6MIUIFN-α that comes infusion via continuous subcutaneous administration/sky (continuing for 48 weeks) combinedly, can obtain SVR in the patient of conventional IFN-α/ribavirin HCV treatment refractory.Data from clinical trial show that further serum interferon-alpha levels indication patient replys.Shown in Figure 1A, within the period in 4 weeks, the patient who accepts 6MIU IFN-α/sky by continuous infusion reaches the average serum concentration that is higher than 100pg/mL, and these average serum interferon-' alpha ' levels are usually above 200pg/mL.Be not subjected to the constraint of specific scientific theory, data acknowledgement from clinical trial, in the patient of some refractory, the serum-concentration that is higher than 100pg/mL or 200pg/mL is to be higher than threshold value IFN-α concentration, when reaching described threshold value IFN-α concentration, it can induce and/or promote patient's replying lastingly therapeutic scheme.

Data from clinical trial show, by use ribavirin with the 9MIUIFN-α that comes infusion via continuous subcutaneous administration/sky (continuing for 48 weeks) combinedly, can obtain SVR in the patient of conventional IFN-α/ribavirin HCV treatment refractory.Data from clinical trial show that further the serum levels indication patient of ectogenic interferon-' alpha ' replys.Shown in Figure 1A, within the period in 4 weeks, the patient who accepts 9MIU IFN-α/sky by continuous infusion reach be higher than 200pg/mL, usually above the average serum IFN-α concentration of 300pg/mL.Similarly, show in the data shown in Fig. 8, in the 4th when week, undetectable HCV level and have approximately or be higher than exist between the patient of average serum IFN-α concentration of 300pg/mL related.Be not subjected to the constraint of specific scientific theory, data acknowledgement from clinical trial, in the patient of some refractory, the serum-concentration that is higher than 200pg/mL or 300pg/mL is to be higher than threshold value IFN-α concentration, when reaching described threshold value IFN-α concentration, it can induce and/or promote patient's replying lastingly therapeutic scheme.

Data from clinical trial show, by use ribavirin with the 12MIUIFN-α that comes infusion via continuous subcutaneous administration/sky (continuing for 48 weeks) combinedly, can obtain SVR in the patient of conventional IFN-α/ribavirin HCV treatment refractory.Data from clinical trial show that further serum interferon-alpha levels indication patient replys.Shown in Figure 1A, within the period in 4 weeks, the patient who accepts 12MIU IFN-α/sky by continuous infusion reach be higher than 300pg/mL, usually above the average serum IFN-α concentration of 400pg/mL.Similarly, show in the data shown in Fig. 8, in the 4th when week, in undetectable HCV level and have be higher than 300, be higher than 400 or be higher than exist between the patient of average serum IFN-α concentration of 500pg/mL related.Be not subjected to the constraint of specific scientific theory, data acknowledgement from clinical trial, in the patient of some refractory, the serum-concentration that is higher than 300pg/mL or 400pg/mL (or higher) is to be higher than threshold value IFN-α concentration, when reaching described threshold value IFN-α concentration, it can induce and/or promote patient's replying lastingly therapeutic scheme.

As noted above, show from the data of clinical trial, can in the patient of conventional IFN-α/ribavirin HCV treatment refractory, obtain SVR.As a result, that embodiment of the present invention have solved is long-standing, but not have the needs that solve, particularly compare the needs of elimination HCV in the infected individual of big figure more with using conventional therapy scheme number in the cards.In addition, although described clinical trial focuses on the patient of conventional IFN-α/ribavirin HCV treatment refractory, person of skill in the art will appreciate that embodiment of the present invention also can be used for treating originally patient.For example, the embodiment of the application of the invention is treated the patient who not yet experiences any previous therapeutic scheme, about 50% observe not the group of individuals that routine treatment is made the patient who replys and to be cured, needn't experience the conventional IFN-α of the failure in 48 weeks/ribavirin therapy scheme (with the expense relevant with such conventional therapy scheme and side effect etc.).

Embodiment 3: the Extraordinary therapeutic scheme

In typical embodiments of the present invention, can customize the therapeutic scheme according to parameter disclosed herein, considering may to affect the patient to the factor of the patient-specific of replying for the treatment of, such as the HBV genotype of infected patient and/or patient's body weight, treatment history, health status, individual ectogenic interferon-' alpha ' clearance rate etc.In an of the present invention exemplary embodiment relevant with the therapeutic scheme of patient-specific, the interferon-' alpha ' of using to the patient according to first therapeutic scheme, average or the intermediate circulating water that described first therapeutic scheme makes great efforts to generate the interferon-' alpha ' that falls in the target scope is flat, described target scope such as 100-200pg/mL (or 150-250pg/mL), 200-300pg/mL (or 250-350pg/mL), 300-400pg/mL (or 350-450pg/mL), is up to 700pg/mL etc.Then can obtain pharmacokinetics and/or pharmacodynamics parameter from the patient, thereby observe the patient specificity of this first therapeutic scheme is replied (the actual interference element in the blood of the particular patient that is for example caused by first therapeutic scheme-α concentration, the concentration of the hepatitis C virus that exists etc.) in the patient.Such empiric observation result has considered can affect the patient to the factor of the patient-specific of replying for the treatment of, for example the ectogenic interferon-' alpha ' metabolism/clearance rate of patient's uniqueness (for example, may affect the factor of the serum-concentration of interferon-' alpha ', described concentration-response reaches in the patient in the dosage of interferon-' alpha '), so, can be used for the therapeutic scheme of design patient-specific, for example can regulate the therapeutic scheme of the interferon-' alpha ' concentration (thereby for example comparing increase serum interferon-alpha levels with first therapeutic scheme that is administered to the patient) in the blood samples of patients.

Embodiment of the present invention comprise the Extraordinary therapeutic scheme, described therapeutic scheme is designed to generate lasting virological response, and one or more adverse side effects that alleviate simultaneously or avoid observing, caused by the tediously long therapeutic scheme that comprises interferon-' alpha ' dosage.Such as what point out in following paragraph, embodiment of the present invention are considered such as following factor: the index of total physiological health of patient (such as body mass index, whether wait such as the existence of the metabolic diseases such as diabetes); And/or the genotype of HBV virus and/or patient's ectogenic interferon-' alpha ' metabolic rate and/or single patient are in response to desensitization degree (about the T cell proliferation) of the T cell of interferon-' alpha ' etc., so that the therapeutic scheme of design personalized, described therapeutic scheme comprises: the time period of using the virological response that the interferon-' alpha ' of effective dose and antiviral nucleotide/nucleoside analog be enough to reach lasting.The Extraordinary therapeutic scheme comprises such scheme: it is designed to avoid to use the interferon-' alpha ' greater than the amount of critical quantity (reach lasting virological response required), and/or avoids using interferon-' alpha ' than the longer time period of crash time section (reach lasting virological response required).In this way, the Extraordinary therapeutic scheme can be treated the patient effectively, and alleviates simultaneously or the appearance of one or more adverse side effects of avoiding observing, caused by the therapeutic scheme that comprises interferon-' alpha ' dosage.

Single nucleotide polymorphism

Identified many different SNPs relevant from chronic HBV infection (referring to, such as people such as Mbarek, Hum Mol Genet.2011Oct 1; 20 (19): 3884-92, the people such as Obrien, gene Immun.2011Sep; 12 (6): 428-33; The people such as Zhang, Nat Genet.2010Sep; 42 (9): 755-8; With the people such as Huang, Gut.2011Jan; 60 (1): 99-107; Their content is incorporated this paper by reference into).Under this background, always inquire about such as Entrez and to intersect the data base such as database retrieval system (Entrez Global Query Cross-Database Search System) search engine can be provided, described search engine allows user's searching database on NCBI (NCBI) website.For example those of skill in the art will recognize that the Entrez snp database provides the single nucleotide polymorphism library, such as those disclosed in the people such as Mbarek.In this data base, name different polymorphic sequence schedulings (for example rs2856718 and rs7453920) with SNP.In table 8, provide and used such SNP name as the resulting exemplary SNP sequence of inquiry.In table 8, the polymorphic nucleotide of these SNP sequences is put into bracket (nucleotide position 27).

Table 8: exemplary single nucleotide polymorphism

rs2856718：

GTGTGGGAGGACAGGCCATGGGATTA[A/G]ACAGCTCTTCTTAACCTGCCAGAGG(SEQ?ID?NO：1)

rs7453920：

AGTGAAGAGGGCAGTCGGACCGATTC[A/G]ACATTGACCTCTGCTCTTAGATCAG(SEQ?ID?NO：2)

rs3077

TTCTTCTCACTTCATGTGAAAACTAC[C/T]CCAGTGGCTGACTGAATTGCTGACC(SEQ?ID?NO：3)

rs9277535

GACTGCAAATCTGCCTGATAGGACCC[A/G]TATTCCCACAGCACTAATTCAACAT(SEQ?ID?NO：4)

rs2284553

GCAGGGCTCAGAACTGTCCGGGTCCC[A/G]TCAGTGTTGGGGCGGAAGAGGAAGA(SEQ?ID?NO：5)

rs9808753

CAATAGCACGAGGCCTGTTGTCTACC[A/G]AGTGCAGTTTAAATAGTAAGCCGGT(SEQ?ID?NO：6)

rs17401966

AAAACAC?ATAGTGCCTCTATGAGTCC[A/G]TATTGAGTCAAGTGTTCTTAGAGGT(SEQ?ID?NO：7)

Claims

1. interferon-' alpha ' is in the purposes of producing the compositions that is used for the treatment of hepatitis B infection that is used for the continuous infusion device, wherein produce the interferon-' alpha ' compositions, keep to allow described continuous infusion device that the average cyclical level of interferon-' alpha ' is higher than at least at least 1 week at least 48 weeks of Css of 100pg/mL among the patients serum when the subcutaneous administration interferon-' alpha '.

2. purposes according to claim 1, wherein said interferon-' alpha ' is puted together with polyhydric alcohol.

3. purposes according to claim 1, wherein use described interferon-' alpha ' in being differentiated as the patient with the single nucleotide polymorphism relevant with chronic HBV infection (SNP), wherein said SNP is selected from: rs2856718, rs7453920, rs3077, rs9277535, rs2284553, rs9808753 or rs17401966.

4. purposes according to claim 1 is wherein used described interferon-' alpha ' in by the patient of hepatitis b gene type A or genotype D viral infection.

5. purposes according to claim 1 wherein after the hepatitis B e antigen state of measuring the patient, is used described interferon-' alpha ' in described patient.

6. purposes according to claim 1 is wherein used described interferon-' alpha ' 5,6,7,8,12,24, the persistent period in 36 or 48 weeks in the patient at least.

7. purposes according to claim 1, wherein said interferon-' alpha ' are kept the cyclical level of interferon-' alpha ' among the patient and are higher than at least 100,200,300,400,500,600 or the average steady state concentration threshold of 700pg/mL.

8. purposes according to claim 1, it comprises in addition: use lamivudine, adefovir dipivoxil, Entecavir, Sebivo or tenofovir two pyrrole furan esters to the patient.

9. purposes according to claim 1, wherein said interferon-' alpha ' make the levels of HBV among the patient reduce at least 2 logarithms (100 times) or 3 logarithms (1000 times) after 1,2,4,8,10,12,14 or 16 weeks.

10. system that uses interferon-' alpha ' be used for for the patient with hepatitis C infection, described system comprises:

Continuous infusion pump, described continuous infusion pump have the medicament that comprises interferon-' alpha ' and hold the pond;

Processor, described processor may be operably coupled to described continuous infusion pump, and comprising that instruction group, described instruction group cause described continuous infusion pump according to therapeutic scheme described interferon-' alpha ' to be administered to described patient, described therapeutic scheme comprises: give described patient's subcutaneous administration interferon-' alpha '; The cyclical level that wherein said therapeutic scheme is enough to keep interferon-' alpha ' among the described patients serum is higher than at least 1 week at least 48 weeks of Css threshold value.

11. system according to claim 10, wherein:

(a) described hepatitis C virus is genotype A HBV;

(b) described hepatitis C virus is genotype D HBV;

(c) before using described interferon-' alpha ', it is seropositive that described patient is accredited as hepatitis B e antigen;

(d) the described therapeutic scheme cyclical level that is enough to keep interferon-' alpha ' among the described patient is higher than at least 200,300,325,350,375,400,425,450,475,500,525,550,575,600,625,650,675 or the concentration of 700pg/mL;

(e) described therapeutic scheme is used the persistent period at least 4,8,12,24,36 or 48 weeks; Or

(f) described therapeutic scheme is enough to make after 1,2,4,8,10,12,14 or 16 weeks the level of HCV among the described patient to reduce at least 2 logarithms (100 times) or 3 logarithms (1000 times).

12. the system be used to using interferon-' alpha ' according to claim 10, wherein said system be used to using interferon-' alpha ' is attached to electronic system, and described electronic system is used for the medical data of management on electronic communication network, and described electronic system comprises:

Can connect at least one e-server of communicating by letter at described communication network, described at least one e-server is configured for:

Receive the information of relevant the first physiological parameter of in the patient, observing;

Based on described the first physiological parameter, set the first dosage by the described interferon-' alpha ' of described continuous infusion pump infusion;

Receive the second physiological parameter information of described patient, described the second physiological parameter information is indicated described patient replying the interferon-' alpha ' of described the first dosage; With

Based on described the second physiological parameter, set the second dosage by the described interferon-' alpha ' of described continuous infusion pump infusion.

13. system according to claim 10, wherein said continuous infusion pump:

Has the size less than 15x15 centimetre; Or

Operationally be attached to the interface of the motion of convenient described patient when using described continuous infusion pump, wherein said interface comprises clip, band, hasp, anchor clamps or strip of glue.

14. system according to claim 10, wherein said interferon-' alpha ' is not puted together with polyhydric alcohol.