CN103060331B - Preparation method and application of capsid-protein-mutant double-stranded recombinant adeno-associated virus containing mediated-membrane-stabile CD40L gene - Google Patents

Abstract

The invention discloses a nucleotide sequence and an amino acid sequence of a human derived membrane-stabilization mutant gene CD40L-M, and a plasmid carrier pdsAAV-CB-CD40L-M. The invention further discloses a recombinant adeno-associated virus scAAV2/5-Y719F-CD40L-M using CD40L-M as a target gene and highly-efficiently transducing lung cancer cells, a preparation method thereof, and an application thereof in preparing anti-cancer drugs. In vitro and in vivo tests of transduction of the CD40L-M gene into the lung cancer cells show that generation of the sCD40L is substantially reduced, a traditional AAV transduction efficiency is improved by using the recombinant adeno-associated virus scAAV2/5-Y719F-CD40L-M, the lung cancer cells can be highly-efficiently transduced, and the CD40L-M gene induces retardance of cell cycles, promotes cell apoptosis, induces immunization activation, inhibits growth of lung cancer in the body and reduces side effects such as liver and kidney damage.

Description

Mediation film is stablized double-stranded recombinant adeno-associated virus preparation method and the application of the capsid protein sudden change of CD40L gene

Technical field

The invention belongs to biotechnology and medical field, be specifically related to mediate double-stranded recombined glandulae correlation viral vectors and preparation method thereof and application that film is stablized the capsid protein sudden change of CD40L-M gene.

Background technology

Lung cancer is one of malignant tumour that China and even world's mortality ratio are the highest.Although the early diagnosis of lung cancer and complex therapy have obtained certain progress in recent years, still have 90% lung cancer to shift when finding, its 5 years survival rate less thaies 15%.Therefore, in the urgent need to finding the new way for the treatment of lung cancer primary tumor and metastasis thereof.

At present, immunogene treatment is regarded as one of the most promising oncotherapy mode.Tumour immunity relates to general immunity and local immunity, is comprising complicated process.Tumor microenvironment (microenvironment) is tumour cell and host immune system " battlefield (battlefield) ", studies confirm that it plays key effect to performance Host Anti-tumor Immunity.Tumour cell is in order to escape host's immune attack, in microenvironment, use the whole bag of tricks to go to weaken or strike back host's immunity system, such as: lower Human leucocyte antigen-Ⅰ quasi-molecule (HLA-I) and tumour antigen, secretory immune supressor, weaken costimulatory signal etc., thereby make host in immunosuppressive condition, hindered the systematic treating effect of tumor vaccine.Therefore, immunosuppression (immune-compromised) state of change tumor microenvironment is that immuno-stimulating (immune-competent) state is successfully to carry out the key of tumor immune gene therapy.

Research shows, the collaborative expression deletion of stimulating factor CD40L and the continuous expression of CD40 may be relevant to the immunosuppressive condition of the generation of tumour and the immunologic escape of tumour, tumor microenvironment.CD40L also claims gp39, relevant activator (the TNF associated activationprotein of tumour necrosis factor, TRAP), T cell-B cell activation molecule (Tcell-B cell-activating molecule, T-BAM), II type transmembrane glycoprotein for 33kD, 266aa, is one of focus of current immunogene treatment research altogether.Research is found, the cell cycle of the tumour cell capable of blocking that reacts to each other between CD40/CD40L, cell death inducing, improves the susceptibility of tumour cell to other inducer of apoptosis (as cis-platinum, TNF-α).CD40L can raise the expression of the endogenous polypeptide of tumour and costimulatory molecules, strengthens the present effect of CD40+ tumour cell to endogenous antigen, makes some tumor cell secretion more have the cytokine of immunostimulation; Can strengthen dendritic cell (Dendritic Cell, DC), the expression of the collaborative molecule such as the antigen presenting cell such as monocyte, B cell CD54, CD80, CD86, ICAM-I, LFA-4, promote itself and the intercellular interaction of T, strengthen the activation and proliferation of T cell; Also can suppress the generation of IL-10 and TGF-β, the Th1 reaction at induced tumor position, and then the generation of inhibition tumour.The combination of CD40L and CD40 can be induced the generation of various cytokines and chemokines, as IL-6, IL-8, IL-12, TNF-α, INF-γ etc.; The IL-12 that also can produce by induction raises the expression of T cell surface CD40L, with other costimulatory molecules (as B7-1, B7-2) synergy, impels the expression amount of CD40L to improve.DC excites B and the immunoreactive important efficient full-time antigen presenting cell of T cell mediated; CD40L increases the immunogenicity of tumour by the expression of activation DC rise epithelial cancer cells costimulatory molecules and the generation of cytokine; By stimulating the expression of the costimulatory moleculeses such as CD83 of DC, accelerate the maturation of DC phenotype; By induction peripheral blood mononuclear cell, make it be divided into the DC that expresses CD1a, CD80, CD83, HLA-DR.Meanwhile, CD40L also directly acts on T cell, by Flt3, produces stronger antitumor reaction with common reaction of CD40L; CD40L activates after DC, further improves again reacting to each other and immunological effect function between DC and T cell and tumour cell.Therefore; the interaction of CD40L and CD40 for the startup of activation, humoral immunization and the cellullar immunologic response of body antigen presenting cell, the raising of immunne response efficiency play an important role; this is regulating tumor microenvironment; in inducing antitumor immunity and inhibition tumor growth, there is very crucial status (Loskog AS, Eliopoulos AG:The Janus faces of CD40in cancer.Semin Immunol2009; 21:301-7.).At present, the treatment that CD40L is relevant has all obtained challenging curative effect in the pre-Clinical of B cell malignancies, multiple solid tumor and neoplasm metastasis.And the relevant methods for the treatment of of CD40L comprises and (as: 5-FU) or novel (as: oncolytic virus) method that associating is traditional also shows good curative effect in pre-Clinical.CD40L has become one of best goal gene of tumor immune gene therapy.

As other transmembrane glycoprotein, CD40L can be cut by matrix metalloproteinase at cell surface, discharges CD40L soluble fragments (sCD40L), and the latter can form tripolymer and enter circulation of blood, and in conjunction with CD40, performance biological action.Research prompting is in the patients such as autoimmune disorder, metabolism and cardiovascular disorder; blood plasma sCD40L level obviously increases; the latter has participated in (the Ferroni P that develops of above-mentioned disease; SantilliF; Guadagni F; Basili S, Dav ì G.Contribution of platelet-derived CD40 ligand to inflammation, thrombosis and neoangiogenesis.Curr Med Chem2007; 14:2170-80.).Part Study also finds, under the condition such as protein synthesis is not blocked, sCD40L can promote tumor growth.Therefore may there is potential danger because producing sCD40L in CD40L gene therapy.

For fear of the side effect of CD40L gene therapy, this project team is by the cleavage site Q of the matrix metalloproteinase of CD40L ₁₁₄k ₁₁₅d ₁₁₇q ₁₁₈n ₁₁₉sport P ₁₁₄r ₁₁₅e ₁₁₇e ₁₁₈d ₁₁₉, i.e. saltant type/film stable form CD40L(CD40L-M).The space structure of this film stable form CD40L monomer is without considerable change, application CD40L-M gene substitution wild-type CD40L(CD40L-WT) internal and external test of gene transfer lung carcinoma cell confirms, its sCD40L produces significantly and reduces, and direct antitumor action and host's Immunestimulatory effect is equal to is even better than CD40L-WT is safe and effective goal gene.

Another key element of gene therapy is to seek carrier safely and effectively.The high efficiency stable expression of foreign gene in object cell, i.e. the targeting of gene therapy, high efficiency and security, depend on the carrier system of gene therapy to a great extent.Good gene therapy vector possesses targeting, the advantages such as reaction and immune response have no side effect, do not cause inflammation.Adeno-associated virus (adeno-associated virus, AAV) have safely, host range is wide, and physical properties is stable, carry the multiple advantages such as goal gene long-term express and host immune response are little, thereby in gene therapy, obtain applying more and more widely.Up to now, existing 81 clinical treatments studies have shown that the validity of this carrier.Although the gene therapy that the AAV of take is carrier has obtained gratifying result in preclinical study and clinical trial, but that application is first-generation AAV mostly, still existent defect and limitation, comprise virus vector cell tissue preferendum (tropism), transduction efficiency and the xicity related problem of carrier dosage.Progress along with Molecular Virology and AAV fundamental research; utilize AAV different serotypes (Wang J; Faust SM, Rabinowitz JE.The next step in gene delivery:molecular engineering of adeno-associated virus serotypes.J Mol Cell Cardiol.2011; 50 (5): 793-802.), self complementary AAV (self-complementary AAV, scAAV) (McCarty DM.Self-complementary AAV vectors; Advances and applications.Mol Ther.2008; 16 (10): 1648-56.) and AAV capsid protein point mutation (Zhong L; Li B; Mah CS; Govindasamy L; Agbandje-McKenna M, et al.Next generation of adeno-associated virus2vectors:point mutations in tyrosines lead to high-efficiency transduction at lower doses.Proc Natl Acad Sci U S is A.2008; 105 (22): 7827-32.) etc. the AAV of new generation of strategy improvement is expected to overcome the shortcoming and defect of first-generation AAV.

The AAV hypotype that AAV different serotypes is named with serotype is so far divided into AAV1-AAV12, mainly take the mankind and primate as host.The structure of various serotype A AV carriers adopts " heterozygosis " strategy conventionally, be the ITR that AAV vector plasmid all adopts AAV2, and AAV rep cap Gene Partial adopts the rap gene of all or part of AAV2 and the cap gene " heterozygosis " of different serotypes AAV, packing AAV out just has the genome of AAV2 carrier, and the capsid that wraps up it is other serotype A AV viral capsid of non-AAV2.Such as AAV2/5 carrier; just have AAV2 2 ITR, be positioned at therapeutic gene expression cassette between the two and the capsid of AAV5; so its infection characterization (Hildinger M consistent with AAV5; Auricchio A; Gao G; Wang L, Chirmule N, Wilson JM.Hybrid vectors based on adeno-associated virus serotypes 2 and 5 for muscle-directed gene transfer.J Virol.2001; 75 (13): 6199-203.).Although the virus of different AAV serotypes all has the structure of icosahedron, the diversity of its capsid protein on sequence and space conformation, makes the bind receptor of its cell surface and the preferendum of cell is existed to significant difference.Research is at present found; AAV2/5 and the AAV2/6 transduction efficiency advantage in lung and airway epithelial is remarkable; our seminar is once with the different serotypes AAV lung carcinoma cell of transduceing respectively; the transduction efficiency of results suggest AAV2/5 is compared with high (the Wu JQ of other serotype; Zhao WH; Li Y; Zhu B, Yin KS.Adeno-associated virus mediated gene transfer into lung cancer cells promoting CD40ligand-based immunotherapy.Virology.2007; 368 (2): 309-16.), be secondly AAV2/6.---the crosslinked sialic acid of N in the quantity of airway epithelia compared with the acceptor of other AAV---the sulfuration heparin protein-polysaccharide quantity showed increased that further studies confirm that the main acceptor of AAV5, and AAV2/6 has above two kinds of acceptors.

The traditional AAV of self complementary type AAV is strand AAV (ssAAV), needs to synthesize transcribing of ability promotor gene through genomic the second chain genomic double-stranded speed limit (rate-limiting) step that is considered to its transduction process that transforms of AAV.Self complementary AAV(scAAV) or be called double-stranded AAV(dsAAV) overcome the synthetic obstacle of viral the second chain DNA in AAV transduction process, therefore in multiple target tissue, particularly experiment in vitro, show fast and efficiently and express.

The point mutation of AAV capsid protein recently, xicity related for reducing the possible dosage of virus vector, and also for reducing the dosage of virus vector in clinical gene therapy from now on, Srivastava etc. have reported the AAV of new generation of AAV capsid protein point mutation simultaneously.Investigators are by AAV ₂seven tyrosine residuess (Y) on the determined AAV2 of the being exposed to capsid protein of crystal structure analysis surface one by one rite-directed mutagenesis are phenylalanine (F), to reduce the phosphorylation of AAV2 tyrosine residues in born of the same parents' fortune process, and reduce the capsid protein ubiquitination starting subsequently, thereby make AAV2 escaped identification and the degraded of proteasome.Experiment in vivo and vitro proves, the AAV2 injected dose of new generation of capsid protein point mutation reduces in 10 times of situations, foreign gene still can improve nearly 30 times at the expression efficiency of murine hepatocarcinoma cell, and wherein, carrier (AAV2-Y730F) transduction efficiency of viral capsid proteins 730 site Y → F sudden change is the highest.

At present, the scAAV that there is not yet report both at home and abroad and be the shell tyrosine residues sudden change of which kind of the serotype lung carcinoma cell of efficiently transduceing, also has nothing to do in building the gland relevant viral vector of the stable CD40L gene of film and the report of Antioncogene treatment application thereof.

Summary of the invention

Goal of the invention: in order to overcome the deficiencies in the prior art, technical problem to be solved by this invention is to provide a kind of people source film and stablizes mutator gene CD40L-M, and its nucleotide sequence is as SEQ ID No:1.

Wherein, the construction process of plasmid vector pdsAAV-CB-CD40L-M, at source clone pcDNA3.1 ⁺in the goal gene fragment of-CD40L-WT, by special primer, design, high-fidelity DNA polymerase pcr amplification, self connect to process introduce point mutation, then by subclone, obtain pdsAAV-CB-CD40L-M plasmid vector.

A recombinant adeno-associated virus scAAV2/5-Y719F-CD40L-M, it comprises CD40L-M gene.

Wherein, recombinant adeno-associated virus scAAV2/5-Y719F-CD40L-M, to select from the wild body of double-stranded adeno-associated virus (scAAV) of self complementation of different serotypes and mutant, the restructuring AAV2/5 carrier of self complementation that coat protein 719 site tyrosine residues point mutation are phenylalanine.

Wherein, the preparation method of recombinant adeno-associated virus scAAV2/5-Y719F-CD40L-M, adopt three plasmid co-transfection method encapsidated adenovirus correlated virus, purified, after concentrated, Slot-blot measures virus titer, during AAV packing, by selecting the pAAV-R/C of different wild-types or coat protein saltant type AAV, and existing pdsAAV-GFP and pHelper helper plasmid be packaged into scAAVX-R/C-GFP(wherein X be expressed as ten natural numbers of 1-10) virion, from different serotype scAAV wild-type and saltant type carrier, by the expression efficiency of transduction lung carcinoma cell GFP gene, select the most effective carrier scAAV2/5-Y719F-GFP of transduction lung carcinoma cell, again with three plasmid pAAV2/5-Y719F-R/C, pdsAAV-CB-CD40L-M, pHelper cotransfection method, prepare scAAV2/5-Y719F-CD40L-M.

Wherein, the application of recombinant adeno-associated virus scAAV2/5-Y719F-CD40L-M in preparation treatment lung-cancer medicament.

Technical scheme: for solving the problems of the technologies described above, the technical solution adopted in the present invention is as follows: a kind of people source film is stablized mutator gene CD40L-M, and its nucleotide sequence is as SEQ ID No:1.

Wherein, the aminoacid sequence of CD40L-M coded by said gene is compared and is had following sudden change with the aminoacid sequence of the human CD 40 L of GenBank report: the 114th amino acids becomes Pro by Gln, the 115th amino acids becomes Arg by LVs, the 117th amino acids becomes Glu by Asp, the 118th amino acids becomes Glu by Gln, and the 119th amino acids becomes Asp by Asn.

Wherein, plasmid vector pdsAAV-CB-CD40L-M, it comprises CD40L-M gene, and wherein, the construction process of plasmid vector pdsAAV-CB-CD40L-M is at source clone pcDNA3.1 ⁺in the goal gene fragment of-CD40L-WT, by special primer, design, high-fidelity DNA polymerase pcr amplification, self connect to process introduce point mutation, then by subclone, obtain pdsAAV-CB-CD40L-M plasmid vector.

Wherein, recombinant adeno-associated virus scAAV2/5-Y719F-CD40L-M, it comprises CD40L-M gene, wherein, recombinant adeno-associated virus scAAV2/5-Y719F-CD40L-M, to select from the wild body of double-stranded adeno-associated virus (scAAV) of self complementation of different serotypes and mutant, the restructuring AAV2/5 carrier of self complementation that coat protein 719 site tyrosine residues point mutation are phenylalanine.

Adeno-associated virus of the present invention is to carry out on known double-stranded recombined glandulae correlation viral vectors 1-10 serotype basis

Transformation obtains, described adeno-associated virus structure gene is Rep and Cap gene, the surperficial tyrosine residues in approximately 730 sites of the Cap gene of coding AAV1-10 capsid protein is sported respectively phenylalanine, i.e. pAAV2/1-Y731F-R/C, pAAV2-Y730F-R/C, pAAV2/3-Y731F-R/C, pAAV2/4-Y729F-R/C, pAAV2/5-Y719F-R/C, pAAV2/6-Y731F-R/C, pAAV2/7-Y732F-R/C, pAAV2/8-Y733F-R/C, pdsAAV2/9-Y731F-R/C, pAAV2/10-Y733F-R/C.

By the homology of AAV2 and AAV2/5 gene being compared and crystal structure analysis is found: 719 sites, AAV2/5 capsid protein surface are corresponding to the tyrosine residues in AAV2 capsid protein 730 sites.By transformation AAV2/5 capsid 719 site tyrosine residuess, be phenylalanine, the scAAV2/5-Y719F of new generation of acquisition can further improve the transduction efficiency of AAV carrier to lung carcinoma cell, becomes the optimum carrier that carries CD40L-M gene therapy lung cancer.

The preparation method of recombinant adeno-associated virus scAAV2/5-Y719F-CD40L-M, adopts three plasmid co-transfection methods packing AAV, purified, concentrated after, Slot-blot measures virus titer.During AAV packing, pAAVX-R/C(by selecting different wild-types or coat protein saltant type AAV wherein X is expressed as ten natural numbers of 1-10), and existing pdsAAV-GFP and pHelper helper plasmid are packaged into scAAVX-R/C-GFP virion, from different serotype scAAV wild-type and saltant type carrier, by the expression efficiency of transduction lung carcinoma cell GFP gene, select the most effective carrier scAAV2/5-Y719F-GFP of transduction lung carcinoma cell, again with three plasmid pAAV2/5-Y719F-R/C, pdsAAV-CB-CD40L-M, pHelper and human embryo kidney 293 cells cotransfection method, prepare scAAV2/5-Y719F-CD40L-M.

The present invention, with scAAV2/5-Y719F-CD40L-M transduction lung cell A549 and human embryo kidney 293 cells, detects CD40L and the expression of CD40L-M in lung carcinoma cell with sxemiquantitative RT-PCR; With the gene induced cell-cycle arrest of flow cytometry checking CD40L-M, promote apoptotic effect, with ELISA method, detect the minimizing of potential inflammatory factor sCD40L secretory volume; The immature dendritic cell (iDCs) in induction person monocytic cell strain THP-1 source, with A549 and iDCs after transduction, cultivate altogether, the expression amount checking CD40L-M induction iDCs that detects mature DCs marker protein IL-12 in cell conditioned medium by ELISA method is ripe, by immuno-stimulating, indirectly kills and wounds lung carcinoma cell; In the body of tumor-bearing mice, experiment has also confirmed that scAAV2/5-Y719F-CD40L-M has effect of anti-lung cancer, and liver kidney side effect is simultaneously less.

The application of above-mentioned recombinant adeno-associated virus scAAV2/5-Y719F-CD40L-M in preparation treatment lung-cancer medicament.Recombinant adeno-associated virus scAAV2/5-Y719F-CD40L-M, be preserved in Chinese Typical Representative thing preservation center in Wuhan University, preservation date November 26 in 2012, deposit number: CCTCCNO:V201252 Classification And Nomenclature: mediation film stablize the double-stranded recombinant adeno-associated virus that the capsid protein of CD40L gene suddenlys change.Preservation address: Wuhan University's preservation center, Wuchang District, Wuhan City, Hubei Province (Wuhan University the first affiliated primary school opposite).

Beneficial effect: the present invention's application CD40L-M gene substitution wild-type CD40L(CD40L-WT) internal and external test of gene transfer lung carcinoma cell confirms, its sCD40L produces significantly and reduces, for improving AAV gene transfer efficiency, the double-stranded AAV(self-complementary AAV of development and application self complementation, scAAV) the serotype virus and outside AAV2, the scAAV2/5-Y719F-CD40L-M that the builds capsid protein point mutation lung carcinoma cell of efficiently transduceing, the gene induced cell-cycle arrest of CD40L-M, promote apoptosis, induction antitumor immunity of organism, suppress lung cancer growth, side effect is little.This gene therapy medicament of the present invention is expected to for the preparation of anti-Gene Therapy for Lung Cancer new drug.

Accompanying drawing explanation

Figure 1A is pcDNA3.1 ⁺-CD40L and pcDNA3.1 ⁺-CD40L-M is with Xho I and the evaluation of EcoR I double digestion, and 1% agarose gel electrophoresis is shown as two fragments of about 850bp and 4800bp.(the pcDNA3.1 of 1,2 and 3 swimming lane: XhoI and EcoRI digestion ⁺-CD40L; 5, the pcDNA3.1 of 6 and 7 swimming lane: XhoI and EcoRI digestion ⁺-CD40L-M; 4 and 8 swimming lanes: DNAmarker).Figure 1B is CD40L and the CD40L-M space structure figure of monomer separately;

Fig. 2 A is that pdsAAV-CB-CD40L identifies through BamH I/HindIII and BamH I/Sac I double digestion respectively; (1 swimming lane: pdsAAV-CB-CD40L cuts through BamH I/HindIII enzyme; 2 swimming lanes: pdsAAV-CB-CD40L cuts through BamH I/Sac I enzyme; M swimming lane: DNAmarker);

Fig. 2 B is that pdsAAV-CB-CD40L-M identifies through BamH I/HindIII and BamH I/Sac I double digestion respectively.(1 swimming lane: pdsAAV-CB-CD40L-M cuts through BamH I/Hind III enzyme; 2 swimming lanes: pdsAAV-CB-CD40L-M cuts through BamH I/Sac I enzyme; M swimming lane: DNA marker);

Fig. 2 C is pdsAAV-CB-CD40L and pdsAAV-CB-CD40L-M part sequencer map;

Fig. 2 D is pdsAAV-CB-CD40L-M plasmid map;

Fig. 3 A is the partial amino-acid series of different serotypes AAV case surface, wherein cap gene 730 sites of scAAV2 are tyrosine residues, because of the conservative property of various AAV sequences, the corresponding site of other scAAV serotypes be respectively 731(AAV1), 731(AAV3), 729(AAV4), 719(AAV5), 731(AAV6), 732(AAV7), 733(AAV8), 731(AAV9), 733(AAV10);

Fig. 3 B is non-auxiliary virus packaging system three plasmids (pdsAAV-GFP, pAAVX-R/C, pHelper) cotransfection method packing scAAVX-GFP simple process;

Fig. 4 A and Fig. 4 B are different serotypes scAAVX-GFP and mutant carrier transduction people lung cancer A549 cell thereof transduction efficiency (fluorescent microscope * 100, pixels after 48 hours ²/ the visual field * 10 ⁴, other groups of * p<0.001vs);

Fig. 4 C and Fig. 4 D are different serotypes scAAVX-GFP and mutant carrier transduction mouse lung cancer LLC cell thereof transduction efficiency (fluorescent microscope * 100, pixels after 48 hours ²/ the visual field * 10 ⁴, other groups of * p<0.001vs);

Fig. 5 dot blot method is measured titre (scAAV2/5-CD40L:1.3 * 10 of viral scAAV2/5-CD40L-M and scAAV2/5-Y719F-CD40L-M ¹³v.g./ml, scAAV2/5-Y719F-CD40L:5 * 10 ¹¹v.g./ml, scAAV2/5-CD40L-M:1 * 10 ¹³v.g./ml, scAAV2/5-Y719F-CD40L-M:5 * 10 ¹¹v.g./ml, (v.g./ml:vector genomes/ml, the genome containing in the virion of every ml virus liquid copy sum));

Fig. 6 A experiment in vitro, scAAV2/5-Y719F-CD40L or scAAV2/5-Y719F-CD40L-M are by each cell 1 * 10 ⁴virion transduction A549 cell is after 48 hours, and sxemiquantitative RT-PCR records the mrna expression amount of CD40L or CD40L-M gene.Both no difference of science of statistics;

Fig. 6 B experiment in vitro, ELISA method detects the secretory volume of the rear cell conditioned medium sCD40L of transduction.Transduction 24h, after 48h and 72h, sCD40L expression amount prompting in A549 cell conditioned medium liquid: in CD40L/A549 group cell 48h and 72h supernatant liquor, the expression amount of sCD40L significantly increases compared with the expression amount of sCD40L in control group, unloaded group and CD40L-M group cell conditioned medium liquid, difference has significance (* p<0.01), and the expression amount of 24h is without difference; Expression level and empty carrier group and the equal no significant difference of control group of sCD40L in CD40L-M/A549 group cell conditioned medium liquid;

Fig. 6 C experiment in vitro, after the transduction of results virus, the tumour cell of 12h, 24h and 48h, adopts PI dyeing, and flow cytometer detects apoptosis and the cell cycle of tumour cell;

Fig. 6 D experiment in vitro, flow cytometer detects A549 apoptosis rate after treatment.The apoptosis rate there was no significant difference of the apoptosis rate of CD40L/A549 group cell 24h, 48h and CD40L-M/A549 group cell 24h, 48h, and this apoptosis rate of two groups is all significantly higher than unloaded group and control group (* p<0.05);

Fig. 6 E experiment in vitro, flow cytometer detects A549 cell cycle distribution figure after treatment.CD40L/A549 and CD40L-M/A549 are at 24h and 48h, and cell-cycle arrest is significantly higher than control group and unloaded group (* p<0.05) in the G0/G1 phase; And its G2/M and S phase correspondingly reduce compared with control group and unloaded group;

Fig. 6 F experiment in vitro, THP-1 cell is progressively induced to differentiate into Immature DC through cytokine.THP-1 cell is through rhGM-CSF and rhIL-4 induction, the bright cell of second day roundlet starts cluster, it is irregular that the 5th day cell shape becomes, what have bears feeler, through flow cytometer, detects, and THP-1 is through induction rear surface molecule CD1a, CD80, CD83 and CD86 raise, and CD14 lowers, and prompting monocyte transforms to Immature DC;

Fig. 6 G experiment in vitro, A549 cell is after treatment measured with iDC its supernatant inflammatory factor IL-12 secretory volume after mixing common cultivation, Transwell to cultivate altogether 48 hours.CD40L/A549 and CD40L-M/A549 mix respectively cultivation altogether with Immature DC or Transwell cultivates 48h altogether, survey respectively its supernatant IL-12 level.At common 6 orifice plates, CD40L/A549 group and CD40L-M/A549 group Interleukin-12 Production are significantly higher than control group and unloaded group (* p<0.01), and difference with insignificance between group.Give respectively the pre-treatment of CD40L monoclonal antibody, CD40L/A549 group and CD40L-M/A549 group Interleukin-12 Production reduce.At Transwell culture plate, CD40L/A549 group and CD40L-M/A549 group Interleukin-12 Production are significantly higher than control group and unloaded group (* p<0.01), but significant difference between group, CD40L/A549 group Interleukin-12 Production is higher than CD40L-M/A549 group (* p<0.05);

Experiment in Fig. 7 A body, scAAV2/5-Y719F-CD40L-M treats the effect of lung cancer in nude mice growth-inhibiting.After gene therapy, tumor growth suppresses obviously, and knurl body rate of growth slows down, and to the 30th day, treatment group gross tumor volume was less than control group and unloaded group (* p<0.01).ScAAV2/5-Y719F-CD40L treatment group tumour inhibiting rate 50.35%, between 58.75%, two group of scAAV2/5-Y719F-CD40L-M treatment group tumour inhibiting rate, relatively there were significant differences (* p<0.05);

Experiment in Fig. 7 B body, scAAV2/5-Y719F-CD40L-M treatment affects nude mice hepatic and renal function.After gene therapy, scAAV2/5-Y719F-CD40L-M treatment group serum alanine aminotransferase (ALT) and blood urea nitrogen (BUN) level are all compared with scAAV2/5-Y719F-CD40L treatment group low (* p<0.05);

The preparation process sketch of Fig. 8 recombinant adeno-associated virus scAAV2/5-Y719F-CD40L-M.

Embodiment

Implementation method is ordinary method if no special instructions, concrete steps can be referring to < < Molecular Cloning:A Laboratory Manual > > (Sambrook J, Russell David W, Molecular Cloning:A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor).

Described percentage concentration is mass/volume (W/V) percentage concentration or volume/volume (V/V) percentage concentration if no special instructions.

The primer, DNA sequence dna synthesize and determined dna sequence completes by American I nvitrogen company; Source clone pcDNA3.1 ⁺purchased from Invitrogen company.

The cell strains used such as murine lung cancer cell LLC, human lung cancer cell A549 and human embryo kidney 293 cells are geriatrics section of Nanjing Medical University laboratory maintenance.

PdsAAV-GFP expression plasmid, pAAVX-R/C plasmid and pHelper plasmid etc. is so kind as to give by Arun professor Srivastava of medical college of Univ Florida USA.

IL-12p70ELISA test kit is purchased from Genetimes company.

Enzyme used is all purchased from U.S. Roche company.

Below in conjunction with accompanying drawing, recombinant adeno-associated virus scAAV2/5-Y719F-CD40L-M of the present invention and preparation method thereof is further described in the application aspect lung cancer therapy with it.

Embodiment 1:

As Figure 1A and Figure 1B, pcDNA3.1 ⁺-CD40L-M builds and identifies.Concrete steps are: 1. pcDNA3.1 ⁺-CD40L plasmid construction and evaluation.The separated people's mononuclearcell of peripheral blood; Cell total rna extracting and cDNA transcribe; RT-PCR amplifying target genes CD40L(upstream primer: 5 '-CCGGAATTCCCAGAAGATA-3 ', downstream primer: 5 ' CCGCTCGAGTCAGCTCCA-3 ', product size: 850bp); With restriction enzyme EcoR I and Xho I by goal gene fragment and pcDNA3.1 ⁺carrier (purchased from Invitrogen) connects; PcDNA3.1 ⁺-CD40L plasmid transforms and identifies.2. pcDNA3.1 ⁺-CD40L-M plasmid construction and evaluation.With source clone pcDNA3.1 ⁺-CD40L designs and synthesizes primer and introduces change point (Q ₁₁₄k ₁₁₅d ₁₁₇q ₁₁₈n ₁₁₉for P ₁₁₄r ₁₁₅e ₁₁₇e ₁₁₈d ₁₁₉); High-fidelity DNA polymerase platinum pfx DNA Polymerase (Invitrogen) carries out pcr amplification; PCR product is carried out to end smoothly and 5 ' end phosphorylation reaction, then carry out self ligation, product transformed competence colibacillus cell DH5a; Selected clone is identified.

By pcDNA3.1 ⁺-CD40L and pcDNA3.1 ⁺two kinds of recombinant plasmids of-CD40L-M are through restriction enzyme EcoRI and the evaluation of XhoI double digestion, and 1% agarose gel electrophoresis is shown as two fragments (Figure 1A) of about 850bp and 4800bp.Recombinant plasmid pcDNA3.1 ⁺-CD40L sequencer address confirms that in nucleotide sequence and Genebank, human CD 40 L cDNA gene order (NM000074) matches.PcDNA3.1 ⁺-CD40L-M plasmid sequencer address confirms the Q of hCD40L ₁₁₄k ₁₁₅d ₁₁₇q ₁₁₈n ₁₁₉site mutation is P ₁₁₄r ₁₁₅e ₁₁₇e ₁₁₈d ₁₁₉(Gln ¹¹⁴to Pro ¹¹⁴, Lys ¹¹⁵to Arg ¹¹⁵, Asp ¹¹⁷to Glu ¹¹⁷, Gln ¹¹⁸to Glu ¹¹⁸, Asn ¹¹⁹to Asp ¹¹⁹, and Pro ¹²⁰to Ser ¹²⁰) wherein red arrow show mutating alkali yl.CD40L and CD40L-M individual space structure have no change (Figure 1B).

Embodiment 2:

As Fig. 2 A and 2B, pdsAAV-CB-CD40L-M plasmid construction and evaluation.Concrete steps are: pcDNA3.1 1. increases ⁺-CD40L-M and pdsAAV-CB-GFP, primer is T7 and T405-R(T405-R:CTTAGGAGCTCGTCGACGTCGAGGCTGATCAGCGGGT), CD405-R primer has added SacI restriction enzyme site and protection base; Then use BamHI and SacI double digestion PCR product, be cloned in object carrier in pdsAAV-CB-GFP; Choose the inspection of mono-clonal bacterium, positive colony order-checking, obtains the clone consistent with standard sequence.

Embodiment 3:

As Fig. 3 A, the base sequence in different serotypes AAV case surface approximately 730 sites and AAV2/5 mutational site build.To AAV2 and the capable homology comparison of AAV2/5 gene and crystal structure analysis, determine that the amino acid in 719 sites, AAV5 capsid protein surface corresponds respectively to the tyrosine residues in AAV2 capsid protein 730 sites.Use Quik iISite-Directed Mutagenesis Kit(Alignment Technologies) standard point sudden change test kit.First synthesize sudden change chain: DNA profiling sex change, with the mutant primer annealing that comprises required sudden change, use Pfu archaeal dna polymerase carries out primer and prolongs life, building 719 site tyrosine (Y) the coding base point mutation of AAV2/5 virus capsid protein is the pAAV2/5-Y719F-R/C plasmid (primer AAV2/5-Y719-F:CCCATTGGCACCAGATTCCTGACGCGTAATCTGTAATTGCTT G, AAV2/5-Y719-R:CAAGCAATTACAGATTACGCGTCAGGAATCTGGTGCCAATGG G) of phenylalanine (F) coding base.DpnI digestion methylates and hemimethylation parent DNA profiling, i.e. pAAV2/5-R/C; The molecule of sudden change is transformed into competent cell and repairs otch; Screening positive clone, send and checks order and survey total length, obtains pAAV2/5-Y719F-R/C plasmid.

Embodiment 4:

As Fig. 4 A, 4B, 4C, 4D, with the expression of different serotypes scAAVX-GFP and mutant carrier transduction people's lung cancer A549 cell and mouse lung cancer LLC cell GFP gene after 48 hours.(Fig. 3) as stated above, pdsAAV-GFP expression plasmid, pAAVX-R/C or pAAVX-R/C mutant plasmid and pHelper plasmid with expressing green fluorescent protein (GFP) reporter gene, press calcium phosphate three plasmid cotransduction human embryo kidney 293 cells methods, collecting cell after 72h, 5 circulations of freeze thawing, Benzonase digestion, obtains wild-type scAAVX-GFP and saltant type scAAVX-GFP virus after Iodixanol zonal centrifugation and heparin agar affinity column (heparin-agarose) purifying are concentrated.

A549/LLC cell is pressed 5*10 ⁴individual/hole is inoculated in 24 orifice plates, and nutrient solution is the DMEM liquid containing 10% foetal calf serum, 37 degree 5%CO ₂incubator is cultivated 12h.Whether observation of cell state is normal, counting cells.Press MOI value (v.g/cell) for 5*10 ⁵counting, adds scAAVX-GFP and mutant carrier thereof.After 1h, suck every hole liquid, add 1ml/ hole containing the DMEM liquid of 10% foetal calf serum, after 48 hours, under fluorescent microscope, count fluorocyte, and carry out semi-quantitative analysis (pixel with Image J software ²/ the visual field * 10 ⁴).Calculate transduction efficiency, select the scAAV2/5-Y719F-GFP carrier that transduction efficiency is the highest (being 72% in A549 cell transduction efficiency, is 63% at LLC cell).

Embodiment 5:

As Fig. 5, packaging virus scAAV2/5-CD40L-M and scAAV2/5-Y719F-CD40L-M, dot blot method is measured viral titre.Use Quik iI Site-Directed Mutagenesis Kit(Alignment Technologies) standard point sudden change test kit.First synthesize sudden change chain: DNA profiling sex change, with the mutant primer annealing that comprises required sudden change, use Pfu archaeal dna polymerase carries out primer extension, building AAV2/5 virus coat egg is the pAAV2/5-Y719F-R/C plasmid (primer AAV2/5-Y719-F:CCCATTGGCACCAGATTCCTGACGCGTAATCTGTAATTGCTT G, AAV2/5-Y719-R:CAAGCAATTACAGATTACGCGTCAGGAATCTGGTGCCAATGG G) of phenylalanine (F) coding base from 719 site tyrosine (Y) coding base point mutation.DpnI enzymic digestion methylates and hemimethylation parent DNA profiling, i.e. pAAV2/5-R/C; The molecule of sudden change is transformed into competent cell and repairs otch; Screening positive clone, send and checks order and survey total length, obtains pAAV2/5-Y719F-R/C plasmid.With pdsAAV-CB-CD40L and pdsAAV-CB-CD40L-M plasmid, pAAV2/5-Y719F-R/C plasmid and pHelper plasmid (Arun professor Srivastava of medical college of Univ Florida USA is so kind as to give), press calcium phosphate method cotransfection HEK293 cell (http://www.med.upenn.edu/gtp/vector_core/production.shtml), collecting cell after 72h, 5 circulations of freeze thawing, Benzonase digestion, after Iodixanol zonal centrifugation and heparin agar affinity column (heparin-agarose) purifying are concentrated, obtain scAAV2/5-Y719F-CD40L and scAAV2/5-Y719F-CD40L-M virus.With a- ³²p label probe, quantitatively DNA Slot blot measures virus titer.Result shows scAAV2/5-Y719F-CD40L:5 * 10 ¹¹v.g./ml, scAAV2/5-Y719F-CD40L-M:5 * 10 ¹¹v.g./ml.

Embodiment 6:

As Fig. 6 A, 6B, 6C, 6D, 6E, 6F, 6G, virus is by each cell 10 ⁴transduction A549 cell, after 48 hours, extracts RNA, and reverse transcription becomes cDNA, and row RT-PCR detects CD40L expression amount (primer CD40L (132bp), sense:5 '-TGA GCAACAACT TGG TAA CCC TGG-3 '; Antisense:5 '-CTG GCTATA AAT GGA GCT TGA CTC G-3 '; Trizol is purchased from Invitrogen company; SYBR PCR kit for fluorescence quantitative is purchased from Toyobo company).ELISA method (sCD40LELISA detection kit is purchased from bender company) is measured cells and supernatant sCD40L generation, and flow cytometer (U.S. company BD FACSAria) detects cell cycle and apoptosis amount.With rhGM-CSF and rhIL-4(PeproTech company) induction Immature DC, cultivate altogether or Transwell(Corning company with the rear A549 cytomixis of transduction) cultivate altogether, detect respectively and cultivate rear supernatant liquor DC maturity symbol IL-12 level (IL-12p70ELISA test kit is purchased from Genetimes company) to assess its immune induction effect.

Fig. 6 A experiment in vitro, scAAV2/5-Y719F-CD40L or scAAV2/5-Y719F-CD40L-M are by each cell 1 * 10 ⁴virion transduction A549 cell is after 48 hours, and sxemiquantitative RT-PCR records the mrna expression amount of CD40L or CD40L-M gene.Both no difference of science of statistics.

Fig. 6 B experiment in vitro, ELISA method detects the secretory volume of the rear cell conditioned medium sCD40L of transduction.Transduction 24h, after 48h and 72h, sCD40L expression amount prompting in A549 cell conditioned medium liquid: in CD40L-WT/A549 group cell 48h and 72h supernatant liquor, the expression amount of sCD40L significantly increases compared with the expression amount of sCD40L in control group, unloaded group and CD40L-M group cell conditioned medium liquid, difference has significance (* p<0.01), and the expression amount of 24h is without difference.Expression level and empty carrier group and the equal no significant difference of control group of sCD40L in CD40L-M/A549 group cell conditioned medium liquid.

Fig. 6 C experiment in vitro, after the transduction of results virus, the tumour cell of 12h, 24h and 48h, adopts PI dyeing, and flow cytometer detects apoptosis and the cell cycle of tumour cell.

Fig. 6 D experiment in vitro, flow cytometer detects A549 apoptosis rate after treatment.The apoptosis rate there was no significant difference of the apoptosis rate of CD40L/A549 group cell 24h, 48h and CD40L-M/A549 group cell 24h, 48h, and this apoptosis rate of two groups is all significantly higher than unloaded group and control group (* p<0.05).

Fig. 6 E experiment in vitro, flow cytometer detects A549 cell cycle distribution figure after treatment.CD40L/A549 and CD40L-M/A549 are at 24h and 48h, and cell-cycle arrest is significantly higher than control group and unloaded group (* p<0.05) in the G0/G1 phase; And its G2/M and S phase correspondingly reduce compared with control group and unloaded group.

Fig. 6 F experiment in vitro, THP-1 cell is progressively induced to differentiate into Immature DC through cytokine.THP-1 cell is through rhGM-CSF and rhIL-4 induction, the bright cell of second day roundlet starts cluster, it is irregular that the 5th day cell shape becomes, what have bears feeler, through flow cytometer, detects, and THP-1 is through induction rear surface molecule CD1a, CD80, CD83 and CD86 raise, and CD14 lowers, and prompting monocyte transforms to DC.

Embodiment 7:

As Fig. 7 A, 7B, lung cancer subcutaneous transplantation knurl model is set up: 37 ℃, 5%CO in people's lung cancer A549 cell RPMI-1640 ₂under saturated humidity condition, cultivate.24 nude mices, in 5-6 week, body weight 18-25g raises and experiment under SPF condition.Tumor cell injection, to Bal/c nude mice (Nanjing Medical University's Experimental Animal Center provides) back, is inoculated to 5 * 10 for every ⁶cell.When tumour grows to 70mm ³-100mm ³time begin treatment, animal is divided into 4 groups at random by tumor size and body weight, 6 every group.Press virus titer, every group to virus 5 * 10 ¹⁰v.g./only.Animal condition monitoring, draws tumor growth curve; While treating 30 days, pluck the blood sampling of eyeball method, dry biochemical process (OLYMPUS AU64O) detects serum alanine aminotransferase (ALT) and blood urea nitrogen (BUN) level, and observing gene therapy affects hepatic and renal function.

After Fig. 7 A gene therapy, tumor growth suppresses obviously, and knurl body rate of growth slows down, and to the 30th day, treatment group gross tumor volume was less than control group and unloaded group (* p<0.01).ScAAV2/5-Y719F-CD40LT treatment group tumour inhibiting rate 50.35%, between 58.75%, two group of scAAV2/5-Y719F-CD40L-M treatment group tumour inhibiting rate, relatively there were significant differences (* p<0.05).

Experiment in Fig. 7 B body, after gene therapy, scAAV2/5-Y719F-CD40L-M treatment group ALT and BUN level are all compared with scAAV2/5-Y719F-CD40L treatment group low (* p<0.05).

As can be seen from the figure the CD40L-M virus that, contains goal gene is compared significantly and is reduced with wild-type the impact of hepatic and renal function.

Claims (2)

1. a recombinant adeno-associated virus scAAV2/5-Y719F-CD40L-M, it is characterized in that: deposit number: CCTCC NO:V20125, preservation date on November 26th, 2012, Classification And Nomenclature: mediation film is stablized the double-stranded adeno-associated virus of restructuring of the capsid protein sudden change of CD40L gene, has been preserved in Chinese Typical Representative thing preservation center.

2. the application of the recombinant adeno-associated virus scAAV2/5-Y719F-CD40L-M described in claim 1 aspect preparation treatment lung-cancer medicament.