CN103060281B - Fusion protein as well as coding gene and application thereof - Google Patents
Fusion protein as well as coding gene and application thereof Download PDFInfo
- Publication number
- CN103060281B CN103060281B CN201310028774.0A CN201310028774A CN103060281B CN 103060281 B CN103060281 B CN 103060281B CN 201310028774 A CN201310028774 A CN 201310028774A CN 103060281 B CN103060281 B CN 103060281B
- Authority
- CN
- China
- Prior art keywords
- sequence
- fusion rotein
- hydrogenlyase
- ethanol dehydrogenase
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Enzymes And Modification Thereof (AREA)
Abstract
The invention discloses a fusion protein as well as a coding gene thereof and application thereof. The fusion protein provided by the invention is protein which is obtained by in series connecting the connecting peptides of ethanol dehydrogenase and formate dehydrogenase. The ethanol dehydrogenase is from lactobacillus brevis and the formate dehydrogenase is from candida boidinii; the connecting peptides are rigid structures Linker (EAAAK). According to the experiment in the invention, the invention provides the fusion protein which is obtained by in series connecting the connecting peptides of ethanol dehydrogenase and formate dehydrogenase, wherein enzyme activity of the formate dehydrogenase is higher than the activity for independently expressing the formate dehydrogenase after the formate dehydrogenase is expressed in escherichia coli; moreover, the stability and heat stability of the ethanol dehydrogenase in organic substrate are also improved. The construction of the fusion protein provides important reference for the improvement to the preparation method for chiral alcohol and chiral hydroxy compound.
Description
Technical field
The present invention relates to biological technical field, relate in particular to a kind of fusion rotein and encoding gene thereof and application.
Background technology
The chiral alcohol with specific function group occupies critical role in chiral drug preparation, and it be multiple antiviral, antimycotic, antitumor and treat the important intermediate of the chiral drug of neural system, the disease such as cardiovascular.Therefore, the maturation of chiral alcohol synthetic method has positive promoter action to chiral drug synthetic with improving.
Enzyme catalysis method is high owing to having catalytic efficiency, be generally the more than 100 times of organic catalyst efficiency, and the purity of product is very high, reaction conditions gentleness, generally just can react at ambient temperature, therefore, in recent years enzyme catalysis method in the preparation research of chiral alcohol by extensive concern.Ethanol dehydrogenase has the advantage that catalytic efficiency is high and product enantiomeric purity is high and is widely used in the Study on Transformation of chiral alcohol, this enzyme belongs to a member of the oxydo-reductase superfamily (SDRs) of short chain, for homotetramer, the molecular weight of each monomer is 26.6kD, each monomer is containing 251 amino acid, and catalysis produces specific R-configuration product.But owing to needing the reduced coenzyme in consumption system in this enzyme catalysis process, the extra interpolation of reduced coenzyme significantly increases reaction cost.Therefore the method that in Development System, reducibility coenzyme is regenerated becomes the key of research.
Summary of the invention
An object of the present invention is to provide a kind of fusion rotein and encoding gene thereof.
Fusion rotein provided by the invention, for by ethanol dehydrogenase and hydrogenlyase by the connection peptides protein obtaining of connecting.
In above-mentioned fusion rotein, described connection peptides is (EAAAK)
2, be rigid structure linker, its aminoacid sequence is that sequence 2 is from N ' end 365-374 position.
In above-mentioned fusion rotein, described ethanol dehydrogenase derives from short lactobacillus (Lac tobacillus brevis), and described hydrogenlyase derives from Candida boidinii (Candida boidinii);
Specifically following (a) or (b) of described fusion rotein:
(a) protein being formed by the aminoacid sequence shown in sequence in sequence table 2;
(b) aminoacid sequence shown in sequence in sequence table 2 passed through to replacement and/or disappearance and/or the interpolation of one or several amino-acid residue and there is ethanol dehydrogenase and the alive protein being derived by sequence 2 of the two enzymes of hydrogenlyase.
The gene of above-mentioned fusion rotein of encoding is also the scope of protection of the invention.
Said gene is any DNA molecular in following (1)-(3):
(1) encoding sequence is the DNA molecular shown in sequence 1 in sequence table;
(2) the DNA sequence dna hybridization limiting with (1) under stringent condition and coding have the DNA molecular of ethanol dehydrogenase and the two enzyme living proteins of hydrogenlyase;
(3) DNA sequence dna limiting with (1) at least has 70%, at least have 75%, at least have 80%, at least have 85%, at least have 90%, at least have 95%, at least have 96%, at least have 97%, at least have 98% or at least have 99% homology and coding and have a DNA molecular of ethanol dehydrogenase and the two enzyme living proteins of hydrogenlyase.
Wherein in sequence table, sequence 2 is ethanol dehydrogenase from N ' end 375-625 position; Be linker from N ' end 365-374 position; Be hydrogenlyase from N ' end 1-364 position.
In sequence table, sequence 1 is alcohol dehydrogenase enzyme coding gene from 5 ' end 1123-1878 position; Be linker encoding gene from 5 ' end 1093-1122 position; Be hydrogenlyase encoding gene from 5 ' end 1-1092 position.
Recombinant vectors, expression cassette, transgenic cell line or the recombinant bacterium that contains said gene is also the scope of protection of the invention.
Above-mentioned recombinant vectors is that the gene of above-mentioned fusion rotein inserts in expression vector, obtains expressing the recombinant vectors of above-mentioned fusion rotein.In an embodiment of the present invention, expression vector is pETDuet-1, and recombinant vectors pETDuet-FDH-linker-ADH is specially sequence in sequence table 1 is inserted to the carrier obtaining between the NcoI of expression vector pETDuet-1 and XhoI restriction enzyme site.
Above-mentioned recombinant bacterium is that described recombinant vectors is imported in Host Strains, the recombinant bacterium obtaining.
Above-mentioned fusion rotein, said gene or above-mentioned recombinant vectors, expression cassette, transgenic cell line or recombinant bacterium improve hydrogenlyase enzymic activity or prepare ethanol dehydrogenase and/or hydrogenlyase in application be also the scope of protection of the invention.
Another object of the present invention is to provide a kind of method of preparing ethanol dehydrogenase and/or hydrogenlyase.
Method provided by the invention, the above-mentioned recombinant bacterium that comprises the steps: to ferment, collects tunning, obtains ethanol dehydrogenase and/or hydrogenlyase.
Of the present invention experimental results show that, the invention provides a kind of by ethanol dehydrogenase and hydrogenlyase by the connection peptides fusion rotein obtaining of connecting, this albumen is after expression in escherichia coli, keep the activity of two kinds of enzymes, and the enzymic activity of the hydrogenlyase in fusion rotein is high during compared with single expression, the situation when stability of the ethanol dehydrogenase after fusion in organic substrates and thermostability are all better than single expression.The raising of the enzymic activity that this fusion rotein shows and enzyme stability and the thermostability in organic substrates strengthens, point out this enzyme in the time that chiral alcohol and chiral hydroxyl group compound are prepared in catalysis, to there is the catalytic effect of advantage more, for the improvement of chiral alcohol and chiral hydroxyl group compounds process for production thereof provides reference.
Brief description of the drawings
Fig. 1 is recombinant bacterium abduction delivering SDS-PAGE analytical results
Fig. 2 is the residual activity result of ADH under different methyl phenyl ketone concentration
Fig. 3 is the residual activity result of ADH under differing temps
Embodiment
The experimental technique using in following embodiment if no special instructions, is ordinary method.
Material, reagent etc. used in following embodiment, if no special instructions, all can obtain from commercial channels.
The acquisition of embodiment 1, fusion rotein and encoding gene thereof
Ethanol dehydrogenase (ADH) and the Candida boidinii Candida boidinii in the short lactobacillus that catalytic activity is high and enantio-selectivity is strong (Lactobacillus brevis) source selected in this research) hydrogenlyase (FDH) of originating, according to e. coli codon preferences principle, carry out respectively codon optimized to two enzyme genes.To between ethanol dehydrogenase and hydrogenlyase, add rigid structure linker(EAAAK)
2, obtaining fusion protein F DH-linker-ADH, the aminoacid sequence of this fusion rotein is the sequence 2 in sequence table.The encoding gene of this fusion rotein is the sequence 1 in sequence table.
Wherein in sequence table, sequence 2 is ethanol dehydrogenase from N ' end 375-625 position; Be linker from N ' end 365-374 position; Be hydrogenlyase from N ' end 1-364 position.
In sequence table, sequence 1 is alcohol dehydrogenase enzyme coding gene from 5 ' end 1123-1878 position; Be linker encoding gene from 5 ' end 1093-1122 position; Be hydrogenlyase encoding gene from 5 ' end 1-1092 position.
The application of embodiment 2, fusion rotein and encoding gene thereof
One, the structure of two enzyme co-expression carriers
1, the structure of recombinant vectors pETDuet-FDH-ADH
Carrier pGH-FDH containing FDH (containing FDH sequence, total order is classified sequence 3 as) is cut with NdeI and Xhol enzyme; 5364bp co-expression carrier pETDuet-1(Novagen, 71146-3 that the 1164bp enzyme obtaining is cut product and cut through same enzyme) skeleton connection, obtain intermediate carrier pETDuet-FDH;
Carrier pGH-ADH containing ADH (containing ADH sequence, total order is classified sequence 4 as) is cut with BamHI and NotI enzyme; The 768bp enzyme obtaining is cut product and is connected with the 6484bp intermediate carrier pETDuet-FDH skeleton of cutting through same enzyme, obtains recombinant vectors pETDuet-FDH-ADH(and cuts qualification correctly through enzyme).
2, the structure of recombinant vectors pETDuet-FDH-linker-ADH
Taking pGH-FDH as template, with FDHF:GACCATGGGCAAAATCGTTCTGGTTCTG, FLAR:TTTGGCCGCTGCTTCTTTGGCCGCTGCTTCTTTTT TGTCGTGTT is primer, obtains the PCR product of 1124bp; Taking pGH-ADH as template, taking FLAF:GCAGCGGCCAAAGAAGCAGCGGCCAAATCTAACCGTCTGGACADHR:GTCT CGAGTTACTGAGCGGTGTAAC as primer, obtain the PCR product of 791bp;
Taking above-mentioned two PCR products as template, be that primer merges PCR with FDHF and ADHR, obtain 1896bpPCR product (thering is the Nucleotide shown in sequence 1 in sequence table); 1896bpPCR product is cut with NcoI and XhoI enzyme, and the enzyme obtaining is cut product and connected with the co-expression carrier pETDuet-1 cutting through same enzyme, obtains recombinant vectors pETDuet-FDH-linker-ADH.
Through order-checking, this recombinant vectors is that sequence in sequence table 1 is inserted to the carrier obtaining between the NcoI of expression vector pETDuet-1 and XhoI restriction enzyme site.
Two, the structure of recombinant bacterium and abduction delivering fusion rotein
1, the structure of recombinant bacterium
Above-mentioned one two kinds of recombinant vectors pETDuet-FDH-ADH that obtain and pETDuet-FDH-linker-ADH are transformed respectively in intestinal bacteria Rosseta (DE3), obtain Rosseta (DE3)/pETDuet-FDH-ADH and Rosseta (DE3)/pETDuet-FDH-l inker-ADH.
2, recombinant bacterium abduction delivering fusion rotein
Rosseta (DE3)/pETDuet-FDH-ADH and Rosseta (DE3)/pETDuet-FDH-linker-ADH after transforming are coated with respectively to Amp
+flat board, picking positive transformant, in 37 DEG C of overnight incubation, is then pressed 1:100 inoculation respectively, and 37 DEG C, the about 3h of 200r/min shaking culture, add IPTG to final concentration 1mmol/L, 20 DEG C of induction 8h, centrifugal collection bacterial sediment is for subsequent use.PBS washed twice, resuspended with PBS, by the centrifugal 30min of 12000r/min after bacterial sediment ultrasonication, collect respectively supernatant liquor and the precipitation of every kind of bacterium, protein ingredient is carried out to SDS-PAGE analysis.
As shown in Figure 1,1 is that Rosseta (DE3)/pETDuet-FDH-linker-ADH (supernatant), 2 is that Rosseta (DE3)/pETDuet-FDH-linker-ADH (precipitation), 3 is that Rosseta (DE3)/pETDuet-FDH-ADH (supernatant), 4 is the marker that Rosseta (DE3)/pETDuet-FDH-ADH (precipitation), M are 10-230KDa to result; Can find out, having molecular weight in 1 and 2 is the expression of the fusion protein F DH-linker-ADH of 66.6KDa, and fusion rotein content in supernatant after the series connection of two enzyme is higher, illustrate that the fusion rotein that two enzymes are connected can realize solubility expression.And Rosseta (DE3)/pETDuet-FDH-ADH is not amalgamation and expression, but two kinds of enzymes are expressed respectively simultaneously.
After above-mentioned ultrasonication is described, the centrifugal supernatant liquor obtaining is FDH-linker-ADH crude enzyme liquid and FDH-ADH crude enzyme liquid.
Three, fusion rotein enzymic activity detects
1, the fusion rotein enzyme assay after two enzyme series connection
For the activity of the fusion rotein of two enzyme series connection in checking recombinant bacterium, the supernatant liquor of collecting after above-mentioned ultrasonication is carried out to following enzyme activity assay:
The mensuration of alcohol dehydrogenase enzyme (ADH) alive: enzyme reaction system comprises 100mmol/L buffer solution of potassium phosphate (pH value 7.0), 0.1mmol/LNADH, 1mMMgCl
2, 50mmol/L methyl phenyl ketone and 100ul ultrasonication crude enzyme liquid; Measure the lower liter of (surveying 60s) light absorption value at 340nm place.By typical curve y=0.011x+0.003(R
2=1) calculate the amount that consumes NADH of reacting.Mei Huo unit: it is a U of Ge Meihuo unit that per minute consumes the needed enzyme amount of 1 μ molNADH.
The mensuration of hydrogenlyase enzyme (FDH) alive: enzyme reaction system comprises 100mmol/L buffer solution of potassium phosphate (pH value 7.0), 0.5mmol/L NAD
+, 100mmol/L sodium formiate and 100ul ultrasonication crude enzyme liquid; Measure the rising of (surveying 60s) light absorption value at 340nm place.By typical curve y=0.011x+0.003(R
2=1) calculate the amount that generates NADH of reacting.Mei Huo unit: it is a U of Ge Meihuo unit that per minute produces the needed enzyme amount of 1 μ mol NADH.
Result as shown in Table 1 and Table 2, fusion rotein after series connection has the activity of ethanol dehydrogenase and hydrogenlyase, after tandem expression, the activity of ADH slightly declines, and the activity of FDH significantly improves before merging, may be by after the series connection of rigid structure connection peptides, the C end of FDH originally irregular space structure has formed the oriented structure that is easier to active performance, in addition, because ADH is homotetramer albumen, so its activity is subject to the impact of amalgamation and expression larger, demonstrates activity and slightly decline.These results suggest that the activity that still can keep preferably two enzymes after two enzymes are connected.
Table 1 is alcohol dehydrogenase enzyme measurement result alive
Can find out, Rosseta (DE3)/pETDUet-FDH-Linker-ADH has the catalytic activity of two kinds of enzymes, and FDH activity is improved.
2, stability and the thermostability of ADH in organic substrates is improved
In fusion rotein for two enzyme series connection in checking recombinant bacterium, bring into play the characteristic of the ADH of Main Function, the above-mentioned two FDH-linker-ADH crude enzyme liquids that obtain and FDH-ADH crude enzyme liquid carried out respectively to enzyme activity assay under different concentration of substrate and differing temps:
Stability analysis in organic substrates: the methyl phenyl ketone of crude enzyme liquid and different concns (20,40,80mmol/L) is mixed, and 30 ° of C are hatched after 2.5h, and the method by above-mentioned 1 is analyzed ADH activity of residual enzyme.
Thermal stability analysis: by crude enzyme liquid at a certain temperature (50,60,70 DEG C) after hatching 10min, place immediately 5min on ice, the method by above-mentioned 1 is analyzed ADH activity of residual enzyme.
Stability result in organic substrates as shown in Figure 2, can find out, the ADH relative enzyme work of FDH-linker-ADH crude enzyme liquid 20,40, under 80mmol/L methyl phenyl ketone is respectively 80.4,67.0,39.2(%) (with 5mm methyl phenyl ketone time activity count 100%);
The ADH relative enzyme work of FDH-ADH crude enzyme liquid crude enzyme liquid 20,40, under 80mmol/L methyl phenyl ketone is respectively 65.0,51.1,22.6(%) (with 5mm methyl phenyl ketone time activity count 100%);
Thermal stability analysis result as shown in Figure 3, can find out, the relative enzyme work of the ADH of FDH-linker-ADH crude enzyme liquid at 50,60,70 DEG C is respectively 56.8,51.4,30.5(%) (counting 100% with the enzymic activity at 30 DEG C).
The relative enzyme work of the ADH of FDH-ADH crude enzyme liquid crude enzyme liquid at 50,60,70 DEG C is respectively 53.6,33.3,20.0(%) (counting 100% with the enzymic activity at 30 DEG C).
Found out by result, although the ADH enzymic activity after series connection slightly declines, but high when in FDH-LinkerADH, the stability of ADH in organic substrates and thermostability are all compared with single expression, illustrate that the two enzyme tandem expression systems that build have strengthened the stability in organic substrates and the stability to temperature.
Claims (8)
1. a fusion rotein, for by ethanol dehydrogenase and hydrogenlyase by the connection peptides protein obtaining of connecting;
The aminoacid sequence of described connection peptides is that sequence 2 is from N ' end 365-374 position;
Described ethanol dehydrogenase derives from short lactobacillus (Lactobacillus brevis), and described hydrogenlyase derives from Candida boidinii (Candida boidinii);
Described fusion rotein is made up of the aminoacid sequence shown in sequence in sequence table 2.
2. the gene of fusion rotein described in coding claim 1.
3. gene as claimed in claim 2, is characterized in that: the encoding sequence of described gene is the DNA molecular shown in sequence 1 in sequence table.
4. contain recombinant vectors, expression cassette, transgenic cell line or the recombinant bacterium of gene described in claim 2 or 3.
5. recombinant vectors as claimed in claim 4, is characterized in that:
Described recombinant vectors is that the gene of fusion rotein described in claim 1 is inserted in expression vector, obtains expressing the recombinant vectors of fusion rotein described in claim 1.
6. recombinant bacterium as claimed in claim 4, is characterized in that: described recombinant bacterium is that described recombinant vectors is imported in Host Strains, the recombinant bacterium obtaining.
Described in claim 1 described in fusion rotein, claim 2 or 3 described in gene or claim 4 recombinant vectors, expression cassette, transgenic cell line or recombinant bacterium improve hydrogenlyase enzymic activity improve ethanol dehydrogenase thermotolerance or improve the stability of ethanol dehydrogenase in organic substrates or prepare ethanol dehydrogenase and/or hydrogenlyase in application.
8. prepare a method for ethanol dehydrogenase and/or hydrogenlyase, recombinant bacterium described in the claim 4 or 6 that comprises the steps: to ferment, collects tunning, obtains ethanol dehydrogenase and/or hydrogenlyase.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310028774.0A CN103060281B (en) | 2013-01-25 | 2013-01-25 | Fusion protein as well as coding gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310028774.0A CN103060281B (en) | 2013-01-25 | 2013-01-25 | Fusion protein as well as coding gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN103060281A CN103060281A (en) | 2013-04-24 |
| CN103060281B true CN103060281B (en) | 2014-12-10 |
Family
ID=48103180
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310028774.0A Expired - Fee Related CN103060281B (en) | 2013-01-25 | 2013-01-25 | Fusion protein as well as coding gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN103060281B (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107299074A (en) * | 2017-08-30 | 2017-10-27 | 山东省科学院生态研究所 | The construction method of hydrogenlyase engineered strain and application |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106188309B (en) * | 2016-07-14 | 2023-05-02 | 北京师范大学 | Anticoagulation fusion protein HA and application thereof |
| CN114539428B (en) * | 2021-02-20 | 2023-02-28 | 中国标准化研究院 | Fusion protein and application thereof |
| CN116904409B (en) * | 2023-04-17 | 2024-04-05 | 杭州力文所生物科技有限公司 | FDH mutant with improved protein soluble expression and encoding gene thereof |
| CN117603924B (en) * | 2023-04-25 | 2024-05-17 | 杭州力文所生物科技有限公司 | Formate dehydrogenase mutant with improved protein solubility expression and application thereof |
-
2013
- 2013-01-25 CN CN201310028774.0A patent/CN103060281B/en not_active Expired - Fee Related
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107299074A (en) * | 2017-08-30 | 2017-10-27 | 山东省科学院生态研究所 | The construction method of hydrogenlyase engineered strain and application |
| CN107299074B (en) * | 2017-08-30 | 2020-06-16 | 山东省科学院生态研究所 | Construction method and application of formate dehydrogenase engineering strain |
Also Published As
| Publication number | Publication date |
|---|---|
| CN103060281A (en) | 2013-04-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN103060281B (en) | Fusion protein as well as coding gene and application thereof | |
| CN102618513B (en) | Carbonyl reductase, gene and mutant and application thereof to asymmetrical reduced carbonyl compound | |
| CN102120971B (en) | Pullulanase-producing bacterium, heat-resisting pullulanase produced from same, and coding gene of pullulanase-producing bacterium | |
| WO2008126784A1 (en) | Method for production of glutathione or ϝ-glutamylcysteine | |
| CN102492668B (en) | Carbonyl reductase and gene thereof as well as application of carbonyl reductase in asymmetrical reductive carbonyl compound | |
| CN104388373A (en) | Construction of escherichia coli system with coexpression of carbonyl reductase Sys1 and glucose dehydrogenase Sygdh | |
| CN109628433A (en) | A kind of Pullulanase and its application with hypersecretion ability | |
| US10612054B2 (en) | Single-cell factory for efficiently synthesizing α-aminobutyric acid and construction and application thereof | |
| CN104673810A (en) | Malic dehydrogenase gene MIMDH1 and recombinant expression vector thereof | |
| CN103642765A (en) | Alcohol dehydrogenase mutant and application thereof | |
| CN104805104A (en) | Trehalose synthase and coding gene and application thereof | |
| CN104673809A (en) | Malate dehydrogenase gene and recombinant expression vector thereof | |
| CN105296509B (en) | A kind of malate dehydrogenase gene RKMDH2 and its recombinant expression carrier | |
| CN103103234A (en) | Method for synthesizing nicotinamide adenine dinucleotide (NAD) by immobilized enzyme | |
| CN103468660B (en) | High reactivity neutral phytase mutant and gene thereof and purposes | |
| CN111019982B (en) | Method for preparing L-glufosinate-ammonium by using hydroxy acid dehydrogenase | |
| CN104561052A (en) | Recombinant formate dehydrogenase as well as preparation method and application thereof | |
| CN103966185A (en) | Double-enzyme system for efficiently synthesizing S-adenosylhomocysteine and application method thereof | |
| CN105779425A (en) | L-ribose isomerase and application thereof for biologically preparing L-ribose | |
| Li et al. | Cell surface engineering of a β-galactosidase for galactooligosaccharide synthesis | |
| CN105296513A (en) | Marine esterase as well as coding gene E22 and application thereof | |
| CN108410843A (en) | A kind of new Pullulanase and its encoding gene and application | |
| CN105734027B (en) | A kind of xanthine dehydrogenase and its encoding gene and application | |
| CN101979527B (en) | Reductase, reductase gene, recombinant enzyme, preparation method of recombinant enzyme and application | |
| CN104651337A (en) | Xylanase as well as encoding gene xyn-lxy and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20141210 Termination date: 20180125 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |